indexold -

Ristorante Sorrento

ristoranti in Penisola Sorrentina, il tuo ristorante preferito tra Sorrento, Massa Lubrense, Piano, Meta, Sant'Agnello o Vico Equense

 

11 teenagerku 1 tešinitových 6 Stromovité 2 SpamAssasin 2 Tevija 1 Spergulario 15 Technickému 1 sparrmanii 1 tríbarevnost 1 thingstodo 1 tilitu 1 Tracyine 1 Trínožky 1 veríci 30 spotrebitelský 1 vagorum 1 Stempniak 1 USCB 1 trachybazalty 159 TTL 2 s ilustracemi 1 Taittngerem 8 Stoljarov 4 Tuccinardi 81 Temüra 1 transferdaten 2 standadní 224 Soutok 6 váliví 3 SWV 2 Varely 3 Timesu 1 švekšenském 1 Torraye 1 Sourdine 2 Stehleovou 1 Superum 4 venovati 1 spisovel 3 Spisovnost 1 Tarhunzas 3 Tschager 4 Tabaquite 649 Tábora 1 Troungoumbé 1 Štítenka 2 supposé 1 tokerau 1 vejcovky 5 Stružnickým 1 tides 1 Teresiano 4 Turen 1 Stowové 12 statistikou 4 Sukoradech 1 STKF 2 Vboj 1 Trenn 1 Tschachvicium 8 Urianchajce 2 úctyhodnému 1 superheterodyne 2 Subacem 1 Trolese 2 Ulothrix 3 tenata 1 VÉMOLA 5 svedivá 76 svislým 1 theós 2 turron 1 Theatinerstraße 1 umberština 10 Theona 1 tragicnu 1 Stateville 1 Squiriou 1 Tolkiškes 1 troitskoe 2899 top 1 Thefakesoundofprogress 2 trinitárne 1 Squaxinském 1 stredoperských 2 Vathiménil 24 Vajecník 1 Tankerová 1 Tlaskal 2 Tippen 11 tmely 56 tyrosin 2 Ukrtelefilmu 1 Tonsorisa 2 velkomoffa 1 Sudíkovou 1 veterinárními 3 Thaicom 6 Torbergsdatter 31 svítilen 2 Tengkawang 1 ÚVERU 1 Triparadisu 2 Thuru 1 Tatsiana 2 Steinerta 1 Vavríkova 1 Tiphiidae 3 ukotvovaly 2 thymidinovými 3 twista 1 Taytu 58 Tippeligaen 2 Terenttila 1 upotrebitelného 6 Trením 1 Trudperta 1 Tschunko 1 Unterbergerem 1 Thingolovo 218 Tvrdost 4 Sýc 1 Vecerníckovi 1 Todeńa 5 tisícinásobne 2 Vetrnik 11 Veneux 1 supervidovaným 12 Uhaymir 1 stavilar 1 torresstrait 1 Tiyana 12 talírová 1 Svatobora 1 vasokonstrikce 2 Thiess 6 Sovetsku 1 Tochmanem 1 Vasilkovu 4 tantrou 2 Tarasiewicz 5 spojovatelné 1 trupel 1 Štetska 1 Tarauacá 1 Vagaru 1 textured 4 Trójcy 1 subGroup 1 svejch 6 UVK 1 tríslem 26 ustálena 4 Tarkumija 21 vekového 1 tootma 2 Verführten 1 tucnákitidu 3 vejírku 3 Strassburger 12 Vetšinové 3 spoletského 1 Trenganová 3 Stadtrecht 4 Valchou 12 ulovila 2 stráženého 5 Temne 1 Tempestt 1 Spinard 1 uríznuto 89 štetinami 2 Štock 1 stádia… 2 varyto 1 staión 117 Tepelná 71 Vantaa 2 stanoval 1 uslyšelo 6 vetvícím 1 svaigstan 2 tlingitský 1 Špagetové 83 velkýma 2 Timanskij 1 stropnici 172 SPAD 3 útca 1 Urickém 8 úchytné 17 Transsexuálové 116 termonukleární 1 Tejino 1 svejkovska 1 tykvemi 1 Tancírnou 11 Tortilla 12 Sutri 1 turkovický 1 toji 11 tenellus 1 Uruguayan 241 stretla 1 Styragel 4 utáhly 2 Štelcl 1 Tríkopec 1 upchlika 1 Suicides 10 tepének 1 transnistreana 2 tesarskému 8 Spreadsheet 2 tenorsaxofony 58 Tichon 2 Umee 2 Spotorno 1 Steatocranus 8 Tokwon 1 Trnkovem 1 Trogaz 1 sparbacherská 1 tarhat 4 Streetlife 1 Vegetují 148 Verí 1 summoning 33 tajní 2 Trelly 35 transpersonální 2 Tődva 141 spoluautorka 1 Upgrading 1 Terechová 1 Vestenické 2 spoluhodovníkum 6 Stenostiridae 1 strazi 47 Terrace 26 Studijního 3 Titanopteryx 2 szereti 3 Stoprocentním 1 Steffahny 51 unášet 1 Tihríské 206 transkripci 1 tribecské 1 Therinsfordu 1 težkoodenými 2 tseep 7 Švédovi 97 Trvalky 2 Vernillaca 1 Stroot 1 titernou 12 usvedcí 1 Venusiu 3 trachybazaltem 1 THERAP 1 súdánskonúbisjká 1 tridekanol 1 Spoke 4 Venamis 1 vayamos 23 veritas 2 Varrett 1 Tenevil 19 Tomori 2 Terumot 1 teikoplaninem 2 teofylin 5 utužené 8 Tippita 13 Tanguay 1 Tintner 1 svícicek 5 Triggery 1 umackání 1 Sprengkommando 11 ventricosa 1 Torpédoberec 1 Vasovec 1 Trimurti 1 Taškentským 34 spotrebování 1 urbanismo 14 taekwondu 2 Stoveovou 4 Stretto 7 Trocenková 3 Vaturi 645 Vatikánu 3 staggers 1 syringová 1 Strom 2 trustee 1 TDII 3 Špacince 1 turrachense 9 SRBOC 2 spiritistickou 1 uvedomiv 394 tyc 1 stesal 1 Theodoretta 4 Tynde 7 Velesova 10 šupinatka 1 Spartoka 2 spinales 1 taganrogskaja 1 Treka 1 Tendillo 3 venons 390 Trebaže 2 uttryck 2 Valérovi 1 tarvi 1 stredoneolitická 1 totam 1 trojnost 2 Trévron 1 stš 1 vábnejší 1 spinorem 1 torkama 1 Tarahumaru 3 SVAZARMu 3 Spektroskop 7 unavene 13 svárí 4 šumavanka 4 Töpen 48 statika 1 Sturgisu 4 sudeták 9 Tyrus 1 Sygurd 1 štítotoši 1 tunelovaní 1 Vadkovský 3 Sydowem 1 uhorívat 1 uccello 4 svedeckým 1 tyrosinkinázového 1 S následným 1 Trsatski 1 Umelému 14 Splnil 3 synapomorfiemi 6 Statik 673 Stanislaw 3 Thakhek 1 strey 111 tete 22 utrechtské 1 surgere 1 týkajícíh 2 SZEM 1 The English 2 Vabalkšnes 2 teplokrevným 7 stredu 9 uniklý 1 Tavernierem 131 stárnoucí 7 urologu 2 Thellungia 1 tokimeki 5 Stošu 1 spilitovou 1 terroristickém 2 Sudková 35 Šturma 1 Stengers 1 vesnovky 1 Tekstylno 48 Transvaal 1 Uldamanské 107 ukrajinskými 5 umble 1 úctového 1 UltraElectroMagneticPop 8 statisíci 2 Tenebruv 3 subiculum 1 trojicních 1 tunicu 75 Tankový 1 Umojský 1 Toldrá 1 Uppslagsverket 1 varabilního 2 Vahram 56 vagon 8 Trillu 1 Tumblru 5 Vesnicky 1 Spolti 1 stredodružky 67 Tarase 2 Tourves 1 theosof 1 úce 1 stránky 6 svetlému 20 spegazziniana 36 Valčncia 77 substitucí 1 Tokoj 3 Tubausiai 11 trojosé 1 tohlezkus 17 stoupavosti 1 Tfreak 1 Sprewicz 1 stromeckovým 1 taureánském 402 Trutnova 13 úlovku 42 trolejbusového 1 Tjaarda 2 Sredniawski 1 UREL 1 vendute 9 Svenja 2 Umurbrogol 17 suknice 1 spoluexistenci 1 svetrík 3 srbce 1 trachybazaltový 1 tiliarius 1 Terpkyj 4 Svitavice 10 Souness 1 Štírového 6 Thorstad 1 Susayeff 6 Splátkový 1 vesnicým 1 usedlejším 24 tricátým 5 ?t 1 spoluzabírících 1 Úctem 1 tokuiwaza 1 steatorhea 3 trolejovou 22 štrasburské 1 tuhatta 13 Ullmanna 1 Szwadron 6 Štaufskou 33 Úmysl 4 Štursovi 87 spolehlivostí 33 upozornily 4 vestibulum 1 uletení 1 Stehovalová 1 Stínovrah 1 trýznitel 1 svetlotisku 9 strništích 2 Uklízí 27 TÜV 8 Tribunály 1 Sturmmarsch 7 Totodile 9 Tillie 3 Trško 1 Ulitse 1 USLTA 1 uculují 1 termosek 1 TagEditor 1 spiknuti 1 Sucherman 1 Veintimiglia 1 Todesfabrik 1 stinec 2 uskupily 1 Vellereux 1 UBE 2 Strouhalovy 1 strežena 7 Transnacionální 3 trpnému 19 temno 1 spacebowl 1279 ucí 2 Újszínház 707 turistickou 1 TYKVA 1 Tumenu 15 Velicenstev 1 Tonea 1 Stseshyts 1 Starporträt 1 Útocníka 1 sumcík 6 Suchej 9 Sucremu 1 varšava 1 sravnenia 1 Ulpian 2 vanuatskou 1 sudárny 1 teiresias 4 štval 1 termin 1121 užívat 1 Stekloffa 1 ukradeni 2 Verbesina 3 Ustug 1 universitu v 1 Tohtamysh 36 Vau 1 Valaraukar 1 svazácky 1 Telecká 1 stanovické 14 svahového 1 tmavohlavý 126 souš 1 Šúrpanaka 2 tasm 3 usporádaností 8 stresuje 8 termoluminiscence 2 uchopená 1 válceného 1 Štibor 1 Tulbingský 173 terciární 5 ?arcu 1 Szpilowski 6 Spodoptera 34 težkostem 4 Sycerika 2 Ultiméciin 1 Stejšna 1 Trojúhelnícek 1 uncinulatus 8 Spolcení 1 staveno 5 Tupadly 1 startpointprize 1 Stronachlachar 1 Tabares 1 Tulikov 1 ThreadFiber 1 stríkoun 1 Splítková 7 Szathmáry 1 Verchenu 2 Špán 11 spásné 1 Ufnukánci 279 thepeerage 6 Supercupa 1 svátekm 11 tapíru 1 synergiemi 1 SPIDER 2 Türnitz 1 supportability 1 tartarea 2 Tassilly 1 Tuasu 7 suffolk 1 Szalóc 1 sutinou 1 Ticiniu 2 Urszuly 1 Torrenuv 1 tréfle 2 Vendôma 1 Tricoleodes 1 Tallové 124 Veril 1 udif 1 Trásnokrídlí 76 Stežejní 17 veky 1 umení Jana 1 taroucovské 2 vast 1 Traynard 2 špicovitých 2 Tendrement 1 Taoihae 1 sympatektomie 1500 stejnojmenného 1 Szydla 2 sredzki 14 Trejtnar 1 superglobálním 1 Toonen 12 Swatch 1 trápeny 1 VANICEK 1 Vernonove 1 Trebca 2 superlaseru 1 Undeclared 1 Standelmannem 115 velmoc 2 Svítkove 1 Vacsoracsata 1 Steavenson 1 Studiovým 3 svatojakubském 1 svárecí 1 Storato 2 Sunnitská 7 Verses 1 Turmalínová 1 Spolupilotoval 1 Vandet 6 Upita 4 Varilla 1 Toikko 1 Tobbe 2 Taichungu 1 Unterpreitenegg 2 trihexyfenidyl 4 TRF 1 Suđurstreymoy 1 Telekyovci 6 Tandja 1 sphaleros 1 továrne 1 stuholetka 1 Vaskoni 2 Urumum 127 upresnení 6 Velkovýkrmny 3 tesarine 4 Vĺg 1 TSTG 2 vernirovice 1 tumemane 1 Urcovacím 1 Troosteloos 1 trolejovými 3 Stodolových 36 toluen 1 trísouhláskových 94 Stredních 72 Specifickou 19 Ustašovci 1 Trikoupisem 1 Towenová 3 Tampax 1 Uchatu 1 Štetkách 1 Szunyoghyho 2 Varcollier 1 vágrysem 6 Titarenko 1 stredokolumbijské 1 Ukkamy 1 Superzlocinec 1 Sparroval 13 supersportovních 3 tolic 1 Uravuga 48 ubytováním 5 Tótha 2 Valhey 1 terofytních 86 svalem 2 Uschnutí 4 spotrebovávány 139 torza 1 Velrybárské 73 Uhercicích 1 šupinkou 1 Trošickém 792 Stan 1 Užijeme 44 stromovité 19 Taber 1 Tunj 2 Vampír 1 Trutnoviensi 1 štiplavejší 1 spoluovládaly 1 Vertjanovová 2 tumorózní 12 teplotnímu 5 Treniota 1 Steinhütte 1 Uaďtze 1 Tilem 1 tshimgana 3 uvádenému 1 Surgh 2 triethylenetetramin 3 Telegames 1 stévá 1 TV a 28 Stoudemire 7 Turgor 1 tolijí 3 Timothymu 80 úsloví 1 Straduv 17 velkomesty 7 svižná 1 transexuálního 1 turmensky 1 Steflingenu 50 TW 3658 událostí 3 velkoobjemovými 2 Sražený 1 Teranovou 4 tebe 1 Varovým 1 Trombitás 1 srpokrídlý 1 Spoluknížatum 1 VanSanten 3 Tropanol 1 tableso 3 Studenská 487 spojeneckých 1 tranzistorovém 1 Vartuvos 43 srazilo 1 Trichen 1 Stratieva 6 Tsangarides 4 Streetwalkers 1 Tercentenary 25 svoj 1 stropkovské 1 Suitsansaari 4 utešení 1 Tiamata 2 Stützen 15 Univers 189 summitu 1 Twelvem 1 švališérský 1 s rozpjatýma 1 Verzichovou 1 Steingrund 2 Undertakers 5 Trongisvágur 1 Szögyenyi 9 Tervela 4 Štechovicko 2 Speranskij 39 telemetrie 1 trombonovém 1 Vassalová 1 stázy 2 Thiancourt 20 tepání 1 Spielfeldu 1 Talimatau 1140 tvoreno 10 šrotování 3 Tavernole 1 Takatorem 2 vaporis 1 tvrzku 1 Vasárosnamény 1 Thorrsen 26 Thuresson 2 transverzálního 16 staveništích 1 Valaide 1 starokrecanské 1 Tríbily 1 Trnovackeho 1 Uraniánu 5 Stulen 1 Spasovac 30 subparametru 1 utuhlým 1 vertrekt 3 Steines 1 Vejvalkovou 1 TONCROVÁ 1 tritonikonu 1 Toniks 1 transatlantiky 2 Svavarssona 1 Štoosuv 7 ucpaly 1 Španhele 2 trasovaní 1 Stoukolkin 4 Stanová 4 Tolarem 1 Vatinium 1 thalliana 7 státnice 6 Vašutem 6 Spisek 6 Varova 1 Trojradka 2 vagínách 33 SVN 1 vardar 2 underpricing 8 uniformních 83 Themis 3 Soyons 2 Uttenhofu 1 stmavne 2 svátostným 4 Stictonetta 5 tríden 19 Timura 2 Valentinim 5 technarum 2 Úplností 10 utrpení 3 um 1 Terceire 1 Uposlechli 1 Sunsetter 1 Velkouhereckou 4 toulouskou 1 Svarohovi 1 Tunmoche 1 Veganský 1 TART 2 THERESIA 1 Unterganschnigg 2 tapírum 1 Totňtruffa 1 taurelasselindon 376 Uživatelé 1 Treboštice 1 Vesicarex 3 tyckarku 15 Souperem 1 Tichodromadidae 2 Taftovou 1 tunguzským 2 Tidqvist 1 Tauchmanovou 2 Torquemadova 1 Valdemarovo 1 vestaveli 1 Surfaktant 57 Tabula 1 Utage 2 Valiergues 406 univerzitou 1 Tómá 2 Tixi 8 toxikologického 1 Unterzollikofen 1 Thurmanové 16 tlacný 17 Stanfordova 1 ŠTINDL 19 spedicních 3 Tríbodové 1 Szanyiová 100 tekutých 2 Tricka 1 ústupkovou 5 Talnet 1 Stricto 1 subdiakonát 19 trénováním 1 trnkovému 1 Topidla 1 Tängritagh 1 tanceným 1 Topvarkofa 4 Stamperia 2 Transpozicí 1 Uživo 1 subedice 8 Underhillová 4 trofoblastem 1 synonymální 1 staromongolském 1 Takakano 2 upustiti 6 Tata 1 tožských 1 Tanguaye 1 stredolevým 417 srbsky 1 Springeren 3 Verghereto 1 Velásquezovi 3 tavbou 1 Univesitätsverlag 117 upevnena 1 umrdlák 18 VBR 1 tunelovaného 5 Stavrositu 1 Spotland 1 Undying 2 Tonserna 4 Stratené 5 Traditionen 1 Vaidja 1 Stadi 1 Štúrovej 2 Vedmederja 1 spoluguvernéry 1 Throllmas 2 usazováku 1 velocimetr 1 továrnicce 2 Totonaky 1 Totorvieciu 11 Svita 11 SUD 1 Tókyó 1 unikem 2 s predsedkyní 1 Tyske 1 stepují 2 Trogglodynamite 2 Vergata 139 Verše 4 spomenik 3 Sowieso 1 Syrdarjy 208 unikátním 5 subdodavatelské 1 szivárvány 2 téle 32 Stašová 27 Uhu 337 Thurn 141 TEE 1 Spiradiclis 2 štírová 1 Starozámecký 1 SYNOPSIS 1 Sudislavicích 719 svetlem 1 Streetsamuraie 1 turok 1 StephensováBethanie 1 velkyslivnik 1 taxolem 1 Stríhánek 1 trojhranne 1 Strimshütte 7 Valiquette 2 Theagena 1 Verbundnetz 1 tobac 2 tutear 5 trnovníku 19 trestala 1 Stredoatlantickým 1 Velkovévodském 2 Touvois 24 textilce 3 Vattai 8 Traces 2 Steinuv 75 spravovaný 6 Vallehermoso 1 Stephenhonan 1 švedském 1 teckovací 3 Tarkovský 1 usía 1 turntablu 1 Teschová 1 Uranicitý 6 sprežkovým 5 Ullmannové 1 Treacherovi 1 terazzo 1 teinteresa 1 Taranakit 2 Usacovem 2 uschovávejte 1 trojvariace 3 Tankograd 3 tratila 1 svetloodrazivá 6 Upanišadách 1 sporánem 3 sterile 10 striktnímu 4 Vesjoloje 1 Uslyszcie 4 totalitárním 1 spravené 1 Stoesslem 22 utekly 1 sudickovské 1 tholeitickými 1 Sweatmanovou 1 svrabovou 1 Stambolijským 2 šteparské 11 spider 37 Typologie 10 užšímu 1 SqlTypes 5 upovídaná 2 svrchnetriasového 2 Trlicíka 1 sporogon 3 vážku 3 STIBRAL 1 Synomyces 2 steviósy 2 subjektový 1 tragt 1 Toldiovy 1 Stolzuv 9 Thiemeová 1 Statistikos 12 strízlivého 1 spoutáván 2 Újudvar 2 Tohmatsu 1 symbiosku 12 Tichonovová 3 tofu 1 Tedva 1 spolecenskopolitických 1 Usce 2 Teb 1 Turnovi 5 ÚstaFu 1 Spela 89 útocily 4 thymidinu 12 stríží 1 Vermala 3 Švábina 6 Trostanec 1 tostones 1 svetlehlavá 1 Stomma 5 Teleologická 1 Stalaktit 1 Topmodel 1 Variis 1 Szkolnej 3 Traxlerova 9 Tuus 2 svetlají 1 trícentové 36 Syme 1 Srebrodolskit 25 Thielemann 2 svadbe 142 usmrtil 3 Tangra 1154 ukrajinské 1 Strattona 14 Veger 1 vatikán 3 Teplokrevní 473 Venuje 1 strednedlouhá 5 Stradonicemi 1 tóbak 1 studénská 5 stavecích 31 trakty 1 Suste 1 ummístený 1 Timaos 1 trojstupnovém 1 tetratetrakontan 1 Tanúf 2 Terrané 1 SousosiSvateRodiny 1 Stellinga 2 Stabio 9 svážet 2 tlesknou 2 stredoevropsko 1 Tríramenná 22 Tajmyrského 12 Tomažic 28 Steuben 1 Timmelem 1 Sweetly 18 utkávali 1 s dostupností 1 Staghound 1 Vašové 6932 stránky 1 trispeculare 1 Tauškandarja 12 stisknete 1 Tracheomykózní 9 streamingu 1 Taferny 4 världskriget 4 Troubridge 1 umovi 3 Tamoxifen 1 Treffelstein 2 Stradonky 1 Thimelé 2 sponzorkou 1 Sponsoroval 1 spolehají 1 Theriot 1 Svokra 24 velrybárskou 3 travertinovým 18 tarot 35 Technet 1 Spjatterjay 1 thianschanicus 2 szkolne 7 tovaryšský 1 stalení 27 straníky 1 Strandh 1 velarizovaná 12 Stálkova 1 toledští 484 Tanecní 15 Ústupky 2 Štepkova 2 Uzbekistanskaja 2 Stagnosol 1 vegetatione 20 uvarena 7 vcelarském 1 ubartas 1 vetový 2 Tramar 1 Unut 181 Ste 2 telovýchovný 4 VERMEULEN 4 Sredna 5 tweetu 2 tercdecimový 1 Spondyliosoma 13 Tetracarpaeaceae 1 trmesícní 75 únikové 3 Srncem 8 Tercovkovité 2 tweakbios 12 Turkmenbaši 2 tits 4 SWIFTu 4 Tripsacum 1 Thokikim 4 Valze 1 topofobie 61 Stredoevropském 22 sršní 1 Uopole 1 spokaneských 1 Uvolnenost 1 Triliovité 1 vájavjánáranjángrámjášca 88 stínící 1 vakantie 17 Tschumi 1 srkající 1 ucitelem 21 subjektech 1 Trímaje 41 spríznená 11 udatným 7 Tóbita 2 stromovnice 1 štolku 3 stochastickou 2 verschwindet 8 svezeny 1 Tchilikov 1 Susumanském 1 Topolský 1 tetivovou 24 Tryggvason 2 Timonius 2 Toutens 1 Sutvarom 1 tarkoittaa 6 tankovny 1 Ubaldova 1 Tjungur 53 Svojkova 3 Verchneudinsk 2 Tolberta 29 úhozu 1 Valaškomezirícska 29 Standardem 25 TGS 10 veselici 1 ttle 3 Trautmannsdorfu 1 ústavnej 5 Thunderstick 1 unin 2 Sportplakette 34 Stíhace 16 Tríjezerní 26 torpédovým 1 Stanisloviškes 2 trolls 10 tesat 8 Swynfordové 39 trigonometrické 1 Tannahillovi 11 Tešínem 50 velrybári 1 Tomšího 56 Vaslui 1 tiskátka 3 symmetria 1 TinyVM 3 tervingských 2 Talleks 2 Titahiti 16 Traumschiff 1 Transportovali 28 Uvedomoval 9 teak 7 Tasnovice 3 Syrdarjou 1 trochoforu 1 Stržák 2 Staropacká 9 tibetolog 1 tobe 1 tajemstva 23 úrodnejší 5 taranu 374 tématum 296 sportem 1 Stegosaurier 1 sumárnímu 1 vede Londonský 1 stredošvédském 1 ušatéhoDvojice 9 Swietych 1 VANLANDSCHOOT 1 turnerovský 39 Šumburka 1 Valadige 95 Sverdlovské 1 UnixWaru 1 Vene 1 tríhodinovému 45 Urbánka 1 Stlacitelnosti 6 Spitta 1 superchlast 2 úcastnými 1 Steindof 1 Trikonis 4 Veillas 75 svítilny 1 vceni 1 Teringlovi 3 territorio 1 Starokadomský 2 subvertising 560 Staršího 9 spartském 4 vacku 1 starogermánština 2 tesudži 5 tasený 7 Spotrebitelská 18 Trapezuntu 3 supraphon 1 Towou 1 Ulach 22 Turneruv 44 Šumavský 1 Tomaszuk 1 Uderej 1 Tiská 9 šprt 1 špickovému 2 Švagera 2 Vašovi 1 varit 3 Szár 2 Thermobia 2 Terebellum 1 Trabasso 14 univerzu 1 Váškou 43 Tyran 3 Tassela 1 Spettacolo 1 Sprengerem 1 vaikeimmat 3 urychlovala 1 Tryfona 1 Tsanga 1 VEGETACNÍ 17 Tubus 2 trombolýza 1 stesnání 3 Tarnkowa 88 štepením 9 tríbarevný 7 Vatsa 1 Špenátový 17 Uvolnený 2 veillées 90 tuhýk 1 Urysohnuv 3 Tronta 22 tráve 1 Ungewöhnliches 1 Traphont 4 vainaga 1 TNZ 1 Velešovicemi 8 symptomaticky 2 Špelinová 1 strojopisného 5 trapézová 1 Tichoua 1 Toyosaka 2 tranzitními 1 Sverenského 3 Trigonometric 1 Totty 1 themistopoloi 27 titulním 1 valici 4 Thofelt 1 Talmudické 1 Staatsworterbuch 4 Tipu 2 toastové 2 Studs 587 svislé 3 štovan 1 Vetlova 3 vecerníky 1 Sousedíkovou 4 Traviny 1 supermocnostmi 1 Trávníckovo 2 ušpinený 24 Svícka 2 Strojsan 2 Utmanzaj 3 tellurem 25 subantarktické 1 Trapezopolisu 1 veç 1 stonavé 1 težkooddenci 1 vaquita 3 stresované 5 tlacíme 1 Thyholm 1 Útlou 2 Steingart 1 Spórok 76 vazalu 1 Töllikkö 20 špionka 6 Sposa 41 útkových 47 sušit 1 Storthocalyx 1 staromilskému 1 traversées 2 steinalmské 1 stoctyricátýšestý 1 S RODINAMI 17 toric 1 tave 15 Udmurtština 1 tonari 11 svedomitým 23 Spáry 1 Stínovy 2 sunnou 3 spájivek 90 Stružnice 1 Tótalmád 31 Thunu 30 Umbro 1 Veruno 1 Vangdžal 137 Stowe 1 Varacka 1 Usevalad 4 umajjovcu 1 svádím 7 Vattásovci 1 Svetlíkov 1 Urimal 2 Turingovou 8 valdštejnská 5 Stifte 1 Valdezarza 5 Umbrellas 1 spekultavivní 1 Torstensonu 3 Txurruka 2 Vaela 1 Téléthon 9 srstnatých 2 superdresum 1 spoluvinnu 9 Trollinger 1 Springfieldským 1 Tutzenzhaler 1 Swallenia 2 uhnula 5 stroja 1 tríkolejného 58 Tricholoma 83 Stoletá 6 vernisážích 1 syntakticko 1 Valienteová 10 supresorové 2 triadické 3 Südmährischer 36 trakcními 1 Štanglera 17 Tweet 1 utkáme 335 syntézy 1 Sprawy 3 Vasilevová 6 Transevropská 1 Spittank 18 spojte 1 Tloukl 10 stratovulkánum 1 Udženiji 2 Tatliakovu 2 Städtischen 1 sukýnkami 2 teratogenu 1 torento 2 Troldy 1 Szeptyckim 5 Tify 1 Toumy 1 Upozornování 2 Torgos 5 tehsil 6 Urbansky 1 Vellavaye 1 Sytiny 10 uhrály 3 Tolkkiho 3 Stiglitzem 1 ušlapanáho 10 Vasselina 1 Stodkovského 2 SPECIALIZACE 2 Veinante 1 transluciního 43 TWA 1 Undiano 4 Úzkým 1 termoakustického 2 Tannerovci 8 Suchdolem 3 Sutheová 446 Thálie 2 Ubývaly 32 terapeuticky 2 Théding 1 tyreotropního 12 vanilkou 1 Tominc 1 Spoluhrácky 1 tarawatch 5 strunová 1 thalasském 1 Stepanenková 7 svoláni 4 sternocleidomastoideus 26 TACE 1 vermontskou 61 Souvenirs 6 tefrových 28 trenýrky 9 Stapina 2 trepenitkou 4 štítníci 1 starokimérské 8 Urologické 1 Stuarovát 5 spojenu 1 uttĺg 12 Toširó 1 tricetinám 1 Suškou 3 Varykinu 215 upadá 1 tárgymutató 1 Vetterum 1 teorico 1 spermën 3 Tihelková 2 tropaeolipicta 3 Torell 2 triumphantes 1 tlouštkuje 18 Swingu 1 Tenochitlánu 32 spolkne 3 Superiores 2 Statkem 3 spuskajemyj 2 Tavarnelle 46 travertin 1 Tourem 58 spravovaly 28 štep 3 Valdarno 1 s jakýmkoli 4 Tomby 1 Toeplitzových 4 Unbalance 1 Unterharz 1 Strádecký 18 ulomil 3 Supercell 14 Tymich 3 Suchánová 15 Stalingradské 3 Stržanova 1 Verdienstauszeichnungen 4 Tughtikin 1 trojmachový 1 Uferhallen 1 Turbaco 14 Ukážeme 2 superuživateli 1 štósská 4 Spalt 1 triode 2 Venix 1 Tapulacci 1 Trichogyne 1 Vernašen 1 Spakh 4 Vandenbergem 241 Takuma 1 Stuhler 5 Vávro 1 Taradeho 1 tvaružkem 40 Surajev 1 Verschaffelta 2 Unzent 6 Valterová 2 uvážlivá 1 tribunáty 1 treb 1 vcítí 2 spojivkami 309 Tena 1 trigu 1 Unvalidated 2 Ústavnom 7 Tetanus 1 Staroch 4 Veise 3 Supaplex 1 Taranidovým 1 Thatë 40 starenka 2 Šúštaru 3 Transaxle 2 Starborough 6 unless 8 tocících 2 Upírím 1 umenšeno 3 Tuhfat 6 svetlezelenou 15 úvozem 1 Suzukazeho 1 Ticug 1 Stanice 17 Trebívlicích 2 strážnou 1 Tourneuxia 1 striací 1 Tahitienne 1 testudovití 1 Strinbergovy 1 Stowarzyszen 4 štedrovecerních 1 trojzápasu 1 Syrecková 1 Tetrarthrius 1 sprinklerových 1 Tirbirhine 1 Suniered 1 Totalitarismusforschung 4 Tonnant 65 Tlumacov 2 Thiant 1 Trombocytémie 3 utahovaly 1 Vapours 1 Splítky 1 Undique 1 VEDECKÁ 17 Vanilka 2 uldé 4 švihnutím 1 Uchylovat 1 Thawába 1 Traute 3 Torpédoborci 1 subvelutina 1 Studovány 1 Štokavci 3148 tok 2 Tumbe 1 turiste 1 suševní 4 typika 1 trícátých 4 Valcíkovou 2 Valavicius 1 urgonských 41 ukoncených 2 synodech 1 Stareje 1 Várhidi 1 Ullgersdorf 1 Teutonech 44 Sperling 1 Stromatopteridaceae 3 Taché 14 tvoj 21 Tvrtko 5 Symboliku 18 tezemi 5 štukatéry 2 Végennes 1 Tjé 1 stum 1 Speedrock 1 tibetianistiky 582 tekutiny 4 Taisei 1 svetlovodice 1 Tubokurare 1 vaham 1 Stablemates 1 VanDyk 1 u císarského 1 stínaldelského 1 Verca 39 Suglobov 2 Strömová 4 Utro 13 Treštského 1 trombastenie 1 Tzenkethii 1 Tamazgha 5 vcházeli 3 tlumocená 1 taksonomicheskye 238 technologiemi 1 Tsangaris 6 Terrany 1 spolulezkyne 1 spremembo 3 stydliví 1 teoretii 1 trecere 1 triadevadesátiletého 10 totemu 50 strepu 4 Štilecek 2 Tonkinským 159 sporných 1 taoické 2 Subapeniny 29 splácí 1 suturní 10 TVEL 1 Streberrsdorf 2 Tómas 10 stagflace 58 utvoreno 13 strízlivá 1 spoluvudcovství 1 ubližujete 1 španelcina 1 tuhnú 1 ‚Steve 4 Venovat 1 velkofirma 42 Toolkit 1 ThGCgNdaFzE 10 staromestskou 1 Unisysem 1 Stĺlknapp 2 thrillerová 7 Ustálené 1 Strdí 1 Syken 1 Vceláková 1 tetrasacharidový 1 Tsunga 1 Stelzhammer 1 termocláncích 1 Turnfestes 13 upoutávku 1 úpského 153 Uhrínevsi 20 splétají 2 Tibie 2 tuong 2 sulfat 2 Šprunka 2 Tooltip 2 UCT 1 strílnové 26 stopkovýtrusné 2 Ternö 497 SVK 1 táhlicemi 1 vetraci 1 Újhelyi 1 Trnice 2 s rozhodnutím 1 Trikolora 11 úroceny 1 Tonlé 4 Verita 1 Stabro 3 Tarfaja 2 Štvanická 1 Uzjukdarja 34 Štulc 1 udicola 1 venuly 19 štítonoš 1 teplovzdušnými 1 toulgoeti 6 šupinkovité 2 Unkovicích 1 s presahy 21 Tomášová 1 symportu 6 tlustostenných 1 sunoucími 2 stén 2 St?ckela 1 spokl 2 turbodiesely 2 Tchanuv 1 spingenta 1 toprédomety 1 Triši 46 užitných 2 Tulkaram 1 Svitjods 21 trockistické 3 Szajer 1 temsil 13397 Tyto 3 Thčve 6 Vápovic 1 SZAVA 1 trojkrídlového 4 Spinozovi 2 Starett 1 Thoreux 2 Sulsfort 6 Trastámarská 1 Vesnani 62 tresky 1 Spöringa 1 taiiku 8 stredomorskému 2 Synnax 1 Tršar 1 ül 1 Uriangchajce 1 vaishnavismus 1 Teotinuacánu 25 spod 1 Ugarcin 3 Staelens 5 Submillimeter 1 Vekoslav 1 staroliberálum 1 swetu 4 titanatý 2 Uberlândia 4 Studienka 7 Vegetariáni 12 týka 16 Spurius 1 Suchumském 1 Vágsziklás 2 szám 18 TAROM 6 Varent 7 Vaskem 34 Tragický 16 spievajú 28 stupnovitý 2 tempest 6 tepy 16 torpédovou 8 Verticales 26 symbolistu 2 Tatuluv 13 Sukanya 1 Teodorowicz 78 Vesuv 1 statkárku 1 tiskopise 1 Teletron 5 stínek 1 temešské 2 tukula 3 vaccinum 1 Spytihnevovou 1 Váženy 41 tekutou 16 THEMIS 1 tamoxifenem 6 štvala 1 studitky 1 Unsolved 35 uvezneného 1 stenatek 1 Supercisté 3 subminiature 20 Úlovice 1 Unikódové 15 Sraková 11 Tijuca 2 Uzbeg 4 sykonia 4 Swarzedz 2 Štuksa 1 vatopedští 5 terminálová 1 Tsinga 35 suite 1 TALENTU 446 uplatnují 2 Verissimo 13 Starecský 1 tusconském 7 Tavolara 29 svrchovaný 9 Tykacovi 1 Tajnost 1 StickIt 1 Venóznímu 1 spievajúce 21 umocnit 1 synkarpia 2 Valerianovo 1 unobtainable 2 Stríbrnicích 4 Stutchbury 1 translátoru 1 Tarczay 8 Veslarského 2 Štepovat 1 štrukturálne 1 Transduktorová 1 Swingerovy 41 transcendence 5 Štulírová 1 s Orthographia 2 Takana 1 stríbrokrká 1 Ulreyova 5 Veuves 2 Tapfer 1 Tapolytarnó 1 Tyberguv 1 SPOTLIGHT 2 vepro 87 Strelecký 42 ucebního 2 trírohá 7 synaptickou 61 úklidu 1 Tucherschloss 5 TKB 2 stloukali 1 Sufitka 3 spectantia 2 Textilane 1 sporového 1 Systenotheca 2 ULTRATECH 5 Vejcitá 2 Thieuloye 1 surofvání 1 vecným… 19 Tuo 61 Tropický 1 speE 2 svijetu 3 Velvyslanecstvi 1 vetováním 3 Stenodus 69 Tug 1 tunnijsky 14 Šturdík 1 Vallecanu 2 Valeru 1 usouká 1 spolecenshého 1 Squin 1 Stylovou 1 Sweetovi 1 ubiquitinového 8 Tankodrom 5 Starostovi 4 Trittico 1 sterkobilinogen 1 töröksip 1 Tearney 1 s automatickým 210 uherském 1 Truism 1 Stortingem 17 Valtínov 22 venute 1 Tanciburek 6 Versatile 5 s dalším 8 Tervueren 1 štíhlozobý 7 Stakcín 1 svalen 1 Tadesco 2 Vendays 4 Studeníková 1 Ströbla 1 Teleskope 17 Terumune 480 stálého 1 streingir 2 Tupce 7 Töpl 3 spletitým 1 thoughtcrime 133 soustavách 12 Trímany 2 Ülgase 4 trendových 3 Šunsui 2 Trentepohliophyceae 3 Svarovaný 6 utrhnou 1 Svine 2 Vajuonis 1 Úmyslný 1 spastik 13 Šterna 2 strednezrnné 2 Subadi 66 unas 2 Vassiljevová 15 vejcorodá 12 štíhlosti 1 Uwakwe 1 Staroselská 1 tubulosum 1 úmrtnostmi 1 terotetickým 1 tohohletoho 1 SPRITEFONT 1 Tesinské 1 Stáhlich 122 svalovou 2 Tornagi 3 Tsishkevich 1 Stapinským 44 strílelo 1 technologiaartis 4 Územními 1 Teodoti 1 spolecenství rímských 1 uC 2 Stísnená 2 végétales 10 utolsó 5 Unterallgäu 8 umenovedné 26 velevrub 1 Štechove 2 Umelcové 3 teretis 5 Straighta 1 vcholové 1 Spiritisty 3 Úsudky 1 s podnikateli 4 Tromb 1 útrok 1 Sventenia 3 stredoveké 2 Trelawnyho 1 uzkych 11 Tunelovací 2 Tchirozérine 1 unsar 5 surinamské 1 terrainmagazine 1 Unboxed 175 Suezského 1 Tungtchingským 1 Unhoštsku 1 Substredomorská 2 Thessalonikís 1 soziales 1 ticlennou 17 ÚMŠ 27 Stavebnice 1 Veltechna 3 SuperVeloce 5715 Star 10 Sparxu 1 Tmkaberdu 1 tunik 8 spodnicek 3 ucpávající 2 Undeland 2 tažicce 1 velkomagistra 6 velkoobjemového 2 Synthesii 1 tryskovitý 1 úpolu 1 Valentinit 2 valleuses 1 Stathamovi 1 tikaf 2 Stennet 2 Uplatníme 4 Strunal 2 Trójanem 15 syntetizovaný 4 ÚSZS 10 úpr 2 Stainville 2 Uriza 5 Trojánek 1 velkobailiviku 595 spolecnostech 1 Stoitzen 1 uzemnovacím 1 TURBOMOLE 1 stotožnil 17 vetraných 5 trojkrídlého 1 Thomsenolit 8 Svjatoslavuv 3 Štula 2 vermikompostu 925 Svetlá 1 Urodynamika 1 Trierovým 1 Uhniska 1 Tintorettovi 1 Tupinambu 77 speciosa 1 synagogi 4 tsi 2 svrljuško 20 tani 5 valdštejnský 1 Urkundenwesen 17 svatohostýnské 2 svätobenadického 1 šruta 1 tui 1 trendove 1 Uprený 1 Tohio 2 Tamagni 30 trojklanná 8 Underoath 6 Uhranutí 4 Veskila 10 Stanovením 1 s figurou 4 veleješterky 1 —stromovitý 1 Tudertum 1 teleologicky 3 Varnská 3 Strhl 6 Umut 66 tretinách 2 tomboy 1 SUUNNITELLUN 2105 stojící 1 Svärdsmedaljen 1 Tegneskolen 326 stežejní 1 souqenie 4 vantroky 1 Vajota 1 Vaccinazioni 3 Srbovu 2 Stenotrophomonas 1 Tinjic 2 Spermy 2 Tiena 1 Tustna 2 Útocili 2 Sušicák 8 srozumena 1 startuRaketoplán 1 Utigkých 9 úsmev 1 UCRFIN 6 uctívaném 2 Sprchola 1 Stravaganzza 2 velitel UPA 1 vdo 1 transsulfurace 1 Uribarren 1 sulecinském 1 Taquaruçu 1 telšské 7 Tickell 2 Sturmpistole 3 štítnatou 1 Udžisunou 1 Transsonická 3 Tremblaty 9 superintendant 1 Szczecëno 209 ventilu 6 UNS 1 Stephainová 551 Tchien 1 Sphragismena 21 TNC 1 theosofickými 48 spolupusobení 4 uzbectiny 3 transfigurací 350 strelecké 6 Stamová 731 ST 2 Úplazský 19 Stodu 79 tvorivé 2 Tomovic 1 Szollo 1 Vekselbergem 4 Taoistický 122 Sugijamaová 1 Vakulovskij 1 spoluvladarství 1 Vattásovce 13 Vaubanova 408 vetšímu 1 sukubus 4 stojánka 13 svazková 34 strevlíkovitých 1 Stepansky 8 Štefánikovu 2 Theodad 2 Veitu 1 Teitelbaumové 1 Tongšinská 1 verfassungsrechtliche 2 urobily 8 Stanou 1 Tagar 1 Urmiberg 1 Týdnem 11 tanaitu 1 spoglie 1 Tassottiho 2 superficiales 61 Surfers 10 spolupusobil 1 stipulation 1 Tangyem 1 valdstejnem 11 Tenzidy 5 Tržila 1 Trooperu 23 tríosé 1 Tukura 2 Ujalou 1 Spravovne 1 Tribalinae 11 Ukoristený 1 tónosylabický 3 Toufflers 4 Tyem 1 Tienovu 1 Trisiných 753 strop 1 urebes 88 vágnost 1 StLB 1 Tareste 4 Uvadec 433 Švýcarské 1 sreca 4 Ukážu 1 také pet 3 veru 6 Tejano 1 tasovských 8 specialistky 1 tlumivému 1 Štelinova 1 Unternehmensverwaltung 191 veceru 1 Uhrinovic 2 Thril 1 Valsasiny 67 tching 1 Toquinhem 55 tatranské 3 tamago 1358 Texasu 1 Usilujeme 12 velkoknížat 7 Torrentera 5 teriérskou 1 sulfonylových 1 Susquehannoky 1 stredoasijec 5 uhlonosnost 59 Tremi 1 Stefem 2 Tygurov 2 Svrhla 2 sprahován 1 tich 5 teoretictí 2327 úspešné 1 Upsané 3 staváci 3 Uniescie 1 stupaj 2 trockistickém 3 svraštelka 5 Trautmannsdorfa 1 s inspiracemi 3 Valerianuv 1 vdava 1 Staszek 1 Transdermální 1 Szolosgyörök 1 Úm 1 Szabás 1 Tomajka 18 Svobodín 1 VAVROUCHOVÁ 1 Uchkuduk 1 Transportbegleiter 2 Týmovou 13 uškrcení 1 Universitais 1 šterkopískovište 1 ülüd 5 syntetizovali 2 striptýzový 46 Strickland 1 šungitový 9 Svetlého 4 Toranem 16 Thurnem 1 Tvrzký 1 unášivý 3 TIKI 1 Urseoli 1 swarmu 2 Tabl 1 Stareckové 29 Štefánikovy 2 Szusza 1 vetracku 1316 Tatrách 7 Tamora 7 sponzorovalo 4 Vážená 2 suupillile 1 Thurnall 6 Vajgarská 11 Südmark 1 Sprízneným 6 Tvarované 1 Vejman 1 tricetisekundový 133 testovacím 2 Spoustové 1 Tomve 1 Vazatzovi 3 utvárejícím 1 Sveceninách 2 Vanozzou 8 Tertullian 9 Sumerština 1 trimitická 1 špagát 6 Tabácek 402 Tora 3 Stallerová 5 Unwerthu 2 Verlans 1 turanismu 1 Traklsteg 3 Tutceva 1 tulipiferin 1 Theonis 3 terpentýnovým 1 Subido 109 taška 1 streunera 88 stredomorský 100 Stare 2 Trámová 2 Teufelshöhle 4 Ureyuv 3 Testerman 50 Statistický 3 subakutne 13 Venasque 33 studnar 1 strutiomimus 3 usmyslil 1 Stanceva 1 s vadami 185 tkaní 1 Srazum 1 triašedesáté 14 šupinu 12 úhlopríckami 1 špásuje 517 torpéda 1 Spasil 50 strídavá 12 Upa 1 timpano 8 Tample 3 Stanislavic 13 strukturových 17 Spinozu 2 Svinském 2 takeover 26 Toddem 2 srubovými 17 Toc 7 úšklebky 3 tabulovými 1 tort 1 suscepit 1 Towerbell 26 Timantés 1 Telewest 1 Tobolou 1 tlukoucí 1 Teplosmenná 13 ustrnutí 1 SuperSponge 1 Švédštine 2 Turgau 98 trap 6 Vernetem 7 Vesaas 1 suhtumist 1 stas 3 symfo 1 Sporckovou 51363 text 1 sphaericus 3 Thexder 6 Tipografia 1 Verjovkinová 1 Symphyacanthida 3 Troubleshooter 21 Teenagerské 1 tomášského 1 Takan 1 superfamille 8 Vasyljevová 4 Timantova 10 Taboriho 144 Traffic 1 Uyledburch 2 Utrakvisty 1 TAKHT 1 Spyridium 3 tage 4 svajamsévak 4 Vaccaroni 42 vavríny 8 Thonsern 16 surfar 28 SŽJ 1 Vajsova 1 Tyrany 2 spoluzasvecen 1 Turnquest 1 Sprízneného 1 supercontigy 108 vaginální 1 Tempry 1 Stavropoulos 1 tašawit 46 stíh 1 Tartuffuvi 7 Sušicem 1 Tavíkovicích 2 Stockenger 1 Vejím 1 Toxicysta 5 Staroruské 1 Tasveer 1 Unteredt 17 urbanizovanou 3 Tronson 1 tRNAAla 1 Sukánta 4 vasco 35 újezdem 1 spodobrví 1 Temperaturen 1 uvedomnení 2 uctívajícími 4 Sunstrider 83 vážneji 136 úsmev 42 Vehicle 3 Venizy 6 tonometrem 1 Strelkove 5 Sutras 2 thiosulfáty 10 tribunus 1 úvahovým 9 Tkácová 1 trakajská 2 trativodem 1 TELECOMSTAV 1 varaních 2 Tónica 2 Valaire 2 Thuckalay 3 Usmernit 3 trpeni 1 tyrannosaur 5 Tillis 1 Stenodon 1 Thameruse 1 Tusiho 2 Uhrineves 1 Tadjourském 1 Syberie 2 Termogram 1 verquere 3 Tendžiho 1 Taróczym 1 Štiavnicí 6 Unsichtbare 1 Tantivy 2 Únanova 1 Torcetty 2 Váhavka 1 Sztereodagerrotipia 3994 staveb 14 Teldec 31 TSN 4 transmembránového 5 Tauben 1 Štefánii 1 Sudecuv 1 tetradec 18 utvrzení 1 Vejmar 1 s predpokládanou 2 Trestaneckém 1 Srostlolupená 2 SuproLiga 18 stýskalo 1 strchr 1 Urmilou 1 Stackley 1 Türkheima 13 urátu 1 Uffenheimu 1 Sukkens 1 Taviv 34 Troskotovice 1 Szëmëm 1 tenzóny 1 TBSK 6 Steere 2 tiššími 1 Tarjanem 1 stanveno 1 špicatolistá 6 tigrina 34 Toomas 1 unveils 2 spookytooth 3 Vetenskapsakademien 2 Tichavského 1 Šraf 1 trienová 1 stalagmitovým 1 uválených 1 tibhirinském 7 Sunitha 2 vastator 19 Színház 18 urbanum 8 Surviving 1 ubukombe 1 suchovska 3 thesauri 1 s náboženstvím 5 tužbám 2 vernakulárním 45 trírozmerném 1 Taboa 1 teistu 3 teenagerovskou 1 umožneno 2 TsarFamilyinStavka 2 ummu 43 Todo 1 urokanovou 1 SVERÁK 5 Šprincluv 15 vavrínovité 3 Temerie 1 verbesserter 1180 Velikost 1 Tasáry 1343 uk 2 Vennezey 1 starokrestanském a jak 10 svrška 1 Totalize 1 vacchiputtíja 2 synthetizátor 1 Svyaztie 19 trvalí 3 svet? 1 tranších 2 statuto 3 sychravého 1 španelskojazycné 5 Tornéus 2 TraceTronic 1 spinocerebellar 1 svetležlutá 1 streckeri 11 soundtrackové 8 Svéboricích 3 Titíž 1 Steigu 4 Tutelo 3 Talyš 11 tažností 3 Štaigl 12 vátými 1 UniversitätWien 1 Špionam 1 strašnickému 1 verdoflavin 1 Taratula 4 trímetrová 2329 velkém 2 s pozitivním 14 Suchardová 5 Toimi 1 Unne 1 staropolski 1 Stevanovice 1 Theuser 2 upocený 1 Vasszécseny 4 Timoku 1 spoluspiklence 1 Straschnow 1 sundském 1 Uzavrenina 3 strobilem 1 Tefala 2 vadáno 11 Tigrane 2 Transoxanií 3 tenhleten 2 TypeID 12 usednul 1 Talleyrandovou 1 úluváckého 3 strekovské 1 Tüürovy 8 Spolupodílí 14 Šulcem 1 Stepankov 1 s kriminalistou 1 superioritas 1 Tegumi 174 taxislužby 3 Stopercent 1 Thénardierovým 1 Toplou 1 uvedene 6 Valtzer 1 Svatojirsku 1 Taškentskou 1 symboliczna 1 spisovatela 2 Talvi 20 ukazatelích 1 Spiniluma 43 tribunu 1 stejnobarevným 11 Tione 3 Valdeblore 1 Tejalone 1 užijem 98 uplatnily 1 SSwota 1 Svislackým 5 Versonnex 4 szu 1 Telenordia 35 Tyc 4 Tarumba 1 Vanio 3 TRASA 2 Stiebnig 1 tlacitky 1 Umage 1 traslaci 3 Undefined 1 Sunbox 4 Stojáka 10 stolari 2 Szczeniutyn 2 unija 4 stanislava 2 Urzáiz 1 Szökevények 9 uragánu 6 uhájí 4 stoperské 1 utešený 1 Strešnáková 33 Vápenec 12 staveni 87 Trevize 1 streamovaným 1 Stinadla 1 Supravily 2 Tills 1 Tyragetia 2 Tryptyk 3 Tótmegyer 197 Tisová 2 Trendu 7 sušicí 2 Tomíkovicemi 5 Svatonovická 2 Verfassungsgerichtshof 1 tacel 2 verrai 1 thekálních 1 Tonfy 2 súhlasu 3 tahy 2 touženou 5 teplouš 30 tetrovitých 1 Valtenberg 28 trust 1 vancouverskou 1 Studinka 1 Toschim 1 Vassilissis 1 Summarit 4 Veirman 5 Straßburger 4 Tajeset 1 strihány 1 vazpyatiyat 1 šumno 1 Steng 31 ustupovaly 1 Strogen 3 Tedoradze 1 Stockw 3 teatrálnímu 1 spomenutých 2 Šubina 1 Spielverderber 1 stegodony 38 Superligaen 2 usmej 2 s válkou 1 s Mezinárodní 3 supresí 6 titánské 4 Tenenbaums 139 tercet 1 Stuguns 2 superkabuto 1 trombonová 12 Statici 1 tabulkovitá 90 uvažovala 2 subspec 2 Turnballa 1 Spinned 1 Suigun 30 stanicení 1 Vanzzino 1 Svatodivišská 38 Stillfried 4 Tuchorazi 4 ultrapravicovou 2 Stadionovo 1 userpassword 4 Tyrelis 2 strelovitými 5614 uvnitr 4 utocili 1 Triéry 3 splazech 1 trigeminálním 246 triumfoval 6 Stonerem 3 Szív 1 trygga 2 Strakác 1 stredoškolákem 10 Tildsley 2 Strania 6 Symptotermální 2 stránkován 5 Vaumort 2 tleskac 1 Vetularius 4 stmelených 1 typizacního 1 vakuom 1 telefoními 2 Taillet 17 vetšinovém 1 ústricovití 1 Steigerit 1 squadrigliemi 1 stenozi 34 Tiffanyho 11 these 2 Sulyok 1 theoretického 2 Vesselina 5 Tasword 32 Tvarove 71 sponu 17 tinktur 114 Šumavu 2 Swobody 1 vestiarium 1 Triesterstraße 21 Torki 1 spasticitu 9 úhrnný 25 Sverkoš 7 Tulskou 1 s ocekávanou 3 Taurenu 1 Stambrovská 1 SSBP 1 Steritz 18 Vejdelka 3 turim 1 Svetlogorsk 2 transovariálního 1 Sprotta 1 Turoski 3 Stovkám 3 veleknezovu 1 uhorská 1 Stenaline 2 tocharštinou 2 Verrazzanova 21 Tiit 34 úrodném 1 Velebudicemi 1 SUNSAT 6 Uražení 1 stoletíKdyž 1 Vajdík 2 splaveno 1 ukrajinskych 14 Teaser 1 velmistrne 1 Vanemseersant 8 uefa 5 Tureckem 1 Tombone 7 Štastných 1 u križovatky 2 ukvapeností 2 Vavrdové 3 Užitecnou 3 Veltrubech 2 Sphaeriidae 18 vetracími 3 Valnícková 1 Verkehrsinsel 5 štekavým 4 Upravování 4 Sulejmanových 1 sudi 1 traverzový 1 Tchirky 1 Valdebruno 7 Storitza 3 strnout 21 statik 1 tenerifskou 21 transplantacích 9 Tusita 1 vcelkou 1 thoracella 6 Trebonin 2 tisknutelnému 1 verführe 2 státnickému 3 Turajev 2 Troncoso 1 tiskarskému 1 Stibralovi 1 trouchnivé 1 Srolovaná 1 starocechovi 1 Ununennium 1 spoluúd 7 uremický 3 stremchové 1 Stanoxofobia 3 Tuneluji 5 totemovým 1 velký 1 sunženská 1 Transportatin 3 Sýkorici 1 strevovou 7 Ulsterský 44 ښteka 6 Vescích 2 vazeni 141 Sternberg 14 srna 1 Umanského 10 Strimická 2 Stürgkhovu 33 Théodena 1 Valschavieler 1 s komentárem 1 Tekeidský 1 Southamptonského 2 teplate 1 Tühirand 3 Veterupristisaurus 1 spoluadministrátorem 1 Uzice 2 Stackridge 1 Stibiopalladinit 40757 USA 2 Valcamonica 12 Thacker 2 Sparte 3 stojiny 1 StaveníZahrade 1 stracené 2 urijštinou 3 staroorientálních 17 Vauvert 54 veršovaný 3 ústroj 1 Tasenskou 5 UHD 3 Squarepusher 1 Svćrmere 1 Tropes 1 sporulujúcimi 3 Taktarov 1 Szymanovského 1 SunDog 1 Vérossaz 9 Tojice 3 tiki 1 Svetozar 1 tankujou 1 uhánel 1 surreálných 1 Tô 1 Sudakovová 2 Spál 1 THADA 1 svatyne 4 torton 1 tighe 19 terminálové 1 Tristo 13 tvojich 29 spritu 5 uvena 1 Svídník 1 transferaz 1 Tscherniwzi 1 Tuxena 20 stíháno 1 Tutori 48 Venstre 12 Tuc 2 Strohova 128 ublížit 96 Tanganika 1 Uhorcíkovu 689 Váhom 21 teoretikové 1 verám 4 trombomodulin 39 uverejnovat 2 Struggles 21 Steg 4 trpkým 1 Tléma 1 Verungspitze 1 Stencil 4 Thywissen 2 Stonovi 1 tugaji 1 TABULCE 2 Tarczynskiej 1 toto plemeno 1 upadaní 1 Tomografické 2 Todini 5 Touvent 2 Tatlina 1 Tísnil 6 standardni 10 Tooting 5 upokojil 13 spuštenými 4 strunatcum 4 Tasci 1 Tragika 1036 Útocník 2 Sulaimanisaurus 1 Uenovy 260 Velikonoce 2 vedcuv 2 Taoniscus 7 uzavírce 1 Turricano 2 Umou 1 StreetMachine 10 Trncí 1 Synaptomys 2 souvstažné 1 udaju 1 Umany 1 Tranijský 1 Turawskie 1 tanskripci 111 Stanovice 2 vedun 1 tleskac 1 Uttersberg 1 ??'t???? 2 s Rafaelem 1 TEHOTNÝ 1 talentovanych 1 tarokách 1 TULEJOVÁ 1 Terragona 1 Stejnojmennost 325 užíváno 3 Thorée 24 Úhlejov 35 Tervel 1 travicu 3 sourodým 1 Tetti 1 sušinová 2 suomisaundi 1 Uhejmir 1 Trenarowski 59 ustupovala 7 strítežské 9 trnavskou 1 s Bavory 25 Velešovice 1 vetrnímu 9 Speusippos 2 Tarivo 3 stronciem 3 Timpul 2 Sünovi 1 Spoloc 18 varmijsko 1 Telefonát 1 Szerynskim 1 subnárodních 1 Vejvanovký 3 Sunndalsfjella 1 usement 1 Srnuv 65 stáhnul 8 tury 1 superautem 3 telepatického 1 Suopo 1 trictvrtekruhová 6 suessi 98 Stalinovy 3 Traviaty 9 vazodilatacní 1 vareckovite 5 Tarver 1 staphylococcus 1 Splzovský 1 Strebohostice 10 Valognes 1 superuživatelským 1 Tunklovými 2 s hodnotami 1 Strubelliidae 1 taluja 4 subconcolor 1 Trabandta 1 Srednekolymský 1 staroblízkovýchodní 1 Taberiová 1 Trutnovsky 1 Veslemřy 1 ulmburským 2 Szczastnaja 13 Stíhacka 188 strelných 1 Tihonen 2 ve? 1 svetoobcanství 1 Ufarte 1 vcelníkem 2 tucnic 15 Trombin 1 veristu 1 tumbles 1 Spidersoft 1 šuntovacím 3 termojaderným 60 Vallejo 1 synonymizováno 14 tmavozelene 1 spasitele… 5 turniketem 10 Tadajoši 1 toleroat 2 tchunu 1 symbolicke 8 spárovaný 3002 Španelska 1 tréninkovámi 2 Trollhammaren 2 Velkodul 1 unenlaginu 2 spacecraftOrbit 42 sulla 1 Vaitkunasem 1 ?ari 1 Syntherchestra 5 Thurau 2 stagionovým 5 Veluwemeer 1 Stejném 1 Ujištuji 1 Tiefenbachuv 1 Tovovým 1 Strasoldo 1 Szabadosem 4 Uzavre 3 Švejkových 1 Stigsdatter 4 Tudorovcem 2 Tecknau 10 Tseh 1 Sykovce 4 trin 4 Valeo 5 vešáku 1 Umsetzung 1 stegosaurích 1 Tónovi 2 Tlacopánu 1 Trimery 1 SZPNP 1 Teruncius 1 Stilbaceć 6 Stuartovnu 10 tornádem 1 vetrovkou 1 tosca 3 švorc 164 úsecky 117 Švehlík 2 teckovitá 1 UWS 2 speditéra 1 úradoch 87 ÚVMV 1 subkapitola 31 sudokopytník 10 Thorna 1 Surgutský 1 SungMo 2 transkodéru 2 Sundeved 1 Substantivní 1 speleoalpinista 1 tramé 4 Struthionum 62 veterinár 1 tárik 1 Ungoliantiných 7 SPRSV 2 Tachyzoiti 1 Termopylském 1 utkanými 1 terpenoidních 1 uniqueidentifier 2 utvrzeno 1 vernetzen 1 tcmay 2 Thackwellem 7 Velkozemané 1 tricetikusová 2 subklinickém 1 tížné 50 Talír 1324 turecké 1 totalitárskou 1 Symmocidae 165 Uhelné 17 stolonifera 1 Vĺta 14 Thienen 3 Suckling 1 Urthiere 1 trojkomponentní 3 urBeats 13 Strojnické 1 úzkoprsosti 8 stácených 1 talolla 6 turku 4 utichnutí 1 štafírována 1 Topilino 2 Treláže 22 ucednické 3 veršovník 4 Szigetszentmárton 1 Štastnou 2 tarotu 1 taurochenodeoxicholát 39 trhavina 2 úhlomerem 1 termochemickou 1 Tisissat 4 terý 16 Vcele 2 Vágvölgyi 4 Tingl 1 Strygun 1 Tamrielského 7 superoxidy 5 Tomasiho 6 styková 1 Tressel 1 Turkyn 2 Tracheoesofageální 2 trojpísmenné 498 transformaci 1 Transportleiter 1 territorialer 17 traffic 4 spolucestujícímu 10 Valentova 1 stanleysteamcar 1 s chladicím 2 Vaculkou 1 Suttheimer 1 uchopené 802 týdeník 2 vedcove 3 Stredohorský 1 Uei 2 umocnováním 4 syndicale 6 Sparken 1 šterkoviskem 1 Teucheira 1 Thouetu 4 Suevit 1 stvolov 1 umístenem 14 Sportka 1 Sudomerí 1 Taubenpreskeln 59 Southworth 5 Tiziánova 39 stranickými 1 Spanem 1 utešovaly 8 supertiebraku 1 svrchnepermsko 1 Vervaltung 14 Tervuren 12 spocinul 95 starorecky 1 uzavrrel 4 ulpet 331 sušení 2077 územím 1 ušedšich 2 testovitém 1 Troyovým 1 Stramper 1 tiburtina 2 Trdata 1 VAVOe 1 Stecha 43 Tobolu 2 Vápeníkem 1 tabuizovala 1 stávu 7 ucpaný 1 Úúúú 2 Trentschiner 2 Stradi 1 Stisknout 29 štátny 1 Trojhran 3 Trouy 6 Tabenkin 5 vecernicek 1 Steisste 32 Štepnost 131 tabákové 10 Trójgarb 1 Vancáta 1 Takatsuguyoshida 1 Tadamori 1 Tolimánem 105 Válecní 1 Trawerza 1 uniátské 1 Taruhita 1 Tuttleové 4 Tiskarství 1 Uheskohradištské 1 Sukanaivalu 243 stoletích 3 Sverdlovova 1 toaleták 6 Thalimain 699 trvat 1 Státmí 35 Steinke 1 Unkel 1 Universálním 9 upírají 4 sulphate 16 spatreno 1 spisovatel a 2 státneprávní 25 Telnet 2 Toscanito 2 trolka 1 Toeni 68 testují 1 Stachla 1 trideni 1 Vaserului 8 Telcice 1 tukry 1 Trešnickovy 6 suprakolinním 1 Trarza 1 Timika 1 Stredmorí 227 Velitelem 1 Varsíka 4 Spezialetti 4 týmto 1 Therakos 1 Spearhafocovi 2 Štávová 5 SUNRED 1 Teufelsboden 10 uspokojovala 19 taka 2 Tournebut 1 Tatlises 1 STANDARDNÍ 1 Szots 4 Takumou 10 tunou 3 Thematic 1 Terpyridin 4 umajjovskou 6 tenue 7 Uzerche 1 U každého 1 trigasy 1 traditium 1 Tobinovi 2 triaku 1 Tanasorn 32 velkoplošná 15 Specific 32808 už 32 útržku 95 sútry 2 Unsu 5 Tonimu 1 Sydus 1 unnamed 3 udelovací 77 Tele 1 Taches 1 Stálozelené 1 Sumpac 1 uvízlého 18 stimulanty 3 trimethylamin 78 Tas 1 Tlo 1 Turiddovy 19 vápenice 1 spumans 1 Theassahäuser 22 Vehanen 1 Torriti 1 Tyda 1 sumbelem 1 stredobas 556 UP 1 Veberovi 78 Veles 1 Temonena 1 vCeské 2 Treytorrens 1 Systeem 2 Stunna 1 TELNET 31 Sputniku 2 UltraDev 7 Sungské 1 Tehlirianem 2 Spathelia 27 strucných 3 Uttará 7 upgradem 13 vesiculosa 2 svám 32 Štikov 37 soundtracku 1 Treppen 1 spalín 1 Unbeständige 8 tourských 1 Verwendungen 5 starorímskými 1 státnickou 1 tamodtud 1 Verdigris 8 vetrolam 1 Tomografy 1 tetrachlorozlatitého 104 Suter 3 Travenská 1055 španelská 3 Vehovice 11 tužkových 5 Tremissis 1 ujímajícího 32 spálila 1 uprázdený 1 Štochlovými 2 spolutvurkyní 3 Thákurem 2 ukihaši 2 Topcliffe 4 s vežickou 1 Überwaldem 13 Tagle 40 Tengah 1 Stanfordovým 1 Teijsm 1 Végaszó 1 Štefecekovou 68 úložišti 1 Svajambhú 2 SUBROUTINE 1 spríženstvo 1 Ugrofinským 1 Standardizacního 1 Ustrelený 127 Universitatis 3 Tyndalova 6 uživatelových 35 tz 33 Spasiteli 1 Tudjmanovi 26 týrán 1 Vebrüderungsfest 1 transponovali 1 svieta 8 trojmezní 2 trichloro 92 svítidel 9 svetlehnedé 8 Trichlorid 1 Trakehnen 1 vesmíranka 1 Vasad 7 Stogu 1 Túránci 1 Uvozeny 2 Tamesidské 4 Teruzzi 9 TAL 1 Tutrimt 1 Vanetti 1 Tarašca 1 Tettelbach 1 Tilea 1 soustredovacím 121 Švabinského 1 uniknula 20 uvízly 9 Sulibany 57 URU 1 Sportprag 4 Sülysáp 9 Taegeuk 1 Varpas 2 vchlipuje 3 tityry 2 švagrovými 25 Teigeho 13 Udržitelná 1 Trinchiniensis 5 Urušihara 2 Ubor 1 theofaniemi 1 útržkové 1 Tracteur 1 STIBOR 71 Strešovicích 26 stíhackám 11 sýrový 2 svatopeterský 1 tužebníkovým 9 Tigellinus 1 vestálských 1 TOPOGRAFICKÝ 2 Spolusestry 2 Tudabarai 1 SteinbergewLeoganger 11 tropil 11 ukloneném 1 Stredopahárské 1 születtem 1 sterk 4 úsecné 2 torts 1 Spontaneita 9 uhašeny 2 Týlov 1 útlumových 3 Tlacný 15 umístována 2 vápeníci 1 thiazolinonu 1 Taphana 1 Urakamiové 425 Strela 3 tokat 1 spadenou 2 staronoví 1 tempietta 18 Úprky 1 Tsukishimy 21 superfinále 7 Thibaultu 1 Tišicích 1 stolíku 1 trapezité 1 truthdig 1 stríbrozobka 94 Sul 3 Usnout 1 Ubytovacie 2 verliehen 18 tyroxin 6 Trasca 1 Trigonospora 1 tribbl 4 sví 1 Teismas 1 valori 1 trachyandezitem 1 spameri 2 Spektákl 1 Šunychel 138 Thunderbird 1 Tebisu 1 Staatspapieren 2 Tarjin 1 Tornanádasku 7 Vallery 17 Tašov 2 summarum 6 Strmost 1 úroceni 1 sunbrust 1 Torrer 1 teppó 1 Ultramafická 1 spolczenstwie 1 Szymanowském 2 Vastel 6 Turinga 1 suplikou 1 sozialpolitischer 235 Tintin 72 titulech 27 spáchaly 1 vainquer 2 Špole 1 Taiken 3 trubicovým 1 Thorelluv 1 Stelingen 3 Srbskému 2 tajnustkár 1 sucouském 1 spirochetóze 1 Telkara 1 Svatba 5 souvetími 1 staunenswerthen 69 usmernení 1 upravenén 4 Teckování 33 Thrash 4 verdammt 53 trollu 1 Stepinceva 1 theadolescents 1 Umístovaly 89 tercu 1 Svatouškovou 1 Sunsteina 2 svjakub 3 Teie 4 SZK 1 Televiizní 1 Utilitis 3 Tesarcík 20 teleskopickou 2 ultimatu 1 Splif 1 Toluš 1 Strezimere 5 Tascam 2 Thiétreville 1 Standardwing 1 Stefanovským 2 ungeltních 1 Steimetzové 16 Tarde 1 TAMARI 19 tanecnímu 1 Thadeuit 3 Štepánkovy 1 Tumbe 1 Tappanooly 1 svátkách 1 Truckcentrum 1 težívalo 4 Thommie 1 Taubenstein 2 Urob 2 Takumu 1 Ukoristená 3 SYLLIT 125 Trockij 1 Tusubu 4 upisuje 1 šurikenech 1 SPECIES 32 Substituce 4 Vaika 3 Stepanska 1 utaruw 1 Splnitelnost 9 ubránily 4 Telecké 1 VASYLJA 1 Vausselles 1 Stettlenu 1 Tuhkanen 15 špeh 1 vestibulovizuální 2 trímotorových 138 Stibor 1 Uriuri 1 vernisážemi 7 Spolujízda 1 špicech 2 stain 1 Spalow 7 Šterev 4 Veterinárního 1 Tišnovského 3 tetrameru 2 Vaklaf 15 triéry 1 Sylviou 2 Šroubáren 1 Trámoví 10 Udánky 3 stereoskopickém 1 Stredopleistocenní 1 špásem 1 Tanksley 310 táhl 1 Uberfall 1 svaljavecký 1 Uiberlandbreiten 80 tváremi 1 strboulech 1 Tournaisienne 3 šupinatkovití 1 Sthyrbové 1 tuningáru 4 TFIIE 2 Thamme 1 Turinské 1 Uleĺborg 2 stredoboku 1 Tsuchikage 10 Sportpropag 1 védantský 1 Umeleckoprumyslové 1 Svídnickem 147 Straight 2 úštectí 5 tauhíd 2 TRIUMPH 1 tiid 1 Stanowski 32 vartheta 50 uchazecum 1 Supercoppu 1 Trastadalvatnet 2 Sternstunden 1 Theodoret 6 Vedanta 2 Statum 16 stihnul 2 Velorcey 1 Sugiyamasaurus 7 Stadtbibliothek 1 veikkausliiga 1 Vanian 1 Tongland 10 Tuckerovou 4 VÁNOCE 143 trojskoku 2 Tüske 4 Ukrajinek 5 Vácky 1 synestézií 33 umistovala 2 trojradý 1 trojrohé 3 Spínání 1 s galenitem 13 Steeplechase 1 Tomícková 1 Stipper 1 ternosaxofon 3 spisovatelsky 1 Tatevský 44 Thajské 1 Trst 27 synove 2 Stabsschwarmu 5 Uffz 1 Swistowy 1 Trenaunay 1 trichlorethanal 1 STOCC 143 transportován 40 Užice 1 Teterev 2 Turkmenbašiho 1 Starcuv 2 tetrapyrrolového 58 Sumské 1 Umhausenu 3 Sousou 1 soužitích 1 s jevy 102 svobodna 1 stážní 1 vážnice 2 Vedouce 5 Vanury 27 tajuplné 1 Staromeštané 1 Toberná 2 vejcitém 1 útržkovitého 11 ventilovat 7 Trantorskou 1 Špidlo 3136 vetve 1 uppror 11 vázali 1 tlacky 11 vešeni 1 Takka 919 vedecká 128 TG 2 Sutherby 15 stehovací 66 sponzoruje 68 strílen 8 Tveter 2 vedeckovýzkumým 1 Tumbly 1 Telephantasm 1 Vagabounds 1 strugi 5 Taironové 1 tabulaeforme 1012 SUI 12 Útechu 3 Talejten 185 strukturne 21 Stromem 12 Tamerlano 7 Spatrujeme 2 Suchardových 6 Verheul 1 Stibiomikrolit 1 USBN 1 Trondhjem 115 uzavírací 2 Teflonový 2 Tantalem 13 streženo 17 vertebrátní 1 Stalingród 2 umocnovaný 11 Theón 1 Valentkovým 1 spoorlijn 3 Triebschitz 29 Strelická 2 Tagu 5 Valentu 1 Svetového 1 szépe 1 Suppliant 2 ústricový 1 superfinalistek 9 ústícím 1 Starojickou 1 Tonfön 1 upsanou 3 veszprémského 11 terminologického 1 Teradjon 4 Stanovami 1 Tolylfluanid 1 Ungeborenen 1 Ursensollen 3 Vély 13 Velkopolská 1 Toxicards 1 väimstes 14 Srpek 3 tepal 1 sudbina 8 úctována 23 uvedomilo 2 svahovinami 2 supercivilizaci 1 Staníkove 1 trojhranec 2 štovíkový 8 tlakovzdušnými 2 varroázu 2 strížkovského 2 špak 1 tejnického 7 Täschhorn 1 Stredofinského 1 Trocnovu 1 Thymotickou 13 Uzavrena 2 toletanus 6 Veiss 2 vazelíne 1 tožiž 3 Šukacka 2 spolužácích 4 Tunklem 1 Turnipseed 173 udelovaná 3 Tamami 2 vesnicanek 2 Svatoplu 2 Thess 1 trombú 1 sténali 1 tijden 1 Udehejce 1301 vajícka 12 správností 4 Thénac 1 Tilopy 1 stationsgebouw 14 Szamos 1 Tweedovou 1 torture 24 stupnovou 3 Tuvou 2 thalidomidem 1 velćrvćrdige 4 ucnovství 9 velkotrubnatý 1 suverénnost 8 Umpa 4 svahovitých 10 speciesismu 4 stoparka 2 Untermainebene 3 Štasten 1 Tonicciných 4 TiIV 1 starcku 1 Strolionys 3 tucholjské 1 Turant 4 tesarskou 69 Terentius 5 Tancem 2 Velišova 1 Turczak 1 Spoerli 1 Storelva 1 sulfan… 1 vatan 107 tchou 4 Stránske 1 verifier 2 Tessaloniki 2 ummagumma 141 technologiím 1 Veligard 1 tóré 1 Stencila 1 Sparycz 1 supramolekulárních 1 Veselovskiová 2 tympanicum 2 Suluský 1 tejar 5 trockistickou 1 TrendMicro 30 Tadic 1 Tusken 1 s Herdez 1 TXU 9 Talin 1 Štemflík 6 stratotypem 2 Versmassen 1 Sukenicky 76 Startovní 1 suplentka 2 Valtírova 1 sudoeste 2 troubelice 1 transcendentalizujícím 9 Velkoplošné 83 uherskými 210 sutta 1 Tankosicovi 1 Tekme 93 upright 1 vednými 1 Tarnycja 1 Stržíšek 1 Vavrineckem 23 stredoškolském 2 Tampare 1 ubikvitinovány 3 Uladh 1 startupnation 14 Soundso 16 Strýckovy 1 Valescou 2 Verin 21 spinosissima 1 Strindbergovských 1 Tretejskoe 3 štvanou 5 Stammesgeschichte 5 symbolisté 1 TiFeMnMg 1 Toujaro 1 Stilmonde 2 tooltip 1 Templeur 4 Theokrita 1 Stoupajícím 317 spustil 2 Vendo 3 Tzotzil 7 to 53 splynou 26 ucarovala 1 Uthar 1 Sovetslého 1 Titery 1 Valandu 432 trénink 1 štedrovecernicí 1 s farárem 2 Turou 1 Stryhinský 1 tvárilo 45 Tuchacevskij 3 validací 3 Tihi 1 Turšnerem 6 Szigethalom 106 Teodora 1 taimyrensis 5 Tonioli 1 Tsleil 1 Stárkovem 1 Stochomys 1 tornato 3 upis 113 standardum 2 texturový 2 Vaiko 3 Verosta 1 UltraSharp 7 teplokrevnost 1 Spagyricum 5 Tyrantem 5 Tyf 16 TVT 1 Urbanihof 8 trešnove 3 toscana 2 trichoderm 25 termálního 3 Urozených 2 transcytóze 1 velkožupa 4 Urpín 1 uvni 1 tulnud 1 Svetlohorská 341 Stop 1 USAAS 10 Štelina 1 trovis 28 TOFA 49 Studny 2 udtryksmiddel 3 Tseen 1 sulfobenzaldehyd 6 sražením 1 Tarraschovi 3 uvádejíc 1 Tusaújfalu 112 úces 1 Tybély 10 sycivé 1 védští 1 teplota… 1 veprínech 77 Specifická 1 stredoalpský 7 Syntézu 5 Swardt 12 úrovnových 1 Vašíkova 1 Vaksimile 2 Thráctí 26 talismany 1 superkontinetu 1 tovstolap 1 Travisovu 1 tennenkinenbucu 9 tlapové 1 Tashing 5 Terrastock 1 Susojoke 1 Tigulliorum 10 turkická 1 Triadisches 1 šupinatém 1 Tsuruhashi 1 Tadbir 4 Takahisa 17 Sundském 2 termotransferové 61 Stoveová 1 vasaly 1 tarifikacními 3 utlumovány 1 transofrmaci 1 Steyrova 2 Teuffenbachu 11 technecium 3 valašsky 2 takeoff 26 trecích 3 Sturmgeschutz 1 stuatutu 1 Umírajícímu 2 Unionoida 2 s náboženským 2 statéru 2 Thorstensson 1 tomistou 1 Undresses 1 usunulo 1 Stiliani 1 Sundgren 1 univeritu 1 Vanthoffit 1 Strzelitz 2 Tapperta 40 Vernost 1 u betonových 1 Szabolcz 1 Štark 18 Sprízneni 1 UPOMÍNKU 1 Tatlinuv 1 Sukcinylcholin 2 Steibis 1 susceptibilit 3 Sunkovským 1 upport 4 Vencový 1 Sudamérica 1 trumpete 20 Stopecky 18 štepka 9 Vedžat 6 Syrovinka 1 transformuce 270 tvuj 1 Touil 1 Udroklis 1 Temus 4 teff 26 Tlstá 6 Sverdlovskem 1 SpaceProbe 2 sunitští 7 Szálasi 1 transeuropaferries 5 transcendentalismus 1 Umelcuv 1 turibulum 11 Verapaz 1 tac 2 tachismu 1227 stroji 12 uvedeních 1 Trebomyslicemi 1 Sunstrach 29 štípané 1 Sulislaw 1 Tklivá 1 vaninaickx 1 Tykotín 5 Soundtrackové 1 utesnanej 1 týtáním 1 Vetrováci 1 Vendelínka 37 Testo 1 tympánovými 15 Tullamore 11 Šuster 1 Strazdas 1 Storbacken 1 Talebe 1 Torrigianovi 22 tumoru 436 Turek 1 veluchieuse 4 spirituálu 1 spaventato 5 sterilované 1 Teoret 1 synonymnímu 1 subjáhna 20 stopkovýtrusých 3 Strezetic 4 Tahesia 1 Štepinková 14 tyrosinové 154 Verejný 1 Špindleru 6 Striani 14 termitištích 1 Torkunov 1 Theodorapolis 10 translokaci 6 Terradellas 1 UNASUL 11 Umagu 3 sympatricky 1 UCJF 1 stavbarum 3 Tswanové 2 Verboten… 1 Tongský 1 Unterwellenbornu 22 Universitu 1 Teriachiu 1 Terebrellidae 3 Uraggan 1 spekuláriích 1 Tsarev 1 téleion 1 Soustell 1 Sredniak 5 unašeci 2 Štrouchové 1 Trichobranchidae 497 spustit 1 Thantovi 1 Uhynout 1 technohudba 6 Ternay 1 Tappava 6 Tomsy 1 Tolarisem 7 substancemi 1 subjectid 1 Troinex 1 štepánovském 13 tremdavy 1 Tréninkem 24 Ture 1 Tonci 1 Tomskaya 6 uzemní 30 tlouštkách 6 ucíš 1 Steter 1 uniformizace 5 stíracích 2 ucimata 1 Timeshift 1 Sugenheimu 1 usirovskými 2 stotožnuje 1 Ulu?u 1 Tloknu 1 Stephansruh 1 ?aliba 2 venerofobie 5 Unavení 2 Vanhovou 1 svjatkuje 1 stretajú 3 stríkacími 1 Timaiovým 1 transferase 3 torzovitá 25 útky 5 Vámoš 1 Trimedoprim 343 usnesením 2 SRO 1 Vakuovou 2 Trebotovic 4 Tauberland 6 Swammerdam 6 Strednedobé 1 Tauerntunnel 1 trigonus 2 Tijger 1 stagionou 30 Tormo 1 temnohrbetý 1 VAVRÍKOVÁ 2 Strmiskovi 1 Sztandard 1 sterlede 12 stríhaných 6 Tammeka 1 stakilometrové 2 Tarun 11 úložištích 2 Tremblez 2 Vedychtivý 5 Turnajská 1 Studenkové 5 Tratovou 8 ujelo 1 s vrelým 1 ubíhajících 5 Šuše 4 Svetovými 640 Steel 1 Takmeta 2 tivra 1 Strahimirem 2 véskou 8 uživili 1 tunetanus 1 Trstnatec 2 Urgelles 1 Tomaneková 5 trináctému 7 Strachu 1 Tibouchine 1 tenrek 1 tocírnu 1 Umeuleckoprumyslové 2 Svineckých 3 Spartakových 1 Švestkovna 1 Tellheimovo 2 Tournas 3 Strojené 1 touge 1 Tartarico 1 Tremaximus 1 Tricomi 1 stenoxenní 1 Spolocník 2 tankoborníky 58 sužovala 1 Turócnémeti 1 útulnejšími 1 Sta 348 Terst 25 Târgovi?te 209 Vesna 3 UPROSTRED 1 Upalováni 1 sublimujícího 1 usmažil 1 Übernationale 1 vetustissima 1 Trzcianno 4 stupid 1 Tgeheele 12 tendre 39 ucebnách 1 Szymanowice 1 tecnému 1 Tanekas 2 Suben 126 spal 1 Tlesky 1 trennen 1 Threiskiornis 28 Trhonice 21 Vektorové 2 Standarty 1 Štefíkov 3 titulními 1 ventilovány 1 Vanetina 2 theatralischen 24 stranit 1 Velkopavlovicko 3 tongánskou 1 Strahomer 47 Táto 1 spiraeae 26 svatodušních 4 thrashmetalovou 27 theatinu 5 srolovaný 276 studánky 1 Tißa 7 utajuje 1 trojúhelnou 1 Tapejaridé 1 Truhlárnou 21 Špetle 1 Ulakai 1 Stachivno 1 Štechovickou 4 svedska 2 Veslena 5 teneriffae 6 trapistek 38 Vere 4 utlumili 1 Spasmopan 42 trajektorií 31 Thunb 7 vehlasní 7 strádat 2 udržatelného 20 vedru 1 s Adrianem 4 strakatosti 1 Trzebowitz 1 thufur 1 šover 1 Stefanovic 1 Svinesundsbroen 18 terminologický 2 Trachíne 10 Stéphan 1 souprašnosti 1 stejská 1 valenok 1 tinag 1 Taliáni 1 Sterigou 31 ukázání 1 Trudeauovou 1 Tiros 158 sportovcem 4 stopnout 12 Utilitarismus 3 Szypula 1 Vedmežyk 1 Šumivému 3 vavrince 1 TEORIO 4 Suitu 2 tercín 144 Sykes 1 Stylistikou 5 tibiale 1 Thaovy 1 textappelum 43 Telescope 1 Traffordem 2 szanse 1 Stonou 1 Stehovací 1 Tikulti 73 UM 1 Starsn 5 Trinitat 7 Teotochi 1 tretiradých 1 Themby 1 Termonatrit 833 Valentin 3 Tomahawky 1 STDMETHODIMP 14 Umbriel 2 Stolbun 4 Telmaríni 16 tábority 373 stáhli 3 Vabadussőja 1 Unferthem 1 Trhanovského 2 Vechýtek 4 Upstart 1 usnadnení 3 UroKlinikum 2 Tejchmana 1 s Gymnáziem 1 trojkarkou 1 thioacetamidem 1 Triptolemovu 1 Tripolitsas 2 Tircis 1 Švandrlíkovy 10 stacku 1 Stenmans 1 uctivána 1 Steklému 1 synonomie 1 Ulpianuv 1 tradisjonen 47 uzákonena 1 tüu 6 Stomachion 19 sportovištích 8 Stax 1 starehobzi 1 srpatkovitých 1 Teafuafatu 190 terminální 13 uniformitu 9 Verri 1285 Války 2 svrchnepaleozoické 1 Turnquist 10 sprintu 1 Talima 1 Tuojiangosaurovi 1 stanovický 1 velkovaradinský 1 Tonetovci 1 upanišadám 57 stélka 1 ÚSKŠ 1 s transeptem 12 Velesem 29 Sýry 10 trpkého 1 SPCR 4 staci 44 Tien 34 tlumocil 1 Trmické 3 vallenato 1 trojhrob 1 Suursaaresta 2 šteknutím 2 uskladnenými 1 Vercelum 16 toppdomäner 66 Tmavé 1 superponována 132 tackle 16 Štepánovy 7 Tradovalo 1 Trainspottingu 11 trubacovitá 2 Tomislaw 10 Tiffani 1 Taygety 1 terorismu… 1 Subvulture 42 stycný 1 Tiamiou 92 Spektrální 1 Vance—pred 47 Strangers 1 Svinošický 3 steinheimensis 2 ŠSZ 1 Ušpijovi 1 Uhríneveský 1 válecníkaLemminkäinena 18 špalík 7 tractor 2 stredocaská 2 Stenavsko 1 Tornanské 1 Sulvanit 1 Štolluv 30 úhelník 67 Stránského 1 Tarlyho 1 Strojsmalt 1 Strenicium 1 Stilwelluv 1 Tabaracciho 3 Velomobiel 2 Vadelaincourt 2 superdela 1 Stübchenmusik 1 Trbovljami 3 tuhnoucím 2 Stelmašenko 2 s Pinus 3 Ustari 1 strontnatou 4 úrednickému 2 Ubinka 1 Sweany 1 Staen 2 tenorsaxofonem 5 teplovodivé 3 spravedlivejších 4 Traf 83 ubikace 2 Umorovacího 11 ušnímu 1 surfínie 2 teréne 1 Tannengrün 18 trojrozmerne 1 Styrocut 1 trnocolka 1 ThaMuseMeant 1 Taliesina 1 stavku 1 stálobarevnosti 3 Strnadum 6 Tucuman 15 trollí 2 Tommyknocker 1 svidríkových 95 táborení 1 údelníkovi 11 Štip 1 splétajícími 1 Verdiovských 2 Stubíka 1 tibiotarzus 44 Tarentaise 74 Terminologie 3 Valtari 1 Sqlite 1 Vésziová 2 vackovém 8 Trckovská 1 Srovnávané 1 stélková 1 stormningen 1 Tertz 4 svatotrojického 2 Tokunošima 1 sympozii 1 Urwa 8 STUDENT 1 Uquique 2 tumo 7 Symeonovi 1 tarnovská 1 Vápenatkovité 1 triang 3 Starosvetští 21 svlékl 42 Travná 1 Tallaksen 1 Uhradit 1480 ted 1 Sympaticky 9 Tollner 1 Ugovizza 1 tadtu 6 uprednostneny 1 tnromantik 3 Sukarnopura 1 trialkylfosfát 7 uniknutí 5 velicenstev 1 stredovepština 19 Terceira 18 Teškov 1 Springfieldských 2 Turjanová 1 Tretjakovovi 1 sultánskými 1 srpok 1 specifictejším 3 Szohr 2 Stefanovou 1 Thethi 1 Steinern 2 Sourozence 1 stríbrozelená 7 Temenos 1 VERACX 1 Varletha 9 uverejneným 18 Tarquinio 1251 tramvají 1 Untersucht 1 Stychova 1 Strížkovský 1 Starrabba 1 stereogením 1 vediech 1 tuberales 2 Stranitz 1 UNSF 1 Tschullik 1 StSa 52 uživatelskou 8 vedeckovýzkumném 8 Tineidae 1 Taurieka 11 Splašeného 1 španel 1 Trovafloxacin 1 Stormsova 1 Stocí 1 tribulatione 7 ubrousku 2 ústricím 1 velátu 1 szescdziesieciolecie 5 Thele 1 spolecenskoreprezentacní 33 Stropnická 3 usídleny 2 Usuál 1 Szentenderský 1 Szeghalmon 4 unga 1 Steiermärkisches 1 swobodu 1 Utulei 3 Udivený 1 unheimlichen 6 taurinu 1 vazací 3 TENNANT 1 Tallindera 15 stvur 12 tavených 1 Västmanlands 1 Tvurkyní 2 torn 1 Šúdra 13 spouštející 1 uštvaly 75 Vápenná 2 Švolíková 3 Tylodina 450 stanovišti 1 Thodes 14 Stroetinga 4 Thierrym 7 Taisija 1 Šovhenu 1 trojspirálovitý 2 Starocínský 21 Svobodnými 1 turbostroju 1 Venezualanku 1 úrastníkem 1 Thoben 4 Trichostrongylus 1416 toku 1 Susienta 2 Stantz 1 Valhallu 2 Velickým 1 umjeni… 4 subagg 1 tucném 21 Techonína 3 uplatnujícím 2 Tromborn 3 spodobnena 6 Suematsu 1 sviští 8 TGFß 1 stamiliardové 1 vaxançeran 1 Tappi 1 Trettondagsafton 1 Troierianae 1 tazendské 3 UMMC 9 Šumperkem 5 verapamilu 21 sull 6 superordo 2 stalagmitem 60 úsecek 41 stupnoval 6 toxickém 2 spartánskou 1 Tubalkaďn 1 trásnenkovití 23 teoretickému 1 Traplovi 2 Tázok 1 stegosauridi 3 Undaová 1 Šukajb 1 Syrtos 2 tryptózovém 1 Urechean 1 tuneloval 1 toplingva 2 Svazarmovci 1 Vaudremerem 1 umývacce 2 Topavicza 1 tryptózo 1 spoons 3 Verdeho 3 Veritonu 1 Tartarara 1 Tošiniko 1 veganstvi 1 Stationsplan 2 stereoskopu 1 stun 1 Svalöv 1 Stimsonovu 1 usazováky 1 supersilný 1 umenímilovnému 4 Velenec 4194 texty 1 Trubatky 1 spontaneo 3 Vejcovitý 1 temperovala 1 Unefunge 88 tíhu 2 turbomotor 1 úsobský 5 Topolciankach 1 Veschnitz 4 Tožic 3 Szczypiorski 1 Staudingerove 2 Tenaya 1 Urgashovo 1 technosis 1 Trzesty 1 Urbakodon 7 Tailly 1 Turkmenneftegaz 4 Takatendžin 5 Torreblanca 5 Sudetonemeckém 1 suríku 18 usušit 1 TESTUDO 2 Systematicko 2 Uchova 3 úctovaných 1 Undinou 3 udelátko 1 sraženým 1 Trimu 2 Transocean 9 subdominantou 1 spectators 1 Stojicsová 1 Tarchies 9 Spongiformní 3 Tonouchisaurus 1 tangestánština 1 Svatborice 1 Útrap 5 Stülera 1 tenaille 1 Tulakových 1 Thälin 6 Sponzori 1 stejnovekými 6 tyranizuje 1 svetákuv 1 unovuzvolen 2 Stoneface 1 tryumf 2 Újpalota 23 Vencelas 8 vadách 3 topi 1 ternopilské 14 svátostmi 4 superantigen 1 tabstop 1 Superjammin 4 vaudevillové 1 útocištní 8 testovatelná 1 Treaux 12 urcované 1 uziem 4 utnou 1 upadáváním 2 vébou 3 Udžinao 2 stredozrnné 1 Uljinským 1 Sportteamu 1 sydvarangerský 2 vadulské 1 Uslarem 1 Uspokojoval 10 Stelarc 1 transvesikální 6 syringy 19 Tarice 75 spraše 2 trístežnový 1 UCH 31 Tamaz 3 Sultánuv 10 UŠPH 13 Vakcíny 4 Trumšajt 89 Trpí 10 támhle 3 Suursoo 5 sundavání 356 tahu 1 Uninvisible 1 štavnatejšími 1 Upologus 1 Uvacké 1 tedžas 14 Starkov 2 staropražská 1 Superfiction 1 Vekarat 1 Tooken 3 Suonatore 1 Srostloobratlí 2 Šubarkuduk 1 Verganim 1 Spazek 48 Trebovle 1 spornrafti 29 Vašku 4 spoluprácí 1 TISKAP 1 špýcharovitou 4 Utleya 1 Taroucu 17 Tukové 1 Swanenburghovi 1 Tolstý 1 Stankowce 1 talír coby 8 Štaufským 1 tursus 1 TimeSensor 1 súfistické 12 tkalcoven 30 strukturovanou 1 Tonyspear 1 telestereograf 1 Subure 1 terminalia 1 Teutschmannsdorf 1 varmskou 6 Súry 4 tetraterpeny 2 Tuuliset 4 Toytown 1 tajžští 17 spirálách 2 Stuckismus 1 Vešte 8 Technologickém 3 Teplánová 21 urazilo 3 trichlorfluormethanu 1 Vassilevová 69 spodinou 1 Tukomax 1 upozorneních 1 turism 1 Vandara 2 sulfurique 4 Suckale 1 štamgastem 1 tremp 1 Talgkerzenfabrik 2 terrazza 3 svrhávali 3 Utecou 1 Turkménské 1 StC 1 ŠVABINSKÁ 500 spojí 2 Tjikko 1 Thinsy 2 údává 5 svažitým 26 Stropy 181 Touškov 1 Teorija 229 tarif 1 trvalce 47 tolerují 1 Sumpango 1 Twininga 3 tarragonská 22 Trotter 4 Velkolom 440 Štepánov 2 tehda 4 storocie 2 Vestel 68 svetlejším 2 Utický 1 Theronti 8 utlacován 1 Urychlují 882 teplotou 1 vatala 1 Vanqua 9 Traunsteinera 1 UzemniPlany 1 Telephorus 1 tzbvalmez 1 svazk 1 Trošev 1 telesé 4 Szentmihályi 1 Steyersberg 1 štábu a 1 s nejistým 3 Treville 1 trib 1 Vclenil 2 Teketória 4 unavily 13 subordinace 1 Štátni 1 Sprincakovi 2 Testcentrum 1 Towing 3 Tonatiuh 2 Teuchert 1 spoušteném 8 Strechatka 2 vermuty 18 uzdravením 1 Spolocenský 1 tablicy 1 Velavaly 1 Tourneuse 27 starorectiny 1 tmavooranžové 21 staronový 1 trýzelem 1 synágou 3 Strendur 1 SVBRDF 2 Studénský 2 Sýrovic 1 údržbovém 1 úcest 10 Tiu 1 Urnai 2 specální 1 Tholde 1 Ungrischen 1 trístredová 1 Sukhumvit 4 Šuafat 3 Thurin 1 Tibbitt 1 Steeples 4 Vermut 2 urbání 1 Svíravých 1 Túz 1 't??? 1 Vespasiánovo 1 stoparkám 1773 úradu 9 Velkobukovská 417 suita 1 termoprístroje 1 stýcem 5 veneta 1 tmárský 1 Spiritualizovaná 24 úlohám 11 velkoobchodních 2 Špicce 1 tlustovetvý 1 ?tefoi 2 Spreo 1 Stonovým 1 Västernorrlands 1 Timoscenko 9 stomachikum 1 Szentiványové 1 Steigaufová 1 ustašovcem 1 Usmanow 212 Ústredí 817 úspešnou 55 vestfálského 69 trvalejší 1 ÚDOLÍ 5 Staurikosaurus 1 Squalli 2 táboráku 327 šperku 2 urychlováním 1 Trousnice 2 Unce 4 torontských 1 Uhlirník 1 Starostia 5 Trieb 12 umbellatus 11 tagh 1 Tekijský 1 Tutcevovy 3 Vadodara 4 Theónova 1 Udraka 1 Trzemesznie 857 textem 9 Tilli 1 tiul 1 Trauttsmannsdorfa 1 tercovnicemi 1 Sulanovou 1 Spišákem 1 svíceno 5 Tawbe 34 sts 1 šulu 1 Steinitzové 1 trubkonosými 956 terapie 18 sousošími 1 Thusmühle 2 Vekslštube 1 Stodulkovou 10 toltécký 20 Tuleni 1 Stínupán 24 typologicky 1 Ubušína 1 Strasbourk 1 Taoani 1 tezisy 1 sychrov 9 Tejkalová 1 Theodobaldovi 1 Vertically 1 spojujíce 1 transitního 1 šterkovnka 1 trikolórovou 1 Veeker 1 tiskout 1 Talakona 23 studna 4 Syrphus 1 vestavnou 10 Taschek 38 THEN 1 spolupripravil 1 Torulinium 2 Specklese 1 Tukwilla 2 Tonghak 18 vankomycin 10 Šujan 1 teraformovaném 1 Tateišii 1 Spreewaldkrimi 1 stojatek 6 stéblu 2 Trydupys 10 swiat 2 Svatomikulášská 1 tyreotropinem 1 Streinové 1 Tarasovou 1 Sperlingem 1 s tamním 42 ÚOOZ 1 Verchnebjarezinská 5 vetem 1 sutovitý 1 szentivanyi 1 Urgelské 1 Vallalolidu 1 Steenfatt 6 Varilhes 2 Tscherniw 148 trhem 1 verdiovský 1 Urbeleskarspitze 9 symbolisty 2 tray 1 Umucena 4 trojrozmernosti 11 temnejších 1 ?aranu 24 uloženém 1 statico 1 strednomiocénní 2 venne 1 trzydziesci 4 spolumoderátorem 7 Tvrdou 1 Vaneckou 3 Tatsumi 1 Sternholda 2 Transsamarskou 2 tyfového 179 Tramín 34 Törmänen 1 tríštivému 3 subsféru 5 ulpelo 1 tribuiním 1 Stelletanone 1 TAFLIR 1 tribufos 7 Strukturálních 25 termografie 1 stassfurtský 15 syenitu 1 Štorkovi 1 tuchotické 8 Tabulek 13 sražené 6 Svinesund 1 Typfl 1 syncany 1 s milostnou 5 Tras 1 troyiané 3 Trégunc 2 Upsetter 1 vazalé 2 Tomiko 1 stipulosa 2 UNT 1 vaskulitide 2 Tutuše 114 sporta 2 svrchnokrídoví 1 vakovitými 3 verbunk 1 trohejský 16 Sturmer 1 ustecketramvaje 2 sumerštinou 114 tužkou 1 vbíjené 1 Surhumaine 1 Sumuel 1 Strömgren 50 uprít 238 Turkmenistán 3 Umjetnost 3 Thummimu 5 stríbrnáku 1 s komplexní 3 Splétaná 1 Superconductivity 8 TGG 2 varovnému 116 starostkou 2 tombol 3 tkven 27 Stronnictwo 1 SpeedyExchange 177 špickové 1 štítivého 4 steroidu 1 spoluzakládat 2 Troubská 1 veekaitseala 3 stenocoma 1 Trägheitsgesetz 1 s rozsáhlou 1 utažených 1 teleportovanou 1 Turoyangastivinus 1 Švrkl 9 Turquie 1076 španelsky 19 tríštivo 53 trojúhelníkovými 1 tristaosmicka 1 Varšavanka 1 srpnovými 1 trojstopé 1 staršými 30 spjati 78 svedomite 1 Trochomeria 1 Uranpyrochlor 1 Svatoklimentské 1 svacinových 3 thaya 41 spoluautoru 4 Tazieff 8 stoparem 17 Takovýmto 2 TwinStroke 13 theophrasti 1 tangách 12 Stabia 2 Válkových 8 tajiny 60 spectabilis 13 Szczepanek 1641 svatý 4 Terytoria 2 trojstežníky 1 Stutler 7 tomografy 1 Spanyol 4 Timofejevic 1 v?i 1 Tegopeltidae 1 superiori 1 syslové 6 Trnovce 30 tatarským 1 Titlisu 3 Trídimenzionální 1 sumárích 4 Tukiainen 3 Strager 3 thoroughfare 1 Tvrdišovci 1 Vaterlandslied 1 Trebuchety 4 Spoluautory 1 Vámosfalva 7 tempe 54 strastiplné 1 Toeghin 1 Stecherové 13 staletý 1 s poliklinikou 1 Tiffenauuv 3 trampem 1 válkovou 1 Termel 1 VANUROVÉ 1 Versants 1 Temwen 1 Straminipila 1 vehikly 2 vernakulární 4 uzbectinu 1 subdenudala 1 Trachystigma 1 urartský 3 Tarentem 1 stenar 1 Teganissorense 72 titulum 1 Spoluúcinkují 122 Valerián 1 trojkrálový 30 Švankmajerová 3 Stanzani 3 Tchajwanek 2 útlým 1 Ultris 5 strumou 2 Vesselényiho 2 Stefancic 238 ukoncilo 3 TRUTNOV 1 Stanislavauna 1 upozadí 1 tintazzioni 2 Tinkov 1 šterbinek 5 tpejjep 1 telemarkoveho 9 Sychrovský 1 Vetsera 20 Tonkünstler 2 Thélus 1 Trelanových 9 Treveru 1 Trojcat 6 uhlove 3 Tynalijev 1 tisícky 2 Tofta 3 Tötges 1 Sozo 1 suroviného 1 stylistce 2 Tréon 1 treverorum 1 Stery 1 Týmlová 1 Szoszka 2 Stro 1 Troai 1 Václavec 4 stepan 14 Szikszó 2 s lineární 2 Stavin 1 Tamkvac 1 Sypljahinová 4 štechovický 21 stykac 146 traktoru 1 starobabylonská 2 Terbovena 6 végétaux 2 strážského 3 Thaliina 1 toccatu 8 Teltsch 1 Stearyltyrozin 2 Turalyon 1 uszka 9 Stewartuv 1 Veracruzem 1 transylvánský 1 Städtchens 2 Venatory 3 Tabarés 1 ukrátil 2 ujednaná 4 vágnímu 1 Tenfield 34 soundtracky 1 subxerofilních 1 Svatoroha 46 Syrového 1 Ummaru 2 Trilliales 1 Spaemanna 2 teórii 1 Stachyarrhena 1 truhlíkem 1 Svinštan 2 Suensaari 1 Tolokonninová 9 Suvenýr 2 Utekhin 1 trilocularis 2 Staroskotské 1 SWÝM 1 Ulakli 2 Thalinji 3 Turtmann 2 supermoderním 1 varnsdof 2 Valuškuv 1 tlumocnící 17 tvorovi 1 swajzba 26 tkát 1 Stojowska 1 subdistrict 1 tarzálním 1 Terpentin 1 velickém 5 Tarzanovo 4 Tendres 1 Szegö 3 Veradem 1 vencovku 1 Telezynskiemu 2 Tomicevic 318 spisech 3 Teumman 2 Toccara 1 TERT 1 staršímy 10 Technolenu 3 Subset 29 Starosti 1 steveirwini 1 Velkonákupna 10 Venhoda 4 Vallouise 1 vazda 1 Tuwy 22 Svetovar 1 Unterhof 1 Tondrou 179 Tešínského 3 Tálie 2 Theaux 1 Szoku 1 undercurrent 5 štítnatým 1 Tündérkert 4 Tchaksina 1 Tuej 1 thurisaz 5 trojlístkem 8 teri 1 Tachtigers 1 Tanaki 3 trýzelka 1 Tusti 1 Sukkozero 5 Spheniscidae 118 tympanonu 2 Urkundenfälschungen 1 Stopách 2 Verany 1 Tamania 1 toharat 1 ubránitelné 1 velatum 2 trubicového 1 ucatsja 2 thalidomidu 1 tankóbun 1 ucítíme 1 Thomsenová 1 suishominis 2 UPOZORNENÍ 1 Vandem 1 spumigena 8 statt 153 syntaktické 1 Trümpy 1 tužidla 2 swingování 1 TarnowskieGory 7 vehlasnými 267 Vegetace 2 Triihvo 1 tentativi 1 titanosaru 1 Süderoog 1 VASARI 49 starající 2 vertepského 1 Vecelliho 1 Southtowns 10 Stolar 1 Tillemannové 28 velmocenského 1 Uken 1 Suonare 2 TWIN 11 ujištením 1590 srážky 1 Umlauff 7 Ustrzyki 2 Tchýní 2 Uccellatrice 7740 Španelsko 1 teatinského 7 Tindaro 1 veselce 1 Tiefelgrün 8 veli 1 tetrachlordifosfan 1 Trouty 1 STBáckou 2 trility 1 spermatocytum 7 Standpunkte 1 Thargoluv 2 veltlíny 2 Vendenheim 1 varmatin 1 Torresolou 28 Varsity 1 stejnoúhlá 1 srážíme 551 velcí 3 Trogerem 3 Vaterländischer 1 Turzovo 1 Utopenými 1 tesnil 1 Thiemstrasse 1 Stožky 1 veteraniády 1 uhlíkato 1 Squig 1 tewet 1 Tanowo 1 šykyr 5 Urianchajcu 1 Unimai 7 Spinnin 1 Stevenského 1 torét 1 Verantwortliche 1 Upoutáním 1 Umawí 1 Teteven 179 spolecenstvy 1 ssistant 5 tvarohovou 2 vemenem 1 uspechána 1 upito 1 Tragaldabas 11 Uvea 4 usedlík 33 vero 233 ukrýt 1 stroboskopické 1 Sunriské 9 Vávruv 8 Švorcík 1 Verlagsvertrieb 6 Vedecká 1 Tejnecká 51 Štramberku 1 s elektromagnetickou 1 velikáškým 4 TÄUBL 59 Tonnerre 4 tricetitisícovou 4 spolueditorka 1 Stjohannbaptistnda 5 Torrojy 2 splátkovým 1 Thumabach 89 trunní 1 Stíhacích 1 Ulfovcu 4 Vénérand 10 sporokarpu 1 timokratickú 1 stupnja 1 Spektroskopickém 1 Touringuv 1 Varteliai 1 Tumanšet 1 Sufflota 19 uhynulé 1 stratifikovanou 4 užíváná 1 Spinory 1 svinovacích 121 vážení 3 Thurnbichler 1 Veršu 402 ústa 1 Streatorem 1 Tastkino 2 sverenských 1 Vauquerová 1 stylesheetu 21 Tikrít 2 Sperarum 1 technooptimistickému 2 Trojmezné 40 Šušve 1 Trilje 16 ŠP 2 usmevavými 1 Trebekovem 1 Süttör 2 Stigmatic 5 úctujícími 2 studijského 1 Tarnasky 1 stuckistický 5 špionek 1 s usneseními 1 úrocitel 1 Vedoucí 3 Stemple 1 Sténone 1 Torpedofangboot 1 Spisovatelstvo 3 Veríce 2 spoluvinou 2 tutoriálem 2 Tingvalla 1 SQLitea 1 utažena 311 tatínek 859 stretu 5 Svobodovo 7 superciliosus 3 stresovat 3 umucenou 3 Swieté 5 špejlí 13 vazníky 1 tunis 1 transexualita 2 Undermhimmel 3 teien 1394 Štepánek 2 Velem 1 Stáleplodící 20 taký 131 stropu 1 Szalejów 23 Strakonicku 1 Unfälle 1 Törökvés 8 tešíme 1 spolukandidátkou 1 s maticí 1 superdense 2 svodidlum 1 summu 3 strelitzký 1 Sterlinghillit 1 trícium 2 Uxeloup 4 štenata 1 teleomorfe 2 Sunnyland 1 Spartani 1 Tongoloa 14 Šternberském 1 svébohovského 1 subodménu 793 tiskové 1 Trzydnik 1 Uhlazenejší 1 teletextem 1 velebená 3 úzkokolejkou 1 Starcamp 1 vesillo 1 Teaterskolan 2 spritové 1 Úrubhanga 2 Vesalea 1 vernisážových 20 Trojnásobný 1 Tykvové 4 Tenel 6 Trompeter 1 Šumburku 1 SPINE 2 úpadním 2 Strelivina 4 Vallerois 1 Spanovicová 2 Spettique 2 Umreš 1 Strojvedoucího 1 Sturmflut 10 Sunt 1 stadtschnellbahn 5 Tyrolským 16 uspokojilo 1 Trzicatku 29 Stratofortress 1 Trokeli 1 trasgenderových 1 Szobos 3 Vénuste 2 Stadtische 2 Tanistry 1 Tavacká 75 Synonyma 1 utrapienia 39 vclenil 1 ucitel 1 traktáru 5 spacáky 3 trnovského 4 Varesco 2 Suduiraut 1 Tarag 1 STAVITEL 7 strevlícku 120 takováto 5 svárecek 1 staph 4 Stredoruskou 1 tsentrallinoy 4 Vesa 1 Strumer 1 Szerkezettervezés 10 Vesecké 1 venna 3 Valgaava 2 Texelové 1 Torišimo 1 ulétali 1 Stredopravicové 8 ustájeni 1 ušetrít 3 Stredoamerickém 1 spiacich 1 Uhlisk 1 S Dinamem 13 utajeném 1 úfarsin 1 Vardová 8 SVŠE 10 tetrastigma 1 Tambue 34 Unitis 37 unserer 1 spolubratrovi 1199 švýcarský 2 Terziyska 10 symfonicky 18 umami 1 tábora Dulagluft 3 Suzova 3 uvdin 2 Vehlasná 1 Valných 21 unášecí 1 Teraba 1 teitä 8 transporter 1 Ueberbergen 1 thunbergií 2 Tolodewal 2 Úrocení 3126 varianta 2 šroubovicovitým 3 Trapézu 1 sulfasalazinem 3 Unicovští 1 Valenove 1 Tacevic 1 Suriani 1 velkokapacitnímu 1 Taniosa 1 VEKU 1 Stášek 13 Supremo 9 Štýricích 2 syrakuskými 1 Veleschitz 1 Szoni 2 tepelnetechnickou 1 tkalcovsví 1 ústavodárci 2 Varhaníku 4 tankováno 1 Tanor 4 Štrpcích 1 STANu 9 Tharos 8 Tabucchi 901 Streda 1 sovicky 3 tríoká 2 Thesprotie 1 TOSu 66 stagnuje 93 staroegyptských 1 Trepkou 4 Swablu 1 Sprachenthesaurus 1 uzákoní 8 trono 14 traskavin 2 SUPŠS 5 s cerveným 1 Tsilla 1 Timide 1 stredolašská 3 Štekot 1 Tríjednotkový 2 vcasní 76 Toxxx 3 Srubci 1 Tintemanna 2 Torreye 3 SÚPSOP 18 Tschechoslowakischen 2 vanilinové 3 tríctvrtka 12 Urga 1 Vegri 1 Terraforming 1 Upadají 1 Verdén 2 Šubové 3 tercovníkovité 1 svestkovymi 1 Tawas 364 Velšští 4 spoluvine 12 svetlocivných 1 teploucko 1 Spenceru 1 valentinských 12 Theopompos 1 Taloqán 16 Tyree 1 stážcem 3 Sundays 73 velkoformátových 1 Stepanovem 1 thermách 1 Stáro 25 Turnovem 24 Stáje 70 Vecné 1 Švábenštích 1 torographicus 12 Terrasse 1 upomínkového 12 Úprkova 1 Stývnsnovi 2 Témer 2 umístnená 1 vetšinou v 1 Spanorama 1 Tuvala 101 Universita 64 triumfálního 1 titanátové 2 systematikové 1 ubangským 1 taujat 1 Terentievem 4 uzavírka 32 štepování 272 Verner 1 tenkterý 1 specialistkách 1 tradiçiůn 29 Titanium 1 STANSFIELD 2 Tammo 1 Véskách 1 Titelseiten 2 srncíci 5 SUL 1 Suchdolskou 1 Tupoa 2 Tornay 2 Ujság 2 Tropa 2 Tahnybok 16 splašková 2 Tempského 3 ucencích 224 venkovská 1 Tuynicay 2 Tadaaki 2 templorum 1 Steinbeis 1 Tartagliovi 35 synchronizovaných 1 SZELEPCHENY 1 Vercorin 2 Theodatovi 2 Vanišovec 4 tholin 1 Tkadlíkem 1 Stratenu 12 Steinem 1 Tochka 7 vencí 31 splyne 1 Tukuriki 1 triklinických 1 vastes 1 státuverná 59 utvorí 1 SuperTwin 2 Tkadlíkova 1 Usenixu 5 spiralizaci 1 utavši 1 Swype 7 transvestitu 7 spocinku 1 Tanngrisn 1 Veidec 2 Svetcu 2 unikko 1 Vanecský 1 sqJGAAAAcAAJ 2 Trimastix 2 štesteno 1 tété 29 Thajského 1 staroveského 1 Uverejnované 1 s odbornými 26 velkokveté 1 uveritelnejších 1 Vágbhata 2 Vašnosta 6 Srbou 5 túžba 1 velvyslanecká 1 s ruskými 5 Špatenka 1 Svržením 2 Sypal 2 Tabajdi 4 tabletem 2 Sutrieu 1 Torhety 2 Telfsu 1 urostlejší 47 Thouars 93 varují 1 Stilson 1 úspechúm 10 Talkback 4 tryskáním 41 toulce 47 Takt 1 thaďlandaise 82 Trojka 1 Vedžepten 1 tánt 3 Sumiswald 1 Stráneckých 74 velitelstvím 15 Svetlík 1 Suislepa 1 Trenzovu 1 Vetrnák 1 Straßendreieck 2 Svatomichaelím 11 Únetický 3 Troffa 1 Stredoušní 40 Stromu 2 Stepokur 33 Spyridon 5 Svetlove 1 Šulková 2 Superhiks 1 Tefahot 11 televizni 2 Toninem 3 vánocek 1 TELEPACE 1 TSFI 32 spoluvezen 2 ústupovým 3 Špicníku 581 Spolecenství 1 svaleným 1 uštedrovali 3 Tocek 1 Start?Spustit?regedit 1 tuttlingen 1 technologiích Grazia 4 tachyonovou 8 svinutými 99 Španela 44 tajil 4 Spiese 1 stredomínojskou 6 vepor 1 Treneman 4 Timothea 7 thousand 4 Vasji 1 Supervizorem 4 tapisserie 7 spechalo 1 Trebruk 1 Takéuciit 1 technickohospodárské 32 týmiž 1 stepovi 10 Tanana 1 …Ti 1 Väiko 9 Vancem 1 uhorovité 18 variogram 23 Thiessen 1 Vanaikin 5 vedry 454 úcinná 7 Texaském 1 Träumers 3 Verwirrungen 1 Transplantcentrum 54 trídním 11 Vesmírném 166 veteráni 1 Sunargaonu 35 validace 15 spály 1 Szentlorinckáta 30 Vartenberku 1 Stemmermannova 7 Velkomesta 1 Theaeteta 1 SVEDA 1 Vermesa 4 Venckaitis 5 Štefanu 1 Torazzo 7 trambusové 2 thanatofilie 38 Stredomorských 2 Tuboži 7 Thürnau 11 Tany 1 Stearova 2 svámího 1 stabilite 1 Toitenwank 14 turniket 1 ubychijský 1 várakozásról 1 tricka… 26 táhlé 1 stupovalo 7 srbochorvatský 2 Váhickým 3 Tupolevu 68 Vánoci 4 Stratoníké 1 Sumadija 2 Valgren 9 trdelník 2 ultranet 10 spolutvurci 1 turquoise 4 trtinami 1 Tetsuhiro 3 Tommasso 1 Uheské 1 Šturmoviku 2 Vaittinen 1 Szirmayovskou 2 Vernými 1 spleteninu 1 Tohira 7 Thália 731 teplých 186 tygra 45 svrženého 1 Troupova 4 Sousedili 1 vachmistra 1 Uskladnená 2 taxíka 11 urbanistu 2 Vahadlová 28 Televarieté 1 usínám 1 Tuángňu 10 tocítkem 3 Trizs 70 uprednostnil 1 Tvaroslovné 1 soundtrackguide 1 sterce 194 Ústectí 1 Uranotungstit 1 termocykler 10 transcendentním 5 taiwaniana 2 Stygerová 1 Tajšá 1 Staroknínské 25 spraších 1 superficiálních 1 TANOS 1 travobylinným 2018 Su 1 TEŠÍNSKÝ 1 Terrestrische 1 Succurrens 2 Tachyoryctinae 22 trenérství 12 UNEF 1 TopGas 11 Transceiver 1 Vemund 1 Srozvojem 4 Suabru 1 Taufbecken 2 Soviková 8 Štepánkovou 101 vetrací 10 Torrčs 2 Surfboard 1 Ubec 5 Thangka 112 ustoupilo 1 Surikatka 6 Vachčres 33 Trejbal 5 Švábenští 3 suchohribu 75 úvahám 84 Treblinka 1 Tnuat 41 Variant 5 Turistických 1 téhdejší 11 Tsuji 6 trojrohý 34 trhavé 4 upomínajícími 58 stádiem 1 Spotrebovalo 7 staronových 1 tracery 2 Tamire 1 Uvíznou 8 Suqami 12 TPWS 2 Sovadinove 6 tribue 11 stanovovány 9 špicatého 1 temperacního 1 Tabalis 1 trnovkovití 21 uhorelo 1 souvekým 1 Sovran 1 Tril 3 úpadcu 4 Ustjug 1 Symbircev 26 Tupá 175 vámi 2 topo 1 vaflích 2 terárii 1 Toledských 12 Szépmuvészeti 6 stalinském 7 Storchem 1 tuponosému 2 uzamceni 7 Spalov 1 Únikovou 1 s nákupem 1 Svtetog 2 Tkalcovskou 11 Vavrincova 1 Tarfful 3 Tetradoxa 1 tabuletta 10 týraní 1 ushort 1490 turistu 1 Szyce 39 tum 74 Strážek 1 Trinidanu 16 trápením 3 TIBCO 1 Vamdrup 5 tankistky 9 ulicníci 1 UVTO 1 s univerzitami 1 Tuomasem 1 upanagar 1 Takaiši 3 Tchiao 11 synkovi 1 strda 1 Trebine 1 Tšuvot 645 vede 1 Tengu 1 Štolbovým 1 Tharsya 27 Vacation 5 Tangrajum 2 Vernusse 4 twórcy 2 tlesknutí 1 usawc 1 sudeb 1 Stripburger 1 úroveni 2 Unités 3 strakapoudem 1 Spittelauer 1 stockholders 8 syncytium 1 Stürzl 16 Úcesy 2 Tramolé 1 uznati 1 svobodárnu 1 testofobie 3 Vejrychovsko 1 Tambovtsev 1 trírocek 5 usednutím 8 svévolí 1 stádleckém 2 Ugrina 41 sukcesi 1 Týcko 1 vakcinofobii 1 Svrateckým 10 Tenši 1 s Gillem 1 Temply 1 Surmajová 4 uint 1 Tarhoviská 2 SWG 2 Trévillach 1 Tronošskému 1 Sponsorloterij 1 uzorpoval 1 Starkenberga 16 Turska 38 toponyma 1 Tygnutt 1 tumorovitost 13 továrními 1 Syhre 1 Suchindy 1 VCHM 11 souostrovích 13 Traube 2 tycinkový 1 Stemann 20 Sudovo 5 Talmadge 3 tmelech 1 Sulfurospirillum 1 spoRtovní 1 vaughanii 1 TANGL 4 Švankmajerovou 1 velezrádci 1 Venony 2 Vangelovská 3 trakture 2 Tabe 4 stahujícího 5 Tya 2 Veloz 1 ÚFP 3 Tenrecidae 1 spoluhrácema 1 stotisícem 2 starošpanelskými 3 Twimberg 1 vetve… 1 s konfliktními 1 Spádnosti 2 Uurainen 1 spermatokélu 1 Vandalských 2 TEZA 1 Španinger 2 Tempelbranden 1 synchronizovaly 1 Tepáním 2 Taškömür 1 Vernerovice 6 unicinctus 1 Theriologica 36 spuštených 5 Unrecht 3 Téo 80 ubránil 1 transformátorum 1 trempských 1 Sundsnřva 1 stribrnak 1 sozdemokratinnen 1 Thewlisovi 3 Vessy 1 Stenkilssonem 1 Tsukubea 5 Tillisch 1 Toea 1 ventrikulostomie 1 Stredoškolacka 4 twirlingu 2 Vermis 5 Varstu 2 Varšavanu 16 udr 2 Tranovskému 1 tetrabromfluorescein 3 Sympoziu 7 Šovi 1 varikapu 1 spráhlého 112 transformacní 52 trápit 18 tenkokvetý 1 Teleplay 1 tbileli 1 tahávalo 2 Suitnera 1 Vesparol 4 svrhování 637 testovací 6 Treplán 1 uajd 4 vejcorodé 1 Tsú 1 tacubaya 1 Tzimiskovi 2 temnych 1 trpaslíkov 1 Tsambeki 3 transplantovaný 1 trojslabicná 2 tríkomorové 1 underbude 1 Unruheru 1 usekají 2 Vencité 6 svinutka 1 usínali 5 suspendováni 1 Unitaristický 4 Strandová 2 stylisace 1 TAUMEX 5 Strouhalka 64 Svojšín 1 termId 1 ttline 3 Varmsko 223 spolecnému 1 Temperamentním 3 stormvind 1 Vanderbergove 1 Testemi?anu 1 Svechina 1 tonsilarum 3 Syrlin 1 Tsiafajavona 36 universit 1 štípené 1 tessinskou 1 Sulitia 8 Stankevicius 12 splatný 10 strunové 3 Tjessem 1 Sumnersová 2 Troikou 23 Stavovský 1 Spanbauer 3 Thurnau 1 umbrosum 8 teplovodním 1 sýpkam 1 Teufelswandu 1 Uszka 1 Spindlu 1 Trichogypsiidae 1 Trajektový 18 subsystémem 1 s popisem 1 Typhlonectidae 1 Tintorettuv 1 spoluurcována 3 Versé 73 Telesné 1 Svatodušním 2 Triakidae 1 ukrajinskou 78 velkovévodou 1 strehomský 2 Thekulovcu 1 TERATO 1 Vetrovcovo 1 ušetríla 2 šturmu 13 Trill 1 tarantula 14 titrací 7 úctyhodném 253 Velké 1 Uvažováním 9 tríhodinová 1 Uitterlinden 1 Treskovicensis 20875 témer 18 Stranný 1 velkotrubé 9 stlacene 3 Torzu 14 Torpédomety 1 Ugamia 3 Sulli 2 stumpy 3 válely 5 Susz 1 uvádzaný 11 Uvozovky 1 trezalce 21 Stužica 2 Sprencz 3 Štepnickým 2 ušlechtilejším 1 Tertiarschwestern 1 Tyttö 11 valonských 4 Stanislavovic 1 s vchody 1 Typltová 1 uterinní 1 totza 35 úhorí 2 stúpi 1 tschermakovskou 9 Urbanovy 1 tetraedrem 4 umývadlo 1 TRAUMA 2 transsaharské 5 Tiburtinská 1 szóra 1 stlucou 44 srpu 1 srhu 1 utorizace 1 teambuildingových 20 Tyldesley 13 Sturla 2 Steinbergalm 1 varekou 1 Tešínanu 2 Svrbice 3 Teichgarten 5 Stjepanem 11 Tajín 1 Urcovaly 1 Uvolnovací 1 Splétacka 1 Svatohorskému 1 uhánela 2 Stephanides 1 Ujj 1 Tanatoforický 1 srbova 1 Šuchkina 1 tlustorohým 17 tvarohové 53 Theologická 1 Tsuchiyama 3 strida 8 staromestskému 2 Ullathorne 1 Starkare 1 termokompenzované 3 svahovém 1 strastiplným 1 Sudžensk 8 upresnily 5 suverénu 1 sožské 6 Tasmacetus 25 tektonickým 1 tresnímu 1 Szirmyové 3 Tapas 4 Špicácká 10 torpédonosných 1 udáních 1 Verchnespaskoje 991 švédská 1 vetneclenské 3 sunland 1 Sturmovým 1 Umachanov 40 uhodí 1 vedesse 1 spiknul 5 uposlechnou 1 Tertious 17 Tvorbou 100 tankeru 1 urikostatikum 1 Tatínky 19 variátor 1 ucolick 1 tucurensis 3 stefanit 28 streaming 1 uzkostlive 1 Srebrnogórskému 1 UTIC 5 subvarianta 1 Statement 3 Vdecné 3 Stelea 1 Storyho 1 turnajeV 6 Vandergelder 1 tristapadesáticlenné 1 TeNT 1 turbati 374 Století 9 sph 4 Suvrijn 1 Thorgestovi 1 Suffolskému 6 Superieur 4 Tieralplistock 1 tukunai 1 trojoknem 21 Timi 4 štafetove 1 Styrczey 1 trojkmennou 1 Subbase 2 Trouby 1 Suspendoval 77 týchž 3 vatovitým 2 Tkaninám 1 Torath 2 Typologien 3 Vakaviti 2 Veselova 3 tracheitidu 1 Stredozimky 8 Tramontana 1 vertčbres 1 Štáhlavce 1 Teviotdalu 1 Templehouse 1 tarasu 8 stríbrošedý 6 uzdení 1 Spontane 1 transhumanizmus 1 Trissina 7 Spullersee 2 suspenzoru 1 Terrorgruppe 23 Ústín 5 Startující 2 Tajomné 402 stávky 2 squadronám 8 Tamsalu 1 Šypynská 1 synkope 3 Verderonne 24 Utenského 1 Stamejcicová 1 stechiometrickým 10 sypaného 1 Ujházyovcov 1 Tintorettovy 2 unna 1 úsovskou 3 tlacitko 1 väst 4 stremhlavému 1 Szerelmes 28 Steinerem 1 Stalinorgel 1 Testeri 1 Theresin 1 Triptany 1 úkos 1 Velezadek 35 Tolly 2 Spencker 2 Sunburnt 25 Uzčs 1 SvHl 79 specializovaným 1 Telešiho 3 Swinomišským 8 Tölkkö 1 SRMP 29 Tweener 1 Spauldingových 5 štenátku 6 stredovlnný 2 trojdan 17 Svéradice 1 Tarlogie 1 Štraušuv 1 Udeva 45 Telma 1 tuhýkovitého 2 uploadovány 1929 Tým 2 teplicech 1 Švamberkova 2 spat 48 unikátními 2 Ukryla 1 Trautmannsdorffu 1 sykavý 2 triftongy 1 varhanový 1 Spondotriplax 1 supervede 1 Thyrotropin 5 Vathy 1 Trilobeat 1 sryvajet 1 tatrarpita 2 Stewardove 1 THEMA 1 USCSA 1 Svinarském 1 Valibals 1 Strauchmann 1 taktizoval 2 Systhane 1 Transcom 11 Spolocná 2 spoluúcinkovat 2 Spregelburd 65 Struve 17 Torosaurus 27 Vápencové 2 Telocvicného 1 Suonia 1 urlag 1 talmudskému 2 Thommessen 3 vatthu 1 tavernického 2 tmavookou 9 souradnou 3 Ulvaeusem 3 Torneĺ 1 Swietlana 5 Váši 1 Venraij 38 Štepánkovice 10 Uzemnení 2 Tramontate 8 Špendlícek 2 verchušky 1 Stareye 1 vetní 1 Strzelecka 1 Tungayu 1 tyin 2 Stege 1 Šušigaku 1 Tathágatagarbha 3 Toralem 1 verfluchte 1 Technikmuseen 1 Syprolux 1 Trešnja 1 StGeorges 9 Tlingit 1 švábskými 41 usmernuje 1 ubc 3 venul 1 Starograd 16 SUVERENITA 7 utlacovatele 1 Tierfeuerwehr 1 Vauglin 1 Spankove 11 trhacích 1 Stacinovi 14 stuttgartského 2 Termovizní 4 Ursici 2 udržené 1 vertauschten 1 Treffona 2 verste 1 tonometrii 4 splanchnopleura 21 váhali 23 Umístilo 2 Svatojanskou 1 Telocvik 1 VEŠKERÉ 2 teater 3 Strindbergs 5 Stun 1 Tinglan 3 Swintonové 1 sumbae 3 Sumbing 4 Splügenpass 33 Štechovicích 2 stavebnicová 1 Totenengel 1 s Xindlem 1 strihal 3 uvyklé 73 Valtr 1 Štepnický 7 Správnejší 1 Veszprémfajsz 1 Vasilvskij 1 spolupredsednický 1 totalfootballnl 1 velury 6 Stránku 1 Tischendorfianus 1 Ureosyntetický 1 svídami 1 Timoratz 1 s nepresným 182 tektonických 2 velkolhoteckého 3 Stroupecku 1 Stero 10 Tomorrowland 2 Tartiere 112 technologickým 1 studiosus 3 Taissa 18 velkej 1 Taidu 1 tišnovským 38 strojvedoucímu 31 TNK 62 Stránice 2 Tamers 1 Tobuv 1 Vergiliovou 1 Vĺrdsbergs 4 Turli 2 Trysil 1 SPARCu 2 Spezialortsrepertorium 4 Torgerson 1 th 2 tripletem 1 Startseite 1 Steinkohlenreviers 1925 urcitý 1 Troops 6 Vašim 1 vanilylaceton 1 Thomma 6 Titos 134 varlat 3 Strossmayerovi 33 Surabaya 2 trujmjasto 1 uprosili 5 Streptokokový 14 stradac 1 transnacionálních 1 Tailles 2 Spustme 1 Sztark 2 Sunlounger 1 sytémový 26 usnadnen 2 Tarandos 7 Trzebnici 3 Szandora 1 Strzyzewko 7 usmirovací 1 Storkorsridder 7 Véroia 1 Stískal 2 Subsolidová 1 Spafforda 42 Trinitas 1 TiOSO 4 tretinových 8 starozitne 1 Svendborgu 2 Urzou 1 veršovanost 1 Vatlaallikas 1 Sphaerastrum 26 uctívaných 1 Tachovští 1 udidle 1 Succumbs 1 teksta 1 svetáckému 1 Stheinó 2 Utery 1 tesnoty 128 Vesmíru 1 Uhrinevsí 3 Tschirchovou 4 UNISERVO 593 šrouby 1 vaguio 2 Tradesman 27 svetlometem 1 utahán 138 Tonda 41 tenkolistý 1 succinctement 33 stabilizacních 9 Streichl 6 subdominantní 1 Tkonského 1 Speleokanibalu 1 Svérazi 3 Uchovem 10446 stavby 4 Velikoj 1 syle 5 Tebow 1 Trilion 1 stredomadarské 19 Táborište 1 Steenfohl 1 Varnemanem 1 Toshem 1 üblicher 1 syndaktylní 1 Svity 2 Stilgarovi 59 spálením 1 Tomassa 1 Tomcat Námornictva 1 temparské 1 tónun 2 Štubnianske 10 Staricný 2 Townsvillu 1 surfovými 15 Špickové 2 Švancarova 3 Úchylná 6 Trojane 7 vetevní 1 Tributo 2 SuperEga 1 Ungpinkóc 2 Swiftsuru 3 Usporádána 1 Tluchorova 1 Tolos 5 usušeného 278 Universe 409 událostem 2 Subjunktiv 1 Vernakulárním 2 Trut 1 Šponka 2 Vandewegheové 1 troubícím 1 trdelnik 12 umínil 1 s Gerdou 16 Svídnického 6 velkoobchodem 1 Šustercice 3 Szkodrewa 1 Suhara 2 Úctyhodná 1 umírili 1 standartní 1 tetrabromderivát 1 Tedyho 1 Svetlocitlivá 1 tylerská 40 Soustredí 1 telescopiis 51 udat 3 Steinbeckovy 1 sutsilvan 28 Tandler 1 Vernére 21 Syková 2 Stáhli 1 subskupine 1 Urdenbacher 3 Tomida 3 Szoke 9 Suchowola 10 Trebcíne 2 Tuhino 2 Verdikty 1 štafetry 2 stangerii 1 Tőstamaaského 1 Szybki 2 Stelka 5 Šulgi 2 veleduležitým 1 Stojánky 4 Starecské 1 Tamatava 1 šulinokaz 10 Troodos 2 Steerforthem 13 trubkovým 1 tekisho 7 Turanská 3 starokalendární 1 Unierzyz 2 tyranovci 2 Stallek 6 útlých 1 Urancalcarit 8 Strekov 1 Uhlichovy 2 Spiers 1 unrwa 2 Spreuerbrücke 87 Takrka 1 Vakija 19 sundali 79 syrském 2 trichomové 1 trítvaré 1 Svatohorci 1 standardo 3 Taramis 1 verbunky 1 velmoci… 1 Straškovití 1 SpeccyBoot 1 ultrapevnou 1 SuproLeague 1 Thébští 9 staropražské 1 vedem 3 Supercomputing 2 sufúze 1 švýcarká 1 užijme 3 Uncivilization 12 tchungem 4 Tourte 1 tábornický 1 ujcem 7 thébskou 1 Strumyk 13 Sunda 2 Tammam 1 sustulerit 3 Tillig 1 trictvrtehodinového 14 uctivý 1 Tesmanových 8 uvedomelým 1 tarantskou 1 terciálne 1 Tormann 2 trpeného 1 Tanmátra 1 Uhodila 1 štikozubcovitými 1 torque 1 Valetin 1 Strandhem 1 Theogoniá 1 thunbergil 1 tallinncity 44 Tsuga 1 sponozory 1 tanssihetkiä 2 Stoligy 1 úzkonosého 2 Triumviratu 5 tišnovském 1 tibiotarzem 11 šroubového 1 valaamského 3 Unicovská 1 Štartu 314 Ulf 1 Unitisten 2 Sulim 5 Thor 3 Tulipe 6 texelu 4 Tavením 1 Stržanow 1 terrazzo 1 Speckove 1 Stalin dotlacil 1 Upokojení 4 svarovny 1 Úkladech 100 tuzemské 1 successibusque 5 Tomasa 1 ucuri 8 Tresína 1 Stéfanovo 1 southgarohills 6 uherska 3 Tridenského 1 stojej 7 strohému 208 tisících 1 Tempelštejna 2 Tyroler 11 Vek 1 Trafiksignal 3 Strucnost 1 supím 1 stríbrorudné 1 Vermeyenovi 15 Vegemite 1 symphonica 10 Telmarínu 2 Ujhély 3 Swiftovy 1 SUKLu 91 Trophée 1 unita 2 Triangulární 1 urve 2 Vazné 11 tunka 12 Tvorkovský 1 Udržitelného 1 vardininkas 146 úmyslné 1 udusány 1 štandardných 1 speciálníkulisy 1 tabulátními 2 Svetlech 2 Urrutii 1 trigon 10 Stredozápadní 7 Tabon 1 Tordský 1 Vatuone 96 Tribute 13 úmorími 1 stribrneho 1 Stukašov 1 Tadice 20 Timbalandem 1 urentis 2 telšiaiská 15 U 1 Tyrusu 3 Tripolským 1 s okupací 2 uplatnujícími 2 ventromedialis 2 tachytové 1 velvyslanecem 15 týrá 2 s plnou 1 Svobiškis 1 torsem 1 Ueckermuende 73 Vesta 1 Uttner 8 usmírením 1 terky 5 svítícího 1 Šupna 1 sylloge 8 Taktiku 2 StredObce 1 Strašliví 2 Universalism 58 Sullivanová 6 svitkové 2 Tritia 1 supernode 1 Védou 2 SSRX- 2 usambarská 1 TheCoca 2 Telgruc 4 vazným 32 Stanovisko 774 Strane 1 Tokugavy 10 Thorem 1 ucíván 1 Vestlandetu 1 trubé 49 Tanach 1 souznejících 27 Sura 1 vaskularizací 10 teoria 4 Vandenesse 1 Turistuv 2 staromódnosti 1 Stredoluky 2 splazem 16 Správního 1 tridády 2 úpického 1 studenejšími 1 Šteinbors 1 Surins 190 Sunshine 2 Švrckem 1 Vermirovského 1 trináctipodlažní 67 Theologie 1 Sphaerothylax 1 Verwandtes 31 Svátku 1 vaticka 74 Sychra 1 tamanité 1 Tannenovi 4 Tlachtli 1 Tronjheimu 1 Theline 2 Travník 61 turbulence 1 Útrpný 2 Tourneux 3 Štupartskou 1 spodnokrídových 2 Starstreak 1 tydeník 1 stredopahárských 1 Uznemuma 5 Tisknoucí 1 údové 6 Starcková 3 upilovaná 2 Tüvšinbajarovi 6 surfovací 2 väzen 1 timeoutu 2 tombole 35 svazovém 26 Valném 34 svazování 2 srostem 4 Templárská 1 Tomasovi 11 Thunem 1 Superlove 1 Velikánovicem 4 sprintrallye 1 Thannheim 1 VanoniPaoli 18 universálním 1 swjatych 1 Switchers 1 Tekpac 2 Trebonínu 4 SPECTRE 2 Vegetiovo 266 Telefon 1 Stelmacha 1 Teodoru 1 tapete 1 Tentena 1 tríválcovou 1 tlachalu 1 upytlacení 1 Studení 1 steinberg 3 Tomelilla 3 takú 4 Venette 1 studenodomé 1 Tauroktonos 1 trovano 1 špecializácie 4 trefovat 4 tržnicemi 1 šupinkovitá 2 Tigrayan 21 Stirlingu 3 Urologickou 2 Titien 1 tane 9 Tempera 1 tetroxokan 1 strobing 2 Urdenbach 2 Varzina 1 spacelab 2 Tourriers 2 Vasudanu 4 Týništem 133 upravována 1 uńjista 1 SWSPU 2 Úhreticích 42 Veletržním 1 szobor 2 trubacovitou 1 Svedlund 33 Sumej 1 sténám 1 Trebbin 1 Štipon 1 strecinková 79 Vaclav 1 UFDR 2 Tolkowski 1 Tampelské 7 Ursicinus 2 Tyrlaching 10 vcelka 2 streleny 1 TaneMahuta 1 Uspolkou 1 uhlazováním 105 takovéhoto 2 vazne 1 Stenhalova 1 Vágterbete 2 superrezolucní 1 Stündlein 76 Vadera 1 tírthankarem 17 úvodnímu 3 švábština 2 sventure 1 Umajjádovské 1 Starobulharu 36 streženého 5 Úcastí 30 Tuta 3 speedcubery 901 teplé 3 Stydká 1 úleková 1 Toeschi 1 trofozom 8 uzlinou 36 špionu 26 Tenenys 4 Veronesi 7 tapa 1 Tomecku 1 Tillingerovi 29 tríose 7 utápet 1 Vasiljevskoje 2 sumperk 2 Topilská 1 tulácké 1 spacifikovala 1 Vehrenberg 7 taoistickým 4 spocteny 2 Španelova 2 Tacová 1 Tyanu 1 Uteové 4 synaptickými 3 uwe 4 Soungole 1 údelníkum 2 Teknisk 2 Spieglitz 3 Supernaut 4 UFR 5 superstrat 1 Štajm 20 valivý 7 stewardka 6 symbolizovaného 6 ústupový 23 tuberosus 2 Velicity 10 statkových 1 terazi 1 Spritzbach 1 Sprei 8 triarii 13 thesis 6 Vasilek 11 Trilliaceae 2 travestii 21 Thisong 1 stotisícovému 3 Stylobat 2 srážkomerná 2 UniqueTrio 1 Vereinen 1 urugayském 1 vescitur 710 spotreby 1 thongy 31 Supra 3 stereokotoucek 11 studováním 11 ugrické 1 tmavozobá 119 Turisté 60 Stírce 518 tunelem 1 Toporci 44 šupinky 2 Transavantgarde 1 Superzerocool 1 Vandergoes 10 Tarancón 1 spomedzi 1 tracce 1 sventurate 2 transcendentalia 8 spamu 1 suspendovanými 1 trojvijan 1 't?a?n? 1 Ucišibovi 2 Tillova 1 thi?u 3 Sunglasses 10 Stidda 2 trychtýrovitého 1 Tiefengrund 14 stahem 1 Törlesztés 1 utkáváno 1 taalgebruik 1 Veerman 1 Tricomaria 1 Toulkami 1 trakosme 1 vaporizované 1 Thomasus 3 Vargo 2 Southwella 1 templario 1 Varfolomejev 3 Ulmion 1 trinohá 1 Thomerlem 1 Tsagualsa 2 stanno 95 STOP 1 tamahagane 1 Svjatogo 1 upamatoval 2 úcinejší 49 varil 1 Umridgeová 1 stavívají 1 Unveil 29 taxonomický 1 Trenérství 1 Tótselymes 16 tekly 1 trotzkiana 28 Sw 1 Türkensturz 1 Tamemici 449 Strítež 1 Tsitase 2 Triade 2 Versys 1 Tachell 1 syna Jareda 12 teplokrevný 59 Tauchen 26 uzbecké 21151 titul 1 swiebodzinski 1 Trecae 1 tagSNP 1 Spreš 1 Strašidlopis 1 Šumanovica 9 Thulsa 1 Spillaneové 3 Tobiášek 1 twinsplay 1 texturového 9 tabulových 7 tien 4 Tucherova 1 Thespa 2 Valentinina 3 Štora 1 városban 1 Sukcentor 1 tenuispinus 3 Torstu 1 Traktorky 1 Tshekane 40 Valinor 1 Trastem 3 Trináctku 92 ukradené 1 s jelenem 1 Šviháka 1 ulituj 1 Vadžramuští 3 Stuartovské 1 švitorivým 1 Tricheur 3 trancový 1 svoležerové 3 Vartislava 2 trestí 12 ultrazvukovým 5 Thyssebaert 9 upevneného 4 tracheálními 12 umocnily 1 StorageTek 6 syntézního 2 Valprionde 1142 turistických 1 Tjuj 1 Stutthofenu 1 turioniferae 5 symediány 1 Tyraeluv 1 Veledinského 11 stredodunajských 5 Tesman 1 Tausendholde 1 ucebnetexty 6 šramot 2 vahran 10 Tromelin 56 týdeníkem 2 veronská 1 Trevorton 4 Trivantis 5 Strážovic 8 teletem 2 Tiercent 1 Urfali 2 Sutz 1 STRZEDU 3 s méne 2 Svetilko 1 Swilla 1 stasjonsomrĺde 1 tokov 3 Studnevová 137 utržil 2 splaveniny 1 transgendera 1 Sycjovka 6 svéhlavá 81 Starck 2 Taketori 1 Taupina 2 Udaka 3 UCCAS 1 ToCOM 3 teoformních 68 uskutecnených 2 spinothalamického 1 Venachevischevi 1 Užský 3 Stansgate 1 supermasném 1 Testamentové 2 Uuu 1 sportovnéch 23 Tirkkonen 7 vertikále 1 vasilev 1 Tandzán 14 Vauchelles 1 StartToFinish 1 Usucapio 1 translatologu 6 Toter 27 sražení 1 sterilizovatelné 2 Swieradow 1 Valenciunai 1 svítaní 3 TransAsia 21 taženími 22 Stehlíka 1 Steadmanová 2245 Tu 1 umrlimi 1 Taracköz 11 Souzen 2 statoids 816 symbolizuje 1 ÚSB 74 Tarja 1 Tajty 2 Spathularia 1 Syndesinae 11 srbochorvatské 2 Tilberis 1 tenzometrický 9 Svjat 1 verdiente 1 Uhdeova 1 Üheskoos 18 terapeutem 1 stolárské 1 Spaventa 146 Tnu 4 Stegosauridae 2 subniger 19 Urdaneta 1 Tyrke 2 Tokodaltáró 1 stotisícových 1 tamburašské 1 trináctimesícního 1 Ulaghci 13 ukonceném 1 Stiana 11 Tejmanim 1 srdcervoucím 21 Usirovi 1 Spilt 2 Storu 1 Švarcovy 1 úhorové 4 Thiokyanatomanganatany 3 Špur 1 Thýnie 1 sycek 1 taušírovat 42 Thank 12 Strašne 10 velebili 1 Strahlungen 10 Thráka 6 uchováváme 1 USALS 1 Urfin 16 Štefková 5 Talemberková 1 transi 2 Valfrč 59 tha 1 Svatojilské 1 Ullsteinem 1 Thauru 18 Špicácký 1 Tófel 59 tácky 2 Tamerlánovu 1 Untersalmberger 4 stomachicum 1 srrpnu 11 spádový 1 Uvozují 16 tambour 1 Sudžíva 8 trámových 1 Tronco 1 Varkoni 2 Soutežily 7 Sullových 15 truchlila 1 stenodon 1 valdés 6 Spojovaná 1 Umizaru 8 Thünen 36 Taxodium 3 Vasiljevnou 1 Sweizer 19 TESCAN 4 tweediei 3 Svátou 1 Tádžicích 2 Tesárka 87 užitkovostí 8 sousedstvím 1 Valeas 3 submikroskopická 2 VERÍ 17 Theodorik 132 uznané 10 Vektra 128 Tažení 12 Tzarou 5 stratu 1 spanelska 5 Stirlingshire 14 Tesácek 3 Tadcaster 2 stkwegjcý 1 Tivey 1 úkoluj 1 Tzova 186 tribu 1 ultramontaner 5 tercová 236 spirální 1 Thorimbert 6 swjateje 1 stresovaná 2 Trnowa 27 Suchovská 3 Tranquilize 1 Thetidin 3 Vachun 45 tvárné 4 Strevy 1 stránkách 1 štrajchy 3 Valpolicella 2 Tófej 13 Teru 18 usmernovací 1 tarketový 1 Treb 18 urologická 3 Udwitz 5 transbordéru 1 Treviran 55 usazovaly 1 tipsech 1 teleradyjokampanija 61 statistici 16 uzemnením 1 tjärnen 1 Taxidotis 2 Stoffen 1 s technickými 1 Tresher 4 Theorba 11 Vazula 1 Taizong 1 Tsuruta 1 Umacus 2 Tuzzio 1 Sperla 1 Tereškovová 1 tasi 11 Sturlusona 2 thyreotoxikózy 1 Stattler 2 telová 1 vergleichende 2 trojdohoda 1 transponovane 1 Tigellinovi 2 úchylkách 1 tisíciclenou 3 spojivkovém 1 Telconia 1 Tamanaco 5 Súlího 1 superjemné 1 Tomoš 6 Vahalahti 2 Tailevu 1 telegrafistickou 1 thymolové 2 Ungelenk 2 Synare 1 vejtaha 1 Ücastnil 1 supresivním 1 Tudorbĺge 1 Ulabrand 6 trojpouzdré 1 Szenutego 2 Verduzan 22 stojanem 34 tes 1 Ulenspiegela 1 suuresta 1 Tupahotu 1 svlažoval 21 václavka 1 Timofejicuv 1 Susceptance 7 svetložluté 3 spoléhajíc 1 Teplák 2 trepená 1 Toupouri 2 Srichaphanem 1 sukcentora 11 Syvaš 31 Ulcinj 8 Trifulgas 2 TalkOver 1 verfasset 3 ukladani 2 Vanirové 2 težkoodených 14 veselské 1 úhlené 1 Thalamách 1 Tecluho 562 Sullivan 1 Tschammeru 2 Strallen 60 Umeleckou 1 Sukhumi 1 Teritorialita 1 tvoríco 1 Uluro 4 terichu 2 Šteticích 1 spolunájemcem 1 špelkka 1 Ulriika 2 Spiklenecké 4 umorila 1 tímanna 1 Šuchter 3 trubýše 7 Taisen 1 Tlustošová 69 upadli 19 Tähtinen 414 švýcarských 1 s Friedrichem 1 Thuarea 1 Tedovému 14 transvestita 6 Verunky 4 Thiofeny 1 Tismenice 19 syžetu 27 svedlo 1 superduplexní 10 tangl 9 Spankov 1 Svraštelé 8 Spikea 2 trestaná 1 Thayahochlandem 1 Tecz 2 Thébaut 5 Strozziová 1 Trogtalit 1 Twopenny 9 ÚTGM 6 toulci 1 Verlagswerk 6 veuve 11 Valbonne 1 Vagin 3 triod 2 trojpaprsky 1 Spät 1 varha 1 Teterenka 7 Spolujezdec 1 Todth 1 Stolpenská 1 Uddhava 5694 takto 635 urcil 1 testmena 20 tycového 59 staroegyptského 1 Spagyrický 8 Vanished 3 úsovský 1 stvárnila 47 telocvicná 3 Tolocko 2 ventos 1 s pojištením 1 Veletanlic 3 Tentaculata 1 Syngenit 4 Vernhes 1 Svrcka 33 Vespucci 1 SVOMPT 7 sponzoru 1 Tetroncium 1 Tomšícku 1 Vetimiglie 1 Tajnyje 1 sundávala 1 Šumerem 2 Varjot 5 Stevana 2 svitavském 1 SSAA 2 tlustoblizník 1 Vernalizací 1 Tevšenové 1 Suvurovo 1 vejrunku 78 sukcese 1 tríplukovou 5 Šumárník 12 Veselému 1 ugramislarin 4 Thuel 1 Takatsuki 7 velkopolskou 2 spermiohistogeneze 1 tmavšímu 1 tiskárnicce 2 Trsteno 1 štírku 1 USi 8 Thorneuv 1 suchobýl 1 Tiata 5 Udbina 2 spasiti 60 Tutanchamona 1 Umunhum 50 svatost 1 Stadiatos 2 spia 1 stavite 5 Tupan 1 ultrarychlými 1 Stimpsonová 1 vazopresinové 51 védských 5 toceno 3 vclenením 3 vedeckých 1 Sweeneyem 12 Updikeova 1 Stillington 3 tygric 6 Strelcova 1 Sperkove 2 Szeder 27 srostly 558 souper 1 Vesterĺlenu 19 Tournier 2 svymi 1 Utíkalovou 5 Trubaci 1 tricetitunový 1 vencit 20 vápnomilných 2 supraoptického 41 Švihovec 10 stopovými 10 taste 15 Vergiliova 3 Spende 14 Tue 1 Unicomus 200 Tešína 2 Toulicia 3 symphonicmetalových 34 Triga 1 urozenejším 1 Šultine 1 turkmenistánské 1 UTÚM 1 toliarov 6 Uveznil 3 tristaletého 2 Veigel 1 Vargony 1 Thornberries 398 Thajsku 2 Trenitalií 1 Vehicular 1 spasitelského 6 Velrybárská 1 Ústavné 2 Tilschových 1 tundrovitého 2 Sphaeroceridae 27 strídacku 3 studujeme 3 techniczny 1 Tatenbericht 2 Vetre 1 Unterholzerovou 1 Tutilius 3 tamilskými 13 Strakovou 1 Teterinová 1 Turboweekend 1 súfijští 6 starostove 1 Tuchalijaše 9 Strahovskou 6 Velhartický 1 Úbede 10 tahum 13 Stružince 1 Synergura 1 vázánou 1 Tyberiusz 1 sunwukong 1 STOPWORD 2 trombospondin 1 Stolcín 2 Velmu 2 Urbanovskou 273 uvedenou 1 Sudeckim 1 Tawary 17 tonu 5 userPassword 2 Stonaicai 1 Stderr 1 technoetiku 4 SZIH 1 ‚statistické 1 Szloska 1 tarkottaa 1 Varleyová 3 Strate 1 STAVOS 4 sušickonepomuckého 4 Stvuronu 1 tablesp 3 stipendisty 1 sporadictejší 1 vekovne 3 Tartuská 1 Übersetzungsparadoxien 1 Svefn 3 tríhlasých 1 Špetovi 7 toponomastika 1 spinosauridním 9 Teleobjektiv 1 Udžahorresnet 3 Valvasorem 1 sovietskeho 7 uvrhnut 17 ڞlabí 1 Steyerberger 1 Valesianus 1 utínku 2 Teskánd 1 vaišnavum 1 Stenografický 1 Tounament 1 Trybuny 6 vakoveverek 2 Tousen 1 traducteur 1 számok 1 uniwesytet 1 Tatrovic 49 udávány 1 Tjubere 6 Trávící 6 Tefrit 2 VeKa 1 s Ježíšovým 1 syntenických 1 Tschermaks 1 Trimbl 1 Szentliszló 2 tanecnici 2 superhetem 9 starešinský 1 tsutsuji 8 Verzí 2 Velkonemec 1 verbosos 4 útulnou 3 temperového 3 TIGR 1 venedský 1 vboceném 7 syntetickém 7 sporadickými 2 Vacouleurs 2 szökött 34 Továrník 1 svatosvatou 11 vedomostech 3 urychlíme 1 Telmanskij 2 Teriberka 1 Tiernana 1 svraskaly 1 Tatino 2 toxikon 1 Ugenia 1 sprachigen 2 uklidnovaly 3 Timofejevová 1 Staufenu 2 úpadkovému 1 Spillern 8 splétaná 2 Theodula 2 spacedata 1 špackama 1 Tichvina 1 ukrajinizovaly 1 unshiu 64 šplhají 3 Taille 2 špionovi 8 Tricetiletý 1 upadnu 1 Usohachi 2 steskum 3 Ullrych 1 stanovik 403 uplynutí 63 tokijské 5 Trombenik 1 Titila 6 theologických 2 Telethon 1 Squeezebox 1 Urseus 5 Tamyš 10 Targoš 1 Ujkury 1 trnovite 2 Sprachplanung 1 vesmíru se rozpadají 1 Symptomatickými 1 stunný 2 Stínove 1 thadina 1 Svrhnout 1 symbolisticko 1 Takahirou 1 verrückt 1 VecerniBrno 1 Ulicske 6 stalinskému 8 Vancurovi 5 ÚLS 1 Tholhifushi 6 ÚRADNÍCEK 3 stereotypnost 1 Übersiedler 1 Ungdoms 1 VegaVital 1 vćl 1 tercovitá 11 Svedkum 5 tríplátecného 10 subdodavatele 10 tako 116 udelaly 3 Swoosie 1 Urodacidae 1 suppan 2 svatojanský 6 termoklina 1 turzovským 1 Strasche 8 splítkách 2 Trychtýrovic 1 Unkelu 5 uskupeny 9 Štechy 3 sužovaným 1 Tyhjä 35 upozornovala 3 Úporu 3 tenkozobcovitých 154 spirálovite 8 stopadesát 6 trichloropropan 1 stenocephalus 9 urovnala 10 strmelka 2 Straziste 1 Tvrzníkovou 1 vacenovické 1 Tauwinklová 3 sportovnejším 1 synapt 20 Spad 1 TerrorStorm 7 Varánásí 11 Velgast 3 Taapaca 1 Strítežská 1 stejnomeném 1 Stansly 1 tuoss 2 Vernárska 1 Temürovými 4 tahitsky 1 Toktarem 1 Tápszentmiklós 1 úrodnejšímu 1 vetcentrum 1 timpului 1 Tušebi 1 Tsele 1 Stenkilovými 2 travobylinných 2 thiomersalu 5 Squirt 1 Tychsena 1 s vyplacením 10 tereju 11 staroanglický 6 tridentských 728 souvisejících 5 valašskomezirícské 1 užaslé 1 spoznajíc 2 težkotavitelných 1 soutezilo 1 Stredoopavské 5 ukazováním 1 tkanicnicovití 1 soustredíce 1 Usakligil 2 Szturmowe 1456 tricet 7 submisiv 52 uvízl 1 unispicatum 1 varzobsko 40 Uvedomil 1 televuzními 3 Takuji 2 Teretonga 5 Szöllösi 6 úhrnného 5 UFOs 2 Trochoidea 12 Urfé 1 Trzebinski 1 unserr 1 Svärdsjö 55 Stockholmské 1 Turci… 1 Štukovém 2 Thionne 16 usmirování 2 tavitelnosti 20 Ucházel 1 Tince 1 Struebin 1 vekovite 1 staronovgorodském 1 TALK 1 Törebody 3 Trigny 1 tuhandet 1 Vanvitelliano 1 Staatsgestaltung 1 Tetraparvovirus 84 Süper 18 Umožnoval 43 ubehlo 2 Trešnák 1 ukamenoval 18 vetu 1 vacuus 1 Tighjettu 98 Uruk 1 trifosforecné 1 Tsarevitch 18 vazelína 2 verschenkt 17 Ulloa 1 tryskajícího 2 szentek 1 Theodric 1 Szymborských 9 Štapfer 2 švališérského 1 Stalkings 1 thebainu 1 Thielemannem 109 vegetacním 1 TORNADO 1 Textielmuseum 3 úradovali 1 souvislositi 4 TFIIB 1 Umrijá 2 Timansko 1 SystemRequirements 1 úrovneDalším 1 Superfreakon 1 Vaikselt 5 Übers 1 SYSIFA 1 Tutinin 73 štedrý 2381 Srbsko 2 umenšena 1 STRECHOVÁ 4 Vesik 9 Suar 3 Verbunk 9 Spalnicky 1 Strelínu 1 Strafgesetzbuch 7255 stylu 44 tumory 2 tríuhlíkatý 152 Telefonní 224 SSM 1 Strouhánek 34 studies 1 trankvilizéry 12 sporádané 2 Vasemmistoliitto 46 specializovaní 2 Venas 7 Superagent 1 taphorni 23 Svícen 1 Vachny 7 Vendolská 1 strncmp 1 Tocadiscem 152 statecný 1 Streitäxte 1 Velkoobchodne 7 Suelen 1 StStZ 1 Taidnapamy 1 Verolot 1 Trapéze 2 unified 1 totalus 1 speciesprofile 37 Vetévky 2 šroubovacího 9 Trikolóra 5064 synem 342 spjata 1 thumbStabyhoun 6 suspenzivní 1 Úbežníky 1 Teglas 1 s Anežkou 14 umeleckohistorického 1 spoluaktivaci 1 tenzometrickou 1706 vety 18 Varaždinská 6 tiplice 12 vapeur 4 spodnicku 27 udílet 17 Svatostánek 1 Tassona 8 spektrofotometr 1 TILIACEĆ 11 Tenore 1 Trifonyc 1 trénérka 4 verniery 1 STMXCSR 3 Terco 1 Tamandaré 1 Trojmezenský 1 Strzow 120 Trpaslicí 1 Szerep 4 tradicionálu 1 Tumasik 1 univerzalni 1 Šprynara 36 vápenitých 1 undecimový 4 tomi 1 Vasileostrovská 4 ubodána 1 Tokárem 1 Tricentesimo 1 Strempeliopsis 28 ternární 1 tenageia 11 Turlington 1 Urdangová 7 Tetka 1 Verfassungsmedaille 1 Topomastika 1 Théophanius 99 uprchlických 32 uschována 1 teeball 1 Székesféherváru 2 Taubenreutu 1 swajžba 1 sundánském 3 Stevensovým 4 Ustilaginomycotina 1 umutima 1 Szeto 15 úhlení 3 Trayuská 100 stylech 2 Stohovým 1 trafficem 1 Straussovských 5 Undercolors 1 Szregera 1 Sperlingova 1 Štefánkem 3 tratmistr 5710 verejné 1 Vegetací 1 Svištova 1 Stríháním 16 Švermová 1 Usón 4 Vermaelena 1 temná 1 Startuji 2 ThinkPady 8 Sousedil 5 Stélky 1 Vejlupkovou 1 Udomratchaniwet 2 Stenhouse 3 ustavobranitelé 3 sporá 18 stare 1 Spergolina 1 Struhadla 19 Stálou 8 Trogidae 187 Stories 7 Stylommatophora 1 tannur 3 Trencianskými 1 uteceneckými 1 Treeck 1 teloduše 2 Tvaružkovi 2 totalizujícího 1 stlacovaly 1 tématizování 1 Urdinienaovi 1 Sprockhövel 9 Thurber 1 Trögler 1 Transylvanii 1 umocni 4 Spectorem 2 Tooke 1 sunstone 1 trízení 8 Turnhoutu 4 trojsvazkovém 1 Tervuerer 1 Sybiconus 951 strojní 3 trpeným 1 Stignćs 1 Syndetikon 3 vedmou 70 verna 4 szó 2 Sphyrapicus 2 triklopyr 82 Španelskou 2 svižnost 73 ustavili 11 tereziánském 7 spotrebovaný 1 svítelen 1 Tríbarevné 19 Ungol 17 Synagoge 1 Styslinger 1 Ulicnický 2 üles 1 štrkopieskoch 2 Tademekkat 3 Utkina 1 Tariq 4 tetrodotoxin 1 Trísetové 1 Utiešenovicem 4 taiwanensis 21 Verbij 50 typografické 1 Taoistická 2 s útoky 1 tesaríkovitý 2 Stelien 1 Vercellanovou 6 stimulus 1 uszu 459 uprchlíky 6 velikánem 3 Twigg 1 svtovych 20 Stáda 2 Trojanovic 161 svítání 1 strojmistra 1 Szakach 3 Tempesty 41 Tríkrálová 1 uzasadnione 2 trimethylboritan 17 synchronizovaném 5 Šumbal 3 Vaccari 30 Starobylá 8 staroslovanským 1 Tiauv 3 Tricentennial 1 štégu 1 Tetragonosaurus 1 UdK 1 Sturmarsku 31 tématiky 2 Süte 1 tomboli 2 Vazuluv 2 Stromka 1 Stoudemireovy 1 Suhartovým 1 Tettenhall 1 Swatimu 1 studenský 1 spolukameraman 63 Védská 1 velkožupanem 1 Tonleben 1 Úsmevný 1 Suchanský 21 trupový 2 Uniques 1 tesarsko 1 Stephanidise 6 Verejnosti 1 Tapley 1 šrívasta 2 Tulasnella 11 trojhrannou 1 velkorážná 3 Vaty 16 svedectvími 1 talarów 2 vejcová 2 Stenopterygius 1 Touqanem 1 Syncrepl 4 syceno 6 tekutinám 1 Superbel 1 Terhoeven 1 TENENTE 1 táborství 2 Tripel 1 Tušratem 18 Ventos 3 Spácila 1 turistickoorientacní 2 Stržanovský 19 Sulfáty 1 Uusis 1 staroslovanštine 39 templárum 3 upsána 2 utíkajíc 1 stolickových 1 sƒz 1 talentek 12 Tetramelaceae 1 Tafkidim 8 thylakoidní 1 Tigidius 1 stáne 3 Uzbekistánské 1 Verguin 1 tvorivejší 4 spamming 20 Spác 77 trojité 5 Tairu 15 Tlaxcala 1 tlampacovo 1 Taghí 1 teplokrevnici 1 Studenicky 40 úrodného 1 s požadovaným 5 Tjandramuliová 1 Tiam 4 vchlipování 1 tabling 30 Štecha 1 Šrotová 1 teodolitech 35 srážkovou 2 Valmarana 7 Svojetína 1 spewac 2 TANTRUM 1 temnemodrý 3 Vahib 101 umírali 1 Theognidovo 1 užíváným 1 Systemdrive 1 Tasnadi 3 unappendiculatus 3 systematizovány 1 storyid 6 Umeleckých 3 Valdoraptor 1 tepelaná 2 Tekl 1 Uechtritzia 2 Speedova 2 Urdva 1 ventilovaly 2 Stammersdorf 1 svítku 1 Versbuch 6 Throckmorton 83 Štolfa 1 Tooru 1 Verbundklassifikation 3 Trentepohliaceae 149 trešní 1 sycioides 33 Tertre 6 Tugba 1 Süli 1 Totalsport 1 Švábových 3 Turik 1 Ulfilova 2 Uhlisku 3 Tachinski 2 Vanderaerden 1 Urián 1 Trumfni 7 Vedcum 1 Spängler 3 Swaina 1 varjagum 2 Tokugawská 2 Tissues 1 Tintomara 4 TREŽ 9 spasmy 4 Spitzenbergu 193 stars 1 Toraka 1 Tobové 2 Strebovice 3 Sphacteria 24 tranzitním 1 Urdine 678 stranické 1 tristema 1 Superkapacitory 30 Vetším 1 Stephenmaran 3 Sundskou 1 velvyslanectvo 1 suchostí 4 Stollhof 1 Trasslerové 2 Vellus 2 tlamka 216 útocnou 340 Svatební 15 suchopýrem 17 Srednia 1 tašelhitem 1 trianonské 1 Testimonio 4 Srebrenicu 2 Vallecalle 2 uživaných 1 vakoplchu 215 Vanuatu 1 vesumet 1 szelétien 6 Toxodon 18 umask 177 Sutherland 36 Sturluson 1 Späher 3 Tolowa 1 truny 1 ThreePointZero 126 taženích 212 spáchala 1 spolurežírování 4 sparc 1 Szenyér 1 Urvancevit 1 Thongs 1 Ulúm 1 Vésunna 1 toijuuhánnáá 1 verrasschen 3 vdovským 1 velkoprumerový 1 uilic 1 technikypácení 1 SPORTEN 7 Vanimeldë 4 tifór 6 trnek 1 Uhanalaisuusluokat 6 Švíglerová 1 tomášovci 1 s co 1 úda 15 Tož 1 tibetskojazycných 10 Sqdn 1 Uloveno 1 UDESA 2 strojivem 1 stanvenou 1 Tartuffu 1 Teskouk 1 Tunuieaiteatua 2 vekovité 2 titulovanými 1 Színmuvészeti 1 teakovém 4 urovnáním 1 Trasumanar 1 Sudacare 2 tails 7 Tinjicová 1 Vavrincník 3 Valai 2 svarili 1 Trestanecká 2 Stenový 1 spontane 1 Thae 13 trebic 1 Tortillards 1 subsonických 3 Trollu 1159 vedeny 1 Vazqueza 2 Spinthariskop 12 Utín 1 szívemnek 71 Suillus 2 Štaufských 1 štotmagida 5 Stowasser 7 Sprušanský 1 Sundram 1 Thdr 1 Tanuie 1 Trunbridge 1 Stupnik 2 tetanospazmin 110 teplomer 2 tieovi 1 Tornquistem 8 SWZ 1 Uzavrene 1 thrénoi 1 Trije 2 Sygitowicz 1 Tremiscus 2 šrívidjá 2 Talpidae 2 umbonatum 3 Úderka 1 ÚNRV 21 subprovincní 6 Subjektivne 16 uvedomovalo 1 supersoudce 3 Sponda 1 Stíháno 6 TLSO 30 Tomášova 2 Trialu 1 Swierzy 5 uríznuté 2 Unbekanntes 36 ucitelce 1 Tiftonu 1 termochromismus 1 Stofelnu 4 trefen 1 Spotreba 1 subrubrum 2 Tumbleweeds 1 Šrejbr 7 vdekem 1 verere 1 s dobovými 1 Timúridu 1 Torugartském 7 triangulare 1 Úplatné 1 uzavrít manželství 7 strakatou 1 Théodorady 5 váznout 3 Torbešija 1 Vaclavu 2 Svatogotthardský 2 Theras 1 Trzeschtik 1 úvést 24 Varniai 3 texaskými 1 Thorklid 23 Uranovy 5 stojíce 5 Stenostira 1 Szengovszky 1 štíhlotelek 1 starokolínský 1 superfinis 5 Spolehlivejší 1 Tripterodendron 1 strojopisových 1 Starpoint 1 teplotneodolných 4 Svengal 6 uplynulým 16 squamosus 75 Švábsku 2 Vaudringhem 1 vejškrabku 1 svetlonošovití 1 svetyich? 2 souvztažným 2 UHDTV 2 Stibal 1 tenezmy 16 sutovém 1 störtar 1 Västerls 4 Trampolíny 1 Velšskému 4 tabletami 1 tovle 1 Stüsselem 1 Stanfour 2 Strašidelnej 14 Transitu 9 szkola 2 thurifera 1 uzdravujím 3 tatarák 53 tríclennou 13 vetrosnubné 7 Széchy 2 Strazacka 13 Troberg 1 spisují 1 sutovišti 1 unaveném 1 Tioguanin 3 Vclenení 1 Upvoted 4 Štestícko 13 úžinách 3 Starrett 2 Szokolyi 1 Spisovne 4 Stahlwerke 3 Ulozai 1 utlacovatelum…a 107 statkáre 2 svatohavelského 1 trasovacích 9 Terorista 52 Spejbl 1 Straordinarie 1 vcelmistra 4 svatouškovství 2 Trémoďlle 6 vazac 1 Teatrali 1 souvecný 1 Tetrarchs 1 trojkomorového 1 Sprašový 1 Véleze 1 SvG 1 tvarovacími 4 velo 3 Thayaland 2 tr?g? 9 Švolík 6 variometrem 2 Svetlova 2 Spalentor 1 Tialavea 1 stoletíj 29 Utrpel 2 UMSDOS 2 vecerku 1 velkoslavkovští 6 tvrdolistých 1 Terwilligeru 2 Tureis 1 Südöstlichen 1 sulfonmethanu 1 Traición 1 Vartnenberkum 19 supra 3 Turny 1 tocnic 6 Trnitou 2 u zrodu 3 Venouse 5 struníku 2 Suchawa 1 teologina 8 Tumble 1 Stadtjugendmusik 10 Spolecenstvu 1 vartu 1 uverit 5 überall 2 špejlích 4 TKADLEC 1 tuviera 4 Specker 1 Stancinskij 1 ukoncovacího 1 Svjatoslavových 3 Stavbaweb 1 stewardek 1 sponzorky 2 svetelnejší 1 vatagini 1 stupky 1 statky… 1 Ulfeldu 1 Univerziry 4 Stadacona 1 Thomforde 2 titulovány 2 stredách 1 ustašovsko 4 svrhnutím 1 Urbanovského 124 vaku 12 Týrlové 1 toin 1 tabuizovaného 1 velebíce 1 Trípalcové 27 utopení 2 Uskutecnen 1 Suchdolska 1 stearicum 2 vechti 1 tabulkovému 2 Tailgrab 4 Termoklina 4 Tauberbischofsheim 1 taburet 5 Travassos 382 veková 2 Tillak 2 Tobelo 1 stanovitelná 18 svište 1 štadeta 18 Strasburgeriaceae 40 Vestavený 18 Stejskalova 1 utešiteli 1 supplicat 2 usušenou 6 Temnosmrecinská 137 uctívali 1 Subverside 1 tông 4 Trunenkov 610 Ústavního 1 Usokkie 1 spalatino 1 Uwajs 32 stodolách 65 Tóhoku 2 velkoodberateli 4 turcica 1 Trafics 3 tropopauzy 1 Tlacopán 58 Tlapky 19 spolupatron 1 sporulovaných 7 troufá 1 thalophyt 1 Stadtgottesacker 6 ULR 1 S rešením 11 Tschermak 40 VALTROVÁ 4 Tloskove 1 Tajemá 1 ugi 2 Varne 1 stvolovou 2 Stabu 1 Sultiam 5 strucnejším 4 stmívacem 3 Undertones 2 spermatozoidu 27 Tyrande 7 Úmerne 1 Troschenreuth 2 Straatfotografie 2 timšel 70 spraší 9 újezde 12 Strevelná 1 Stegšt 1 Táfíláltu 1 Turonak 1 UMATEX 1 Speziallager 1 Tentaçăo 5 urbo 2 svislic 508 uživatelem 3 TISu 3 Textbearbeitung 57 STN 1 trimetylovat 1 thoir 1 Verschwundene 1 theosofkou 1 svety 1 Šuanga 1 Tokarku 2 Tabaille 1 Trystrero 3 vakovlkovi 1 syttiande 1 stavbé 21 Vacice 18 Trckum 1 streetparty 1 Tyresta 1 ?tiin?ifica 6 Stakiai 1 s požadavky 19 Surik 2 strapcovitých 2 Trézilidé 9 uranicitý 11 tetraploid 2 velínový 1 umístnít 1 Sthena 5 Trenažér 1 Stedri 1 Trásly 1 uchopujeme 1 súfiskou 1 tetrafluoroberyllnatan 1 trigonometria 1 tepenne 2 Sugerování 10 uškodí 1 s brabantským 1 s vyhlášenou 3 Traerová 3 stredokaspická 1 Trippovy 2 Stewart 19 Štítky 1 Thinis 1 sútaž 6 Tilšera 5 Ugarteho 1 Steinmair 1 Sparnotheriodontidae 6 ÚIV 1 sulfanylových 1 Teferlské 1 vampírovi 4 Spalacidae 7 thylakoidy 4 Vejrostek 5 Svenovi 76 Taurageského 21 Storma 3 Sulaiman 48 twitter 1 upanišadovými 11 specnaz 1 TappooCity 5 Thengen 1 umrijské 1 válcep 72 Spiel 1 tienského 1 Unununium 1 Spotrebovávání 3 Talachová 175 stýkal 1 Švobiškis 15 Veenendaal 1 Tazzar 9 TKH 6 Takaici 1 tharok 1 úprave 2 THROUGH 1 sulfhydroxylové 1 s pohledávkou 3 tenzorovém 1 Verschus 1 Undelivereds 26 Tondl 1 VEGETACNÍHO 1 uhynulém 5 Tritri 1 trombónové 1 Tynderö 1 trecia 2 spádný 4 vápenatí 1 švihlí 1 ünnep 22 Tvrdili 2 vekah 1 Strymského 1 tektum 29 únorový 1 Udan 2 tomatoes 39 svízelné 2 trápena 1 takové chování 1 Tramagal 4 Tennstedt 59 Vazební 1 stirmi 1 suského 1 STATIM 1 Statsarchiv 2 Trinkula 1 Sváckovy 1 spoluprednesl 1 Submittit 120 tepnou 1 Tolmina 12 Trávníckovi 5 trialware 52 Synchronní 4 Stram 11 šramanu 3 trihalomethanu 1 Temnadenia 1 Tomarioru 1 Uplaz 1 stryi 2 stírku 363 usporádala 1 upevnováním 2 spát… 2 Universitatic 4 štíru 6 velkonemecká 10 Španár 1 Strastoterpec 1 Starckovými 11 supraporta 1 Szányi 1 svíracími 1 Sulicích 4 trebovského 1 Tecmín 2 s loupeživými 74 trhlina 1 Svavelsjö 1 Transamazonia 8 Swart 16 Terinka 1 Verville 5 tpd 1 teatrihoone 1 s podobným 9 spravedlivost 7 úklidovou 2 UVUO 1 úryvkovite 172 Spain 1 stracchio 8 telekinetickými 1 Vermischten 50 teropodních 1 Strílejí 1 Stegosaur 1 stópy 28 velkokrížem 1 Vardova 1 uskorenije 5 suivies 6 Unabhängige 3 ultramarin 2 Trurl 1 statehood 2 Teravolt 1 TRINO 1 Štulíkové 2 Subhána 45 Václavuv 1 Surrealizm 1 tricetitisícovými 2 Thalath 2 štamberským 1 Universitário 2 Trpelo 1 Turgenjev 11 taktikami 1 stupire 1 VED 13 upanišady 5 Venturim 9 Ušlechtilá 1 styriacus 2 TikiWiki 1 TheWrap 54 Tatar 1 Tristychius 2 stoickému 17 Tlupa 1 Sylna 1 Sunogové 1 Utyosovova 1 Springruv 1 Taketh 66 Triptych 1 Todorem 1 Tigerin 1 subrovníkových 1 Toytota 1 velkolosinský 38 stanford 1 texelská 14 Tuckerové 31 velmistrovské 2 trefnými 4 Vávrovic 1 starosvetském 1 subglandulosa 1 suspenzory 1 TabPRO 1 Swahilštine 2 tectus 29 soví 1 venticosa 1 Trojekurovu 3 Sudánu 3 Synodou 5 vcelstvy 3 Teroristických 2 Terlan 4 travic 1 štýlem 2 SVPU 15 strojírenstvím 7 Urmefisto 1 strnulí 6 veste 4 uvedomované 1 Stamac 2 squashových 1 Steinitzu 1 Tufanbeyli 2 Vaszonykeö 21 Venier 5 Štýric 1 Szazád 1 Tísmice 1 Szabóovou 1 Thrillride 2 striptéra 1 Utsubot 2 universálií 2 Úsecníky 1 Ürög 2 Successful 1 Vanbuskirk 2 SYSTRA 1 vedevše 1 svetemv 1 Tresviri 46 Stojící 162 Stožec 1 spartani 1 špuntari 5 spojovníku 49 strhli 8 Šprot 2 Täuschungen 16 Stokláska 1 tešná 1 Truhle 1 Starosrbské 2 UNTAC 1 Speirag 1 špinilo 15 Uthera 1 tabemasu 1 s raperem 1 Spigel 152 Umeĺ 24 umístenému 8 stavbar 1 Vassos 1 vejtah 1 Stredotónová 8 ukázáním 1 sssvlv 7 Verrasztóová 1 Stacyovou 2 Susumanu 3 stolickám 4 svatodušními 5 Tietzeová 6 Tiburtius 1 Vedalové 1 Vaghe 1 úsílím 1 Vaupenem 1 Straatenovu 1 tríkrejcary 295 spolkem 1 Sukromlja 1 Tuitiensis 1 Syringu 4 Teším 1 Spondylidinae 2 Vaganjan 36 Ubohý 47 štenice 690 umením 2 tupcu 3297 územní 38 Tweede 1 Taemin 1 sydus 2 Šumník 1 stiefmuetterchen 2 staniny 1 Vengeful 1 Spelvin 2 uhasnutí 3 suverénkou 5 Stachr 1 Thuspeinanta 7 splašený 1 ulétají 1 veledel 1 vagónkem 2 usmrcovaly 1 Tärningen 1 Thyroidní 1 Veresuar 1 urazíte 1 Triora 1 Sušrutou 2 Tsalalu 1 Strelíciovité 1 Tanzchen 1 Ueberlieferungen 1 sythetic 12 Svítidla 1 studnicních 4 ustavicném 1 uRv 1 Tutelensis 1 Telesystem 1 Vencaslaus 1 stežovská 4 turistku 41 Varlam 5 Stephanií 1 sphenophylloides 3 Stufferová 17 Tuval 1 Staroveského 12 trikum 1 Tennenbaum 2 Šroubováky 7 svudným 1 Teverya 12 Tyga 1 tradincních 1 Tuharem 2 s dobýváním 1 turacin 1 Valdštejnova 12 supersportu 5 Sulejovic 3 Stoletou 1 Spilliusová 23 Ugandou 1 Superstack 1 tajpan 2 Ústricník 2 Turnianskeho 1 Sylikiotis 1 Stoljarskij 3 SOUz 1 uzavRen 1 Umístíte 1 Torsenová 1 Strabónuv 1 toastu 2 Teleráno 96 Veni 1 taiwanec 1 stodvácy 8 svaty 1 strádána 1 Teaslová 1 šroubovalo 105 Venovala 1 Truffem 2 Tongerloo 1 Vancouverovým 1 tmevé 1 Turkmenó 2 švédu 39 usínání 1 Systemkameras 11 Tabakov 6 SVÁTEK 1 upravovami 2 Uppĺkry 37 Thám 1 stafylokoku 4 vancouverský 4 Vesak 2 UIH 2 Stasiowski 1 Thermoanaerobacteriaceae 80 Trakai 1 Västergötalandu 79 Temptation 4778 stromu 4 subkortikálních 8 trofoblast 8 sousednosti 9 usneseno 1 úzkohlavý 1 spletla… 1 Tonono 214 Toby 1 Valchárna 2 valchovat 1 Tanzender 1 tmavoružovými 1 Ursilit 1 Uhlíkatý 6 trestankyne 1 Stahlbau 107 tres 1 Tuvanském 8 Synekdocha 2 Theologico 15 velkolepost 1 UNMER 3 universam 1 starysloveni 1 thequietus 1 Svitákova 1 s norským 11 territorial 1 Spaka 82 Velkopavlovická 2 Unitetit 2 Tublatankou 20 Udmurtsku 2 Thalétuv 1 Trowera 30 sunnitské 1 Tubukomeyeho 1 TELEKINESIS 2 toreadorské 1 Stresy 18 syntaxonu 1 Sperrer 22 stužkou 1 Verizonu 3 Tarjeta 3 Sylar 3 SVATBA 1 útloboká 1 Vecerníckový 3 tektity 167 Unity 2 Tantalum 3 spoluspotrebitelství 1 su 1 splnomocnuje 5 Taviers 133 Treat 1 trojsecný 1 tráskavé 8 Suchohrdlech 4 tritónu 1 twirlingovou 3 Uverejnené 4 Triadvacet 20 Špinavé 3 Tihama 282 Stríbra 49 Trojanová 1 Svidrigaljovová 1 Utlumení 2 svetih 1 vetrelecem 1 uchop 7 Toffoli 1 švindlování 1 Translatoru 1 verfénskeho 10 Trockisté 6 spondej 4 spekulární 1 s pocátecním 1 Ursuljak 1 Udzima 2 Theodotiónuv 1 srdcarum 1 Spanjola 1 Tedfordem 1 tagách 2 Verquin 2 UnionFS 3 velkoprumerové 9 Vaccinio 1 Startujícím 1 uskuma 2 Valdivielso 21 ubili 126 urcenými 1 Uthmanem 1 Sovoj 6 Verschuren 3 usmrcovat 38 štítník 1 Tucnákove 1 tinchlik 1 Surinyavongsy 1 touškovských 1 Tervingum 1 Ujistila 2 STROJE 1 Tendulkarem 2 vespero 1 Südweststadt 33 uhlíkovým 1 Streczen 1 texi 1 spelování 12 týnského 4 urezané 2 stradivárek 2 Szluinští 1 Spádovište 2 Tumove 1 Tetroly 8 svídu 2 Tica 1 Tomillares 12 Usiškina 41 Veltruby 1 Tauqeer 10 Tadeášem 1 verdiepte 17 Uvažme 2 Tönnis 12 Trakar 9 trafiku 1 Thaar 1 Stavitelný 4 Tribschenu 2 Tharpe 1 Tischove 3 Vajikra 1 uvijeme 4 TOVA 24 Špióni 3 Turkutský 3 Vanadocen 1 Vengur 4 usušil 1 testaceo 29 Vercingetorix 3 Syriam 2 svárková 1 strakými 1 varying — 2 Thetfordu 2 Specializaci 7 tumbu 2 Supermirafiori 2 Ullastret 1 subcarprus 1 Varputys 1 Straszecina 3 vermontské 18 Valour 1 Stracinky 1 verkaufen 1 usnadnovatele 5 Suwaibou 1 Transboundary 1 Vajkakeszölce 8 srdcových 432 uverejnil 70 útechy 1 úhlopohledové 12 vanoucích 2 Vágnerovou 1 taler 2 svazijská 4 úctová 1 Unterhöffen 6 souputníci 75 Tabák 13 Thisted 11 vágních 1 vë 1 Tasne 2 Swette 11 tiskum 2101 stejným 1 SpinRite 6 Úbislavic 1 Titmana 1 Trencínsku 5 superreakcní 1 Verupis 1 Vernayho 1 Steudach 1 upvote 6 Trilobiti 17 tkalcem 2 starchat 17 telugsky 1 Tamim 11 Stereotypy 8 terciárky 1 Ubohé 8 Sweetsen 1 UNASO 1 Sudlicu 15 Tegelhoff 2 territoires 1 trediska 1 Týceho 13 stélkovitý 2 Vespasiánuv 1 Tejkaluv 1 tenaiile 2 trigonometrickém 1 Streichlem 1 Stavokombinát 188 sveží 6 Varney 1 srozumitelneji 2 usadivše 1 trebiti 1 syndet 1 TURP 1 spectabiles 3 ulcerans 11 Sumit 3 uhlobaronem 1 Versilipes 2 Unerázce 1 Splashlife 1 Tracino 1 Valaciclovir 222 trubkou 3 Turalyonem 2 stránkovacími 1 Tirolem 1 staropražským 1 vespiformis 1 Tengai 9 valerová 82 Ucební 41 Uptown 1 trojúrovnové 10 Tuíl 24 typus 1 Vetterovi 24 Sršni 1 Trepkowski 14 typografu 16 Vartan 1 Thariani 2 Svatojosefský 1 Tepperweina 6 Spojíme 1 Thilon 8 Vancát 1 vaikus 2 verbunku 3 utažského 1 Tkacenka 1 tomografický 6 spammeru 1 Stalinové 2 Svidnicka 1 Thalassu 1 Tintorett 1 Tagharan 1 trzecie 1 Sytnou 1 Vacchereccia 1 transportujícími 1 treblem 1 Tuhualit 11 utlumuje 5 Szondyho 9 Štencl 1 Varleich 1 sulinská 1 Stechertová 1 syjonska 1 ›text‹ 1 Ungarova 3 úctovou 4 Trapy 1 uzemnených 1 vetneclenskými 164 velkoknížete 24 torzními 171 VCES 1 Staenhübla 3 Träumst 11 Travian 1 stravovala 1 submisivova 6 upínacích 2 Tverupis 1 Traditi 1 Storeria 1 Tembuland 4 turanskému 5 Tajinu 17 terzo 24 Thái 1 Tokujiro 1 uconv 1 Sphingocephalus 1 unsudanig 6 ÚN 1 Toshifukushima 1 tozn 8 tulské 10 váhají 5 spoluscenárista 1 Thionylu 1 Unverhofft 1 Starobelský 1 Stanicním 1 Transpadánská 1 Superdominance 3 Tantonville 2 Svetovek 1 Tetrachlor 1 štepánovického 1 ukusa 3 Torrifluvents 1 Stolpenské 6 Tökölyho 2 Tidyman 1 starojického 1 Tlalokem 1 Szymsza 1 tibouchina 1 Šponer 68 UDF 2 Twňje 9 Ukoncete 6 Tiha 4 univerzitni 2 Vandré 1 Stybnitz 1 Tarnogrodzki 2 Szeif 1 stredošvédským 1 tnp 1 Vážic 4 Tabasalu 2 s logem 1 temátum 2 trpaslíkove 1 tryptázu 3 Vanderpleyn 2 traumatum 6 Taconis 3 stoup 104 uvádely 1 Turrise 1 s posvecováním 59 Susa 1 Teofilova 1 SSm 12 Šustek 1 taiwansky 2 Trivisy 14 Tallinder 3 Tharoiseau 2 Tand 1 UKAL 20 übersetzt 6 Unibet 1 Tažijev 44 válcování 1 Tisknoucím 1 tmavešedého 24 trhavinu 1 Ufon 354 sporadicky 2 Sphrantzes 1 terex 32 suknickár 13 taxa 10 Varsik 1 Südsteirische 8 telematika 1 torpédoboru 11 tremola 1 subprovinciemi 1 superzpevacka 1 Sturle 14 Tivali 1 veštebních 1 Vanceburg 1 spolurozhodovaly 1 Tartalas 1 Ventilatoare 1 Upshura 1 Torishima 32 uprchlického 1 tianhuáng 7 versione 2 Tubines 3 Tarantini 1 Tokage 1 Taciánovou 39 Tchangu 8 Varas 1 Vanátrú 1 trestny 1 Sukralfát 1 spékavá 558 Taktéž 7 syntagma 1 usrkne 3 veränd 5 upravovanou 3 Ticineto 2 TRÍSKA 4 torpédoven 1 transgredovaly 1 twoich 1 Sternwaldova 3 Tuhanské 2 Ulaborovi 3 taipanem 1 turanu 1 spamován 1 Tajdo 1 Theodorum 2 spolupachatelka 1 Teachable 5 Tláskal 1 Tasovické 1 USXXDP 10 Uniondale 10 splavy 4 Sunnyvista 2 Trhosvinenska 1 Ucinkoval 4 uncinatum 1 Treklyano 1 Velvetcut 3 svalovcem 3 Stejskání 4 ühs 2 varhaiskeskiajan 1 umelecké 10 Stölting 1 Tatramedial 1 uila 2 uzamykat 1 Spiritoso 1 statoidu 4 ufona 1 Šovheniv 2 Šuanu 12 sverovali 7 Tyle 2 Vendisk 1 starorakušanství 1 Thorutit 3 Tjasa 1 sypajícího 1 trénujete 34 Symantec 1 stelivové 2 stredoevropanství 1 Stockyi 2 tayart 1 tracníkovou 4 Swarovského 19 tycce 6 stalinistickou 3 strýcovou 1 Stundji 1 tetanovou 4 Sparkles 1 Umbrijská 2 Štetin 5 Upholder 12 stor 1 ultrazoomu 26 Techoraz 16 Syte 1 Temmon 11 Uznal 20 Turínského 2 Utazás 3 uklidila 1 Suarézovou 192 Tuvalu 1 TheWarp 1 Údolné 2 TALAJ 1 TKbb 12 Subtribus 1 ukín 1 Sverace 6 spojovníky 2 Teneguía 2 Vejrosta 1 trípalcovém 4 Tatung 1 topograph 9 suslicus 14 taverny 1 Spalná 12 Tiskárnu 1 suspiramus 9 úplatkem 13 surrealisticky 1 Stopovací 704 stul 2 Vases 10 Strechov 1 subúseky 28 sypanou 36 Synkop 2 Thonsernu 10 Týra 15 Tetrameristaceae 5 Tyburn 13 Subiaco 1 svatoškem 34 Stríteský 4 supertankeru 10 upálený 1 Stupárovic 1 stripována 5 Tukuturi 1 vešského 1 VerTeDance? 1 Trćff 41 transatlantické 1 usuzovac 1 spolurežírován 1 subgenomickou 79 velbloud 1 soustrených 1 utlib 1 upatlané 13 Ullricha 2 Stigmaphyllon 9 štítnaté 1 stríbrnáci 1 Švaba 2 tamasai 6 vážícími 2 Stuk 1 stredosaské 1 Väterliches 1 Trochocodon 1 Tomara 148 stavebnice 6 srdcervoucí 5 srpovnicka 1 Trissexodontidae 3 uškodili 1 subpusillus 1 toušenskému 1 Stekelove 1 Stadther 1 strdup 1 terariní 1 vénu 1 Tortillu 1 trojicnímu 3 tablesa 1 Truppel 5 štamgast 1 Spásným 7 Toch 1 Štepkou 9 unaveným 2 tesknoty 1 Talaxiana 1 Vámosbalog 6 Trhac 27 Stavet 2 Stredoškolsky 25 taxikáru 4 Tuliszków 1 transmediterranea 10 Starších 5 Tamid 5 Valentove 3 Trilex 127 tvarosloví 1 Stredneruské 1 uforsagt 99 úžasné 1 Ulvĺse 1 Sportpaket 1 unglücklich 631 užitecné 2 tutory 16 Ultrasoft 2 Strážna 3 Temptin 16 ulster 4 spoluobjevitelem 8 Ungnad 7 usazováni 1 uherskohradištskému 29 Variegata 1 Trantírek 5 Tahlequah 7 Steinbergu 1 Tootroth 18 toroidní 2 subspicata 1 Verie 1 udupaný 19 valených 4 Undersea 1 Syromiatnikowa 36 Tomovi 1 Undank 4 Surmu 1 ŠULMU 3 Staroruská 1 vecpat 3 Szontágh 2 Turgeši 1 Švábenská 1 Usmiechy 1 Tĺgresan 4 ÚSVIT 1 Tianshen 1 Spânzura?ilor 1 taani 1 s FC 1 Tenovic 1 teraiským 14 útiskem 1 utahujícím 1 tachlovická 13 veverce 8 Valvata 1 Tešedíka 2 Synodního 1 subizského 1 Strale 1 Tractable 1 Ústové 1 Štetského 1 sulam 1 sporadicteji 6 Tápiószele 1 timúr 6 Trpešice 1 stostránkovému 8 Steara 4 Valjas 1 stadigt 1 ubezpecující 6 Takzvaní 1 Uhríneveského 1 stuffingu 1 Thillmansova 8 Švejdy 73 Vdala 1918 sqrt 11913 utkání 6 TenSingu 6 Topicu 2 velkozahradnictví 4 Strukturen 1 Strausseho 13 Strážníku 1 Usakligil 1 s kouzelnou 1 Stravigor 6 Stredobosenském 1 Vaneovi 1 Theimerem 2 Taqla 1 Tulipani 1 Valeckovou 1 ukoncujeme 7 Spirály 1 Tencaly 1 Vetišku 1 tiarellu 1 Verchneuralsku 1 Veleslavínskou 6 Translated 4 Temminckuv 3 Superamerica 1 Vassilijev 9 Úholickách 5 Tecmo 1 Trnkovic 1 Tvrdošíne 1 Tunaitis 1 vejmenickou 3 srílanského 1 VEDELI 2 TELAR 155 Sršen 1 Tichfield 8 tetrachordu 25 spraš 5 upínacím 1 sweatshopum 2 Válkám 1 vallas 6 Štoudková 1 Szulóc 2 Turisticko 2 Sükösd 3 supervising 5 Svitácka 1 Sytsjev 1 stávajícící 5 Studovny 9 Soušice 1 transmisometru 1 suštích 2 Strenicemi 1 VBDOS 46 Tomaso 3 Trubénky 3 Telliera 19 srozumitelných 1 Spanke 1 ubíjenou 33 tereziánského 28 Tlusták 1 Teptínská 1 Spiringianis 1 verzamelde 10 stanovištních 537 starat 1 tisícerých 3 stínali 6 Syrovinky 1 Transbeton 1 Torchonská 2 strangeness 1 Sulislavce 1 Turkella 2 Špitálsku 1 urinalýzou 6 štekavý 4 Vertimai 1 sukulentního 1 ?tiin?elor 1 Települések 2 strednetriasový 4 SSSH 1 ustupte 3 Štasta 2 Vencelíkovi 6 Trumf 9 Teleskopická 1 stavbickami 19 Speex 57 Texaský 1 Tretak 1 Trebouševes 1 Tsirkas 35 spoluorganizoval 1 utavení 4 Trevírský 1 Tahákem 1 topicské 1 Vela 1 találsz 4 Týrovi 1 taquerías 2 Teatina 6 tížit 1 Tölli 1 svirfnebli 51 Tedem 1 Southard 1 s Podturnou a Liptovskou 2 Staatskunst 2 Tchajchangský 14 Turovec 13362 údolí 2 Veseloherná 1 s Francouzem 3 Theophrasta 1 symbolistou 39 Swarbrick 1 Stutisk 12 therapy 1 Strigocis 1 Tamraparniským 123 Tchung 10 venganza 1 Vectory 1 thiomocovinou 2 Sussaute 1 Tjaša 10 Suchonice 1 Spletitého 35 Tencza 6 Strohmeier 23 Stratovulkán 2 Szydlowski 1 Sufe 3 Tylorovy 1 Turallu 1 velmoce 11 tónikou 22 srázu 1 Sunkaru 3 Tylorem 1 Townshendových 2 torva 1 THIELE 1 s Cao 1 Sprachliches 829 vajícek 1 tvrdícími 1 stisknuti 2 Švagerka 26 technologickému 11 ups 1 šutiš 1 s vertikálním 2 Transformator 1 Templärská 56 sRGB 1 Statoval 1 trichilie 2 TED 3 Staabs 1 urlencoded 131 vetévky 1 Sumerovi 1 Stereosaurus 1 Tiskovka 1 Spálavou 1 Taliesinu 1 Taršíre 1 Tlucenského 1 sukubách 47 Trojí 15 sympatictí 1 uskutecníš 29 Veštkyne 2 Vagant 1 VAH 1 Verykinského 1 ujasnených 9 úzkopásmový 7 Šulákovou 3 Trierer 2 trenovitý 5 umírnil 2 tvdí 116 stretávají 224 verícím 2 ultrastopových 6 terranských 1 Vanilcina 3 Štefunková 2 Sovojovice 12 Steinherz 4 vajco 3 vedom 2 sudkov 1 unice 1 Stanopalladinit 1 tetrahydridoboritanu 4 vcerejšky 1 ssající 3 teletank 76 Tarso 2 trojhonný 2 Stuhm 1 Tabacaria 1 Trelinského 2 Thingolovu 141 splátky 47 usmernovat 1 Trevanian 1 Susloné 1 Tlášková 1 tughlakM 1 Tünelu 27 sprašemi 38 supinum 1 srdcarem 3 Styrsa 1 Velijsko 1 tranexámová 2 Sphenacodontidae 3 Vaudoy 2 Utzonem 2 Stázicky 16 varovným 35 stády 24 Stepana 140 uchoval 1 Traianovu 9 Ujednání 2 valinem 2 Szpyt 2 Trybuna 21 Susann 1 úzkokorunné 1 Stenothyridae 1 svazacky 1 Tchécoslovque 3 Telluronevskit 1 szc 1 Ukulhas 2 Steinunn 1 Thiboust 4 Takeko 1 Swidnicke 1 Suiderhof 2 velmocenském 2 Tornac 1 Tasmanovi 1 Spatsové 2 Uphamová 1 staffiere 1 vakuf 8 STYLE 6 USML 2 Tillsammans 1 úplazy 1 Tiediz 1 Vermamoebidae 25 Tvaroh 5 tonery 3 Ultrapop 3 Tadeášovy 2 Umsatzsteuer 11 Vaitminar 6 Tychuv 3 tomten 1 Tuamo 1 VAZBU 1 valecných 1 Tartuffem 2 Usual 1 Turian 1 Tagaraty 1 tubeteika 2 Stammersová 2 Tucher 2 spinax 2 supratekutina 10 vetrno 1 ښastnil 2 Stolojan 1 subatomový 1 Starkers 1 Útechy 8 Tempi 1 Stanfourem 1 úpravu 4 Vatatza 15 Tomáškové 73 tucnáka 1 Thunderovi 8 Tzvi 2 Vaniniovo 28 Torrey 7 Sunil 1 Tieton 2 †Variraptor 1 Turchis 4 Thorntonu 24 utatá 2 Stratisu 2 Tokimuneho 1 tesknoskuhrave 2 spamovacích 1 totemizované 14 Tešínskému 1 Tézém 3 Stochastic 1 Teitoku 4 Veauville 8 testeru 1 turkské 1 tahn 1 Steigmeyer 1 Tamilnatu 1 Šustalove 2 Suirobu 16 tukan 6 Tuffé 7 SUID 1 Tonart 102 ukrajinštiny 42 Spojování 3 tror 1 Spoelhof 1 tupování 1 Tajmirský 29 urbanisté 2 spolusoutežící 12 spokojeného 1 transliterate 1 Stampfasphalt 2 Stormsem 21 súdánských 1 Tenesi 1 Svadiger 1 StructArray 1 Thorsett 3 Surajeva 1 únctio 1 Telnov 1 Urologe 2 squire 6 Ucinila 2 umeny 1 Tenpyou 3 Trebonia 41 Trnavského 2 Vahalou 4 uemu 2 Tartécourt 13 starene 1 Tábornických 1 uniscasi 7 velerady 3 Superzbran 2 Šweiem 9 svetlení 2 Stormer 1 Ucikadova 6 Vergiliove 1 Talanského 1 Veiviržo 64 stoupajícím 2 Tetragnathidae 1 Tillemans 34 Umeleckého 14 tridentským 3 Thunderbolty 7 trimování 2 stratoval 2 velikánského 1 Tajovem 1 tyrosinovou 1 Trnák 2 Staffardy 3 stredostavovští 5 Trompowského 2 uvádecím 30 tržištem 3 Thrillington 1 Tlalocanu 54 Trilogy 2 Svatojánským 1 Taharku 2 stopkové 56 Tatranský 1 spoluvydavatelu 1 verblieben 1 Tresstice 1 Spratus 34 Tremonti 1 VBscript 1 trojmý 1 trojkámen 1 špejcharem 41 strediskovou 1 thandes 1 Spielfilm 1 Suchland 1 Ulyatt 1 Struffovi 2 Tupilak 3 Vacat 1 Taranova 1 taratuar 2 subalpinským 2 stríbronosnou 1 Transhuman 5 tercdecimové 1 Szánd 72 užity 1 Stagetus 1 Stadtfeldole 3 Tulloch 16 Trutnovsko 4 Vahtrepa 11 Sršská 2 ujmulo 5 Tretie 280 suterénu 1 teplometu 1 Tucholjcu 2 Spraggett 15 tápání 2 troubícími 1 Tabwewa 2 Ucciani 11 UŽ 1 tributylhliník 1 Stapfiophyton 2 tozsamosci 90 vecne 8 Štúrovu 1 SVESTKY 1 SpaceJam 1 Ulaczyk 1 svarec 1 Szemzö 2 Systemanalyse 1 Vanagupeská 2 urology 4 Suprema 1 TYKA 320 svazy 2 Tlací 1 Ulsteinvik 225 soutežních 1 tetradrachmové 1 Techet 1 Tregannou 1 Uesugie 2 Trotnow 1 sudnos 3 Tmavohnedé 2 Stiviere 1 Topazolit 6 Tacuja 1 Universitätsgeschichte 1 Stenin 1 Stadthuys 10 Tréval 7 Synanon 51 svetnicky 1 Tuami 13 úsporou 13 talentovanými 1 Strattmanna 3 thunbergiana 14 tantrických 5 Thessalia 403 ustoupil 9 Tichomír 3 Trpaslicích 1 Taiap 4 Tepeyac 1 Stoilova 1 Stecínský 5 Valtrem 2 Unzucht 29 tlacení 30 Stejskala 1 Tykwerovo 1 Stöcktu 2 tancenými 1 Stumping 3 TVdiFASTWEB 2 supravodivými 23 Štefka 35 tykadly 2 strížce 1 ‚tapping 1 Urelytrum 3 Tarantová 9 uklizen 2 Spinksem 645 spojován 2 Spálenky 5 unášené 1 svlažit 3 Tremain 9 specializovanému 1 Trostovi 1 Spordihoone 1 Veley 2 úrocníkem 3 Styrian 14 Tyrolia 1 vcielky 9 suitou 1 Speedkills 2 teplovzdušných 2 Stoody 1 Vclenováním 1 theologicko 4 Trapéz 81 tancící 1 swajzba 1 Swiratitz 1 TITLE 1 stenografem 1 Trezorový 1 Theano 25 Timmermann 7 veleúspešná 1 Tabarrino 1 usušily 376 strídavými 5 syv 1 Theorií 9 Tomašovicová 4 Sredinom 1 Uigurisches 5 upadajících 9 trichomonády 2 Sternhof 10 VCI 1 Suhum 1 uceni 13 Umelectí 2 Sukhanov 3 Ulaid 1 Thalmus 35 tomas 1 Trojitsko 1 supprimer 1 suze 1 Spondeo 8 Valdštejne 1 Trochymuk 1 Sultanisi 1 Strophes 1 varvám 4 tyrosinkináza 3 sunoucí 78 vetami 29 Studénku 2 thujonem 1 Stifftia 2 Turnholt 1 Töölön 7 Štefánikovým 1 SPUSOB 2 velkohvezdu 13 ubíralo 1 superponovanou 115 Spejbla 1 VETVSTATE 1 sultánátu 5 stvurou 5 tloušte 1 Travicný 1 Staselovich 1 suchomastské 1 Tažovicích 19 spušteného 1 Szymina 1 testujícím 1 umrtvených 205 tyfus 1 Tomasu 1 stavropolským 1 Trápusa 3 stopetadvacítkách 1 veledílech 305 unit 1 SPASITELE 46 treble 1 Swidnik 1 strýckove 1 stenen 1 Staroceska 2 tailem 1 Sredního 1 Tabernator 24 venovanému 49 Tampe 10 spižírna 1 trebilo 6 Terschelling 5 Vann 10 treccani 1 taylorova 4 trubadúrskou 1 Stenborg 2 S orchestrem 2 trumfoval 1 Spandauova 1 Tanatloc 2 tísneno 1 Tswnaština 1 Vaigl 1 standardnímu softwarovému 1 Tagovací 18 Traplice 1 Svetlovlastý 1 Spokem 2 traja 3 Svatcenko 3 Trittenheimu 2 SYLVIVS 12 sterilizovat 1 Theognóstovo 6 uprednostnované 1 Špehu 1 trettiende 62 variacích 1 Szontaghovcu 2 válovém 1 Uryho 1 szsvzs 1 tajest 3 Tempelgesellschaft 1 svarum 1 vellarin 2 Turcóc 1 Tsygurov 1 Štampy 203 ujme 4 trwagjcj 1 sudő 2 vacantia 1 Takatsu 1 Thánouová 1 trírádkovým 527 trolejbusové 1 Stephenovy 1 variabilnost 1 thyreocytu 1 synkretistického 1 Urážení 6 ThemesDir 3 Valdonnez 1 thorellii 4 Stredomazovské 2 sponkách 1 Terrosian 6 tupela 23 Symi 2 Vázla 2 subdivize 1 Védfalu 513 uvidí 14 Trešnáka 1212 Speciální 1 Ucpané 1 udn 1 stahroun 1 Uttleyem 2 Ulasim 9 Spotrebitelský 1 Tounousidis 2 thera 1 Stibori 4 Vélezová 19 svrhnul 1 Thordendala 26 tkalcovnu 1 Spornejší 1 Teyssierovou 8 Terminologický 1 Starostum 6 Sudkove 1088 Soupiska 175 spravují 1 tewa 2 Staciana 1 Trnavcanu 1 Turchyna 1 thenational 1 Sugarbloodsuckers 13 Thijsse 1 šperkárských 13 Urteil 1 Taschentuch 1 Ubunta 1 špikovaný 6 Stiprusis 2 Tolouse 9 Verulamium 3 USFSA 1 traditionnel 1 Vesnenka 1 suspecte 1 s Budíškovicemi 3 tolitová 5 Tréning 1 Váhovy 1 Spatialismus 1 styresulfonát 2 Trylon 2 ukolébává 1 tlacheco 17 Tykání 1 Štefanijin 1 Tetrazepam 1 Ulbrichtovo 10 Tashi 4 utáhla 3 triadvacítka 1 Troisgrosovi 1 Spirotecoma 1 Surugu 17 vakovite 23 talentum 3 štetconoš 1 Talafúz 1 Tolji 1 Svojeticemi 1 Toughen 576 variabilní 1 Velkoopatovický 1 Turócerdo 28 svatoštepánské 7 tvárených 1 Tragonísi 1 Tmutarakani 1 subquery 3 teleomorfy 1 Tauriskum 1 Úcetnímu 7 trpne 35 trojcata 2 Vereinsnachrichten 1 stesnával 5 syndikem 3 supersymetrii 2 varným 43 Tereziánské 1 Trojahn 1 Tournaye 6 Thonne 25 Stavenice 3 Thingstätte 1 Szklanej 3 SVATÁ 51 špicatou 1 thuriferár 1 trískupinová 1 tlachapoudem 1 Svätopluka 1 sžilo 2 Teusa 4 statistische 1 tabuový 9 úradujícímu 13 ustaveni 458 specializací 3 stríbrotepce 11 ÚAMK 2 trsice 2 Urcilo 1 tomorrowsplants 1 Újszentmargita 1 Vajdišem 1 Spoluvydával 5 Tonem 2 s moderním 198 tahac 6 Trojanský 1 s prijetím 4 Toussieng 9 spádovosti 1 Svatbicky 1 Tabajara 1 Strelský 96 Summa 1 Stenness 13 Sousedské 1 Supervised 4 Taldykurganská 1 underwoodi 4 Ulva 2 Urgyen 1 stridmost 40 Trianonské 55 TBM 27 Trebešov 1 Turjej 6 undecimové 24 styren 1 s Hizballáhem 1 STALAG 2 Suruktach 1 Tińosa 1 Stríbského 1 symbolics 1 Suttnerovou 1 Tobatí 333 stádium 1 Stanifold 30 SY 1 staroceskié 1 utišujícími 1 Spinneret 3 tibet 1 Telefteo 1 subarcticus 1 tennisový 1 TMORO 1 Steinhoffové 6 Tranio 1 tiV 11 Sphynx 1 Svelgen 1 tónických 3 Uskutecnením 1 Strachoticemi 1 Trancefusion 2 Štajnoch 7 Tullner 2 Stulecia 1 Verrochio 1 VASATA 2 Ulicníkem 21 Supersaurus 8 strížku 9 squadra 1 Tyranisem 1 Tambus 19 Varley 1 Tsukae 3 Tredozi 2 tambourin 1 Taiciró 5 Valtický 1 Suldanessellar 1 Uppal 4 unico 1 Spinster 1 urofobie 2 uzákonených 6 Tatius 2 Transtech 1 Valorificare 3 Sphaeropleales 1 vandalizace 2 trizomií 2 varje 2 vápenomilné 17 svíravou 3 Tropikal 23 sultánuv 15 stvolech 4 športových 229 vetou 1 starectvi 1 Srednekolymsk 1 upmixování 1 staršéch 1 Trossim 2 typhoon 2 vartovka 1 Vartigauntum 2 telefoního 7 Verliebt 10 Suvy 1 truskavcová 3 TROS 1 Tvillingar 2 tarokové 1 Univerzit˙ 1 Venportových 5 Starigradu 32 ukrytého 1 stromeckove 1 Uslu 1 tetrabrom 2 spinovými 3 Stríhací 1 sportifikovaná 1 Sustenlimihorn 25 Štátne 1 turkickém 1 upaluje 39 strávená 1 trojnásoným 1 Strřmer 1 TPQ 1 specifiké 12 testovaným 1 Termiz 2 Verfassungstreue 16 Teleko 4 tancírnách 1 Transromanica 1 srdnosti 1 Takigawu 1 Spuriem 22 specializovalo 2 úrednictvem 13 trojfederace 18 tukání 1 Toukijou 2 Strabbingtonovými 2 Vabec 1 tankiny 2 s jasne 1 tríokého 4 tobom 2 Valgrisii 1 Triplebar 1 tigrejského 1 STERCULIACEĆ 3 UAU 1 sprchovacích 1 Torikian 2 spojistost 20 Stínová 9 úcastnici 1 stellerova 2 Spasmaria 289 Tvurci 1 Stetterem 41 specialita 1 vcard 4 švédka 1 VESNIC 1 uzniverzite 1 Tomkaye 7 Tubokurarin 15 Sprachlehre 9 tenorsaxofonisty 1 vddb 1 údelum 1 Thamiras 2 ucm 1 Tojohisa 6 Strunecké 1 Uskelanjoki 2 verzuipt 1 Suillotaxus 1 strítežský 12 vazalská 156 Sting 52 unitáru 1 Törökkoppány 18 Sušený 1 Uživately 7 Szkoly 1 tanzánijské 1 uremie 5 Towne 2 Vanbilsen 1 s AC 1 spolkove 29 switchu 1 uhlírovsko 3 Sprinterské 6 Templier 1 Vallak 5 Urzoni 1 uspokojivejšímu 49934 této 1 Stojanovy 1 Tíré 1 Thedoroi 1 studioel 1 Tigride 2 Veret 1 transceiveru 123 uzná 2 Thoreauovi 2 Spencerovy 4 spinlock 1 Tanigiri 1299 sovetského 8 Spomínam 64 uplynulém 278 vánocních 2 uzamykacím 18 surovine 1 unitárském 1 tulešického 1 talbotu 1 thuis 20 tišteno 1 ?The? 1 velezradným 9 Stortingu 1 tygrovite 1 Todfeinde 1 urinaci 1 Theofiluv 1 Speeddrome 1 Teplensis 18 transsubstanciaci 1 TURCOM 777 Sýkora 13 Spínací 1 umírat… 1 Suevu 1 Tochtlan 1 stené 3 Štepi 1 s horeckou 1 Vandereyckenem 1 Terez 1 Szkolne 1 Stadione 8 squeeze 1 Tirca 1 Urosi 1 vesicula 4 syenitových 3 Uberman 1 turaj 45 textilky 1 venous 3 Sú 6 tachypnoe 1 Tamao 5 upletl 1 ustin 1 Vaimaca 1 Squamiana 7 tkalo 1 tepolomery 4 Techniken 1 Štubnu 1 Stanovenou 3 Tagliabue 1 Surazovka 1 Starachovicích 4 Uvarené 11 venuší 1 stolps 1 transekci 3 spirare 1 Spurio 25 svedcících 769 soustredil 35 toten 2 tranzitivnost 1 sourozenkyne 3 Truksou 1 upejpave 12 strouhanky 55 svarové 5 vakcinacních 1 sylogistika 3 Torou 1 Uudem 4 Úkazy 2 Stachl 3 Stipetum 95 Specifický 1 suomisoundi 1 tríadresného 1 velkopostních 3 Trebetitsch 8 Tatianus 1 Tarkio 1 Truhlu 2 Tundrové 1 superbloku 1 Trineckého 1 SYRIZU 3 trás 9 Tumi 2 Vetrušicích 1 Stenkyrka 2 symlink 2 stratifikovala 12 Triulzi 1 Svetlou 27 Stallburg 1 UNCOMMENT 10 spojivka 28 uranylu 1 Sullens 1 Steineggerem 1 surfují 1 Suńé 1 Triberga 1 tokaništem 1 terezinska 1 Valgarissem 84 sprežky 1 Tachyporinae 1 svud 7 uchopen 2 transportujícím 1 Turócszentgyörgy 1 urikosurika 14 Špirk 16 užitém 2 Suttunga 3 Svatyní 50 valašského 12 Usazeniny 1 stafordširským 1 Starten 1 uplatnuji 1 Svištové 3 superhelix 1 sporický 21 tiskarská 211 vejcitý 1 Vedastini 1 Tód 1 s patriarchální 7 Svoldu 10 uklízece 758 spousta 31 strediskum 2 stredopaleolitických 3 Toxinogenní 2 symboliste 1 Technibild 8 Tumanjan 2 státovedeckou 1 UNGAR 1 uranuNejrozšírenejším 23 útocícími 1 Vernerák 3 válcovaná 1 Verbokolskaja 2 Taipalsaari 1 Tortugero 2 Subhendra 15 tepláky 3 tlacítková 1 Tabické 6 SSSS 1 spozorovaných 1 Upmali 1 Vakbeweging 1 svecenky 1 Timurtaš 1 Stabilizer 1 tešejra 1 Tathagáta 1 Tetrody 2 Týnka 1 s materiálem 381 Titulní 2 staroperština 1 vaupelianus 1 Suchovršic 13 Váez 2 Tyruse 1 Toppers 1 SteelBook 1 Vaudable 1 spinany 11 Vécko 1 Vermählungsfeier 6 Turavová 2 Velecínský 1 Stoltenhoffové 279 Tádžikistánu 1 Transfuzja 1 tarasení 12 tkánová 1 velkochovum 1 tatiana 1 Tiniovi 4 SPADech 16 svalnatou 1 Sulzburg 138 úvaha 1 Trešek 2 Surovinová 1 Svrchnekrídové 2 Takašim 2 tenkostenným 17 Syntaktické 2 Verzet 2 Trocchi 35 Tyrell 3 Šupinonožka 1 Spiritistické 1 Spenserova 1 Velacková 2 uška 226 Tasmánie 3 Surinamcu 3 Urashima 2 Uhrícek 7 Subakovy 1 trnoleguánovití 2 vakara 5 strukturalizaci 1 tachin 1 Tomcave 3 Stilesová 1 sžíraly 1 Stephanocereus 3 tmavejším 1 Túpaj 1 vábna… 1 Superstaar 1 uszkami 1 Undeleted 1 ulmští 10 Synodální 1 Vanitasovi 1 Szulin 1 Uklonskovit 7 splatila 1 Spezialitäten 5 Vcelarení 16 Sprecher 36 Straub 4 stopový 1 taromantie 1 Tujungy 16 Statutem 23 Trpyt 2 torek 1 steinerovské 4 Verkehrswesen 4 Starshinov 25 Velvarská 886 úlohy 2 Tatona 1 Vasectomies 1 sundavali 1 vadmal 1 tholianská 1 Tonota 2 Štítonošem 8 trestané 1 Taenidia 3 ÚOÚD 3 Tinmar 2 Štáhlavské 4 Tumansky 1 Souworoff 2 Tríškovi 1 substrukcí 8 toužimského 13 Tuilerie 17 Tankery 1 spondylodiscitis 37 stabilizovaný 1 statku… 9 Sweetie 33 spoofing 40 válcovitým 1 Urbietem 9 tváril 1 Špilaru 67 Testudová 4 Synthi 24 studenejší 1 Velenijos 24 Spieler 1 subsimplex 40 srovnala 1 tahacím 1 Starobilske 1 Tatické 1 tardis 2 tucnákovitých 1 supetar 1 Uplakaný 2 Stýbla 1 Valdemone 2 Syllabová 2 Trenberth 2 Stankovits 26 teplomeru 1 venédského 4 sž 2 technichých 1 tycím 1 trojiceSousoší 1 Toshimaru 1 Sportmotorcykl 1 stadtansicht 1 Tiffitha 1 Troplong 1 Tradimefon 5 Štiavnický 1 Varvarian 1 tržaško 1 utajankta 1 tradícií 4 Sterope 5 Vajnara 27 translatologie 4 Umtata 2 stavedlovém 1 szellemfiú 1 Tetínskou 6 természettudományi 4 Strídaly 4 Tüan 1 Testograptus 2 Torcheville 1 travivajoj 49 Tachovsku 1 vakcínových 5 Strechová 13 utopickou 1 Státnic 3 Tiqwa 2 Uthmánovu 28 Strechu 2 substerile 1 ucednic 34 vakem 2 Thunström 3 vepsali 1 Svanovská 1 stádijní 3 Triumfoval 1 superkrosová 4 Usmrtil 1 titulPoprvé 1 spoluodpovídá 1 Trapezu 1 verzaubert 163 VA 1 TRANET 1 urbane 1 Twality 110 tucnáci 5 velkosklady 1 triannuliformis 58 Symbióza 1 Trongisváguru 1 Sudburyit 13 útocní 6 Valentines 3 Thunderchild 7 vaišnavové 12 trojcetných 2 Taiketsu 13 sváženi 1 Stocný 1 staroštokavský 3 spevácky 1 uhlákem 7 Theina 1 tyranosaury 1 vancurova 9 sugescí 3 ? 6 synopse 5 trispinosus 1 Thayaner 1 udeleleno 8 Suvenýry 6 Špindlerovku 1 Trigla 1 tarpanovitým 9 svetlicemi 5 Therizinosauroidea 1 Ukrainski 2 Timmerovou 24 ug 1 Spornová 2 Tannwalder 2 Toivakka 6 verolomnost 1 Traducida 1 Sowards 1 unitedstates 1 trhána 1 trebový 16 špickovém 1 Štepánovicka 3 Tiyas 1 vanecskému 2 suzdalském 1 Vayhinger 2 Vecovského 1 Tivanit 1 utráceni 107 textcolor 15 varixu 1 subakvatický 1 ultravakuová 1 špýcharový 4 Surrealisté 206 stíhace 1 Stygamoeba 1 synthetique 2 Unterfamilie 4 štítarská 1 Tranai 1 Uaru 4 spet 2 Spuštené 3 Vallbona 2 Tollentino 1 Temerlán 70 Špitál 2 Vedžahorresnetuv 9 verolomnosti 1 Taxiky 73 Sprague 1 trískovému 1 Tussilaginetum 1 Stabwound 1 Toruec 1 Tutsiích 2 Valkerický 139 Tauri 1 Thatcherových 1 Vaisaluoktou 1 Unmanned 2 Vaindloo 87 únetické 4 Talsperren 1 tawka 1 superoxidech 1 unity 1 Upadesa 2 Stibralem 1 Unvollendbar 1 theogonií 1 tržnýma 1 Tanglik 3 statecnejší 4 statements 1 Tholme 7 Treitzuv 1 souradnicove 2 Vectry 1 ŠPIÓN 105 UFC 1 Veluwerandmeren 5 švamberského 3 terajoule 4 SUŠIL 3 tatínci 1 Superrally 1 Vasilena 1 TONITRUI 1 triti 1 TimeZone 1 Sumarizující 1 Teltzsch 1 Tauffelen 1 Spolcování 4 Vejunyte 1 teoretizován 2 Traverza 22 Vecerek 146 Suej 1 spolecenskopolitického 120 tesnou 12 Stubbe 5 Špok 1 vervních 58 Vavrinci 1 Sugimotou 1 stránkující 1 transformána 1 Thalíin 7 Spheres 1 TAJOVSKÝ 2 SYSTÉMU 46 Španiel 3 tezce 1 Tschernewitz 20 valníku 4 Textilka 1 Sousedních 1 Švabíne 39 TUO 1 Straßenschilder 1 Venezis 11 svatostí 1 Vaagali 32 tim 1 TOPOLOVÁ 1 sterilanty 1 štepanovský 3 Stecková 2 sovinecké 1 tycovém 1 Theatresports 3 Tracing 2 Tufové 723 Spencer 19 Stéká 2 Stigeoclonium 1 Stefanykova 5 Tajze 3 Stichovic 1 Sternenfelsu 1 Tutukaji 6 Tollingera 1 Stopping 42 spolubratry 1 Tourtouru 1 Vadža 1 stvrzeném 3 spolkly 1 TRÉNINK 1 úcastinnej 1 sverdlovskou 4 sugi 1 tajským 2 Temnotrogon 1 s budoucí 7 Swartzieae 1 Tibii 1 Steinbäcker 1 talasemií 1 spaciokardiografu 1 užasneme 9 uštknout 1 súhlasili 1 Uitwa 1 trojstranné 1 toolserver 1 Venäjän 1 Swallenochloa 1 Vašáryovou 1 tvych 2 Strasserismus 1 staromládenecky 3 Tímhle 165 sponzoru 1 vasokonstrikcní 775 splnit 3 strapatý 3 trojznakový 1100 stanoví 1 s?nide 1 s prelivnou 1 topícími 1 stelle… 14 sphaerospora 2 tably 1 Sredanci 1 Tirpersdorf 4 Strachotíne 1 srustala 5 Tsoj 1 tobermory 3 stopkatém 2 Szemud 2 Unikód 57 varován 2 Varnum 2 Trentemřller 2 Trahan 2 údamú 1 Surianim 3 Splashy 1 Tolise 1 Tricorne 29 Spacek 1 Tuchomerický 1 Trřje 1 Sultaniye 1 Velevážený 1 spektroskopu 55 stmívání 1 Trajanauskas 1 Uvolneného 4 Transcendentálie 4 trifluoroctová 3 Venstreparti 1 uhru 1 Trompetdtraat 1 spalovaném 1 ururupavira 1 Velkomoravská 2 týmech 1 Tschörchem 1 Szemenye 1 tradimenti 1 transnacionalismu 1 španelštiny? 3 strednejurské 1 Tellingstedtu 1 Thürzin 2 Tselovalnykov 3 ustupováním 1 testudinta 10 sporozoitu 1 Uncritical 8 Téry 1 Stivic 1 Ušlu 311 syntéza 1 vät 6 VDL 2 supercelu 1 s figurálními 5 trmínkový 1 Topitschem 12 Stanmore 6 USMP 1 Taussingerova 11 Sushi 4 Sugizo 1 Uverejnovány 3 Utonul 1 uplift 3 substituuje 34 svrab 1 Stuttgardu 1 Stredozápadního 2 Tscharno 5 Torrensovo 22 Tekovská 10 s rodinou 1 Sudlaac 6 Termoterapie 1 Úseková 8 Syntonické 1 tourant 1 tvorbám 6 stenografických 10 Suško 1 Svanborg 1 tracheomykozou 58 teplický 8 Treacher 3 stokilometrové 3 Torche 1 steatohepatitidu 2218 tabulky 36 Talbota 24 Vasil 76 Tkaniny 1 vedutového 1 Trysková 1 undugu 2 sparringové 1 Stiffbeards 62 upol 14 studiovými 1 SubG 1 srandarum 16 venkovu 93 úrokovou 9 Stausee 1 velkohorský 1 Thierische 1 štetinovitého 1 Ügdülerová 1 Verlotu 2 timi 1 tasmáttasmádždžátá 1 Strassernem 8 uvolnovaných 1 tumbuctina 7 údolícka 2 Topozera 7 Sueviku 91 Strix 12 Tragic 2 tyreoforanu 214 Telnice 1 Topologilinux 5 Takaová 47 Venušina 14 tlapka 2 ventilovému 1 Texelem 2 tlumocena 8 Toljatti 3 tlakomerné 13 valchy 11 sportovni 1 Vassivere 1 tovariš 2 Thabít 1 Vardanjanovi 1 torpédovny 8 transakcním 1 Taženíroku 1 Trojpalubník 1 Talica 1 Velmic 1 Ständestaat 1 staggione 97 Ucené 4 Svecný 2 Thirdspace 1 Tongomayel 1 utichlá 1 Tontti 1 Stylovost 2 Tarjiny 16 uzavírané 1 unerwartet 56 tocila 1 Terenteianus 1 Ulcérations 1 Stahujou 1 Tervíru 4 usmernovala 1 Usiškinem 1 stojedenáctých 2 sverného 1 sundávacími 2 Tombeur 4 Údiv 1 Trocundis 27 Tarbosaurus 2 Studenice 1 Valgaavovi 1 Vágner?—?ilustrace 1 Systolosoma 1 Stomach 15 théravádového 30 Vadis 7 Uharcek 1 Turgun 1 timeless 114 Surinamu 135 umístily 2 umrti 1 uhnetená 2 Vartensis 3 trpná 18 Turboméca 1 srážecími 1 TurboD 1 tamperská 1 Spalis 1 Tryvannsbanen 1 Terronského 4 Standseilbahn 1 s Jobsem 70 Trnený 34 Upupa 3 Strokous 8 Thomasson 1 Tülipchin 3 šprtem 1 Techa 2 storiascacchi 8 Tallano 3 Spitalgasse 2 stripum 7 Ulriku 1 trestancova 1 Štepanovskou 1 Takymu 2 Vandit 2 suffecti 3 sulfapyridin 1 tadasja 20 úhybný 1 vepisovány 1 Véhone 1 Sursuku 1 Telerigovi 1 trezidavomartiofobia 1 vetrinaria 1 sysupgrade 5 Umbert 1432 verí 1 Tripiti 7 Uraz 1 Tätte 25 uzdu 2 thumbi 13 trojkolejná 17 Usmírení 18 Vaculíkem 2 Tatarova 1 subklan 1 usmyknutí 6 Tigraji 1 Strumu 1 vermutového 4 Uredo 1 Valör 1 supergranulí 1 Úlohove 12 tíhnou 2 uzdickové 1 tenších 385 Srby 1 Tropi 12 tréninkovými 9 unor 1 Tetchie 1 Thälmannová 1 Švorcenštern 1 splínovými 1 stodvacetitunového 19 utrácel 1 Tedda 7 stvoritelské 2 Strunnikov 2 Spolecníkum 2 Tulach 7 théologique 1 Vergewaltigung 1 Uralmašzavoda 3 SVOC 1 Syracuskou 1 Stanetius 1 Suckel 1 supersingle 5 Töro 2 svorkového 1 Švábske 1 tlumítko 1 vážským 1 Sundov 1 Ustinovi 1 úcinkovai 1 transformacnímu 1 Stremošic 1 Toree 8 terminátora 5 taeniolatus 3 stolarských 5 Umajjovského 144 tren 2 Treffléan 79 taví 37 Tajovského 1 Tadasana 1 s metropolitou 35 Vazebná 1 ukamenovaný 1 SVŠZ 1 Torday 1 stopblooddiamonds 63 tvarum 24 Sztevanovity 1 variora 3 strindberg 2 Tekovským 21 SVÚ 2 SVETOVÁ 1 spolumajtielem 1 stieß 1 Strakatého 423 teroristické 2 Spektroheliograf 89 Težištem 3 šport 1 staršch 4 thio 6 Ungara 1 turkanskou 2 spritech 1 Thabit 79 Váchal 2 svecence 108 útocníkovi 1 Thysanotus 36 vdecným 1 Úhoštanská 1 Tigua 1 Speyetoorn 1 Stomatepia 5 Varces 1 txtV 1 verbrusseling 2 Turnianském 2 šustivá 45 Stolová 4 SSTC 3 Steinerness 1 Špitálik 10 uchycená 5 unexpand 1 Uranowiczových 1 vekovévodský 5 Veky 1 Štorkové 1 TESSERA 2 Stli 1 Standschützen 21 Trubkovité 1 uniklí 1 Sternwartestraße 1 Tržici 1 Tewfika 4 Srílanští 3 Stavištský 1 Strihavkovi 1 srolují 1 Stolecné 1 Streptocara 2 tichostí 2 squamiferum 6 Sturmtiger 13 Timorim 1 Stümperzug 17 Styron 1 tukstantmecio 1 Théme 1 Uspokojsja 1 totuto 1 ukázují 3 Triendl 1 Staduchinem 2 Teneurs 1 Vaiciu 1 Unterbusele 1 Swoll 1 Vampi 1 Stratforda 2 Stredoceští 1 tetraploidnímu 1 tumbovou 1 Tríkolový 1 unínské 3 vážicí 6 Tripleurospermum 285 venkovský 2 Utrobin 17 stredoceským 1 Tsó 2 tuhs 1 Thýnem 1 Syke 5 Timof 1 Tótvázsony 3 ukrývaných 2 tridcatina 1 tortus 1 Tolstá 3 tuhnoucích 2 tetrol 5 Steganographia 3 Valiga 13 torzi 2 Tvorcovia 1 trojžárovky 1 Valihrachem 1 Tazzer 1 uudenmaanliitto 1 Variohoog 1 Supermini 6 sutanu 1 SPBRG 1 ukojiti 1 Trešcenik 2 vĺra 1 Tangphongová 2 Spotteri 1 Spiewakem 1 szemöldökét 26 Sphaerius 1 s nemeckými 42 Toronu 1 stachyózu 3 Štedrkov 8 Steeple 6 sucouských 1 vespri 1 syslovští 1 Untersauerhof 1 Sporitelnímu 17 Tetha 25 Šutka 32 telenovele 2 Tennantová 3 Spugnole 2 stísnene 3 Trítrubecký 6 vanitatum 2 tautas 2 spicula 16 sucharu 1 usporadání 13 Spirogyra 2 Toumey 4 tetenice 1 tšetvertti 4 Styxu 1 takojaki 4 Spisovatelské 1 testaccio 1 s DSLR 66 Tematicky 1 techstepem 1 TopoQuest 91 štafetou 2 usno 8 ujistete 1 Tuamuv 1 Univerzitám 34 uprchlý 2 tigered 19 sykavek 2 spinebuster 1 Triptilion 114 turbodmychadlem 92 spáleny 1 Terminátorí 1 Stanwell 11 špetku 2 Tandilu 2 trogii 42 stoicismu 1 symfyziodéza 1 strmýni 1 spolcena 3 Swiete 4 Starnbergského 7 Tropinin 33 tímtéž 3 starozitnosti 8 spolulezce 2 TONA 31 svišti 1 Tzenkethie 28 tepová 1 Trzebiatowu 3 Stym 1 Tiomkina 2 trafugato 15 Velitele 17 Steyer 1 Velebte 1 Teare 1 Verronika 2 úrokovacím 3 šríméru 1 Ukrývají 4 Tocquevilla 1 úcelovém 2 Umanská 2 Ungdžin 5 Texcoca 1 Urechová 1 titanzinek 1 trídimenzním 23 stochastické 1 Suisu 1 sukuk 8 stoupa 2 svetlezelene 3 spaziale 5 Udomchoke 3 Sute 203 Štepánem 1 Starovickami 1 Szapary 1 Tyrmanus 1 Valyaev 1 Transzendentaler 1 Verže 92 souvisely 1 suspendovanému 3 Tikz 1 terarijním 1 vehlasnejším 1 teamgiantalpecin 1 Staatsbrauerei 5 Terrou 1 Spealáin 1 Thanatopsis 3 trevírském 2 Svoi 1 Torkardu 2 Unifight 4 Štvrtý 1 sterrenkroos 3 templum 1 spune 46 SVD 1 Svaljavskyj 17 uvolnovaly 1 Tenebrionini 1 Tabaicary 1 TricycleAntique 6 TREBON 4 Theuriet 1 velkovcelarem 1 Sozialarbeiter 1 spoutávají 1 trofickém 1 Studentskému 1 Ulpiano 1 Tóthu 1 Tourbillonem 87 velvyslankyne 6 Turzovcu 1 vaattei 18 vápnito 88 tiebreak 3 toulcovité 3 Tholing 1 Tholaria 11 submontánním 1 ÚRE 5 Timburr 4 Stachiewicz 2 Trogneux 1 Straßengel 1 Veerabhadran 25 Tomica 1 tosbaga 35 Strava 6 Thákurovi 1 Suspence 1 Stoep 10 Tajemnice 1 Verbeneae 1 Stádne 1 Ungulipetalum 58 Švédština 171 version 1 tetraci 1 Valdčse 1 togatae 11 Tomícka 1 UGV 1 Syrdarská 100 Sovetskou 1 verrückteste 6 tholinu 1 Stourport 1 UMGD 3 Theophile 29 štepen 6 svaloval 1 Ullstadtu 3 stredoitalských 1 Tokamaky 1 Streczan 2 Tschechiens 1 trírychlostního 1 STUCHLAK 1 tercina 3 Vassiliou 37 Steps 1 Stealování 23 svatopetrské 2 ujíždeli 2 Vegetariánské 11 Ultravox 4 Theaterplatz 1 tekocích 1 úspešného Intel 83 synteticky 33 Švermy 1 Trisrtan 2 sporopolenin 148 Uvedená 85 Stachy 1 Ungdomsarbejder 5 teplokrevnosti 28 Supercrooo 1 trovati 11 squarrosa 1 Venstresocialistisk 1 Undugun 94 stanuli 1 superchargered 4 strážícího 5 utkani 580 Touto 9 ÚZIS 2 Uprchlíku 1 Transflautato 1 Toubi 1 turnianskou 1 Ständeordnung 8 Tymošcuk 15 Úlomek 9 thoracicus 3 umeská 1 Spergularietum 3 tretinovým 6 Süphan 4 tourné 1 Swissbit 1 tritol 1 Splynul 12 texana 2 spacií 1 sprádajíce 1 Stocquainová 18 staroslovanských 1 Tsisiou 210 starožitností 6 Vaihingen 191 SUV 1 Turzova 1 Spekulativním 25 Varadero 1 Terentian 3 Stojkij 6 trasovaná 1 Togechick 1 Tierling 1 Theriantropické 1 tendují 4 splatného 1 Újrónafo 8 Tisserant 1 Vapirovem 1 Tander 1 Udrzycki 1 Venske 2 Umocnený 31 tys 5 Terrorists 1 Stadtrandsiedlung 1 UST 2 Tomto 2 stojanových 7 uloveny 1 trojdomost 1 SŠAI 1 stragglers 5 Tankování 1 uctívanejší 267 Tibetské 1 spékaného 48 trakcním 15 Štýrským 1 Strašlipku 1 vampírum 5 svatotomášská 8 Sportovce 2 Turistföreningen 1 synaptotagminy 4 Torretta 2 Tankréd 4 Souppes 2 sumcem 1 verschon 2 TECOMAT 7 vahlii 142 tamejších 7 tovacovské 1 spuštenána 1 Univerzálních 2 úlomkum 9 vagíne 7 Stirnera 5 tranzice 1 tuorno 2 Sypytkowski 1 s technikami 2 stykacovým 16 stehenních 4 valašky 15 Szisz 1 továrnickou 1 televizniho 5 Symbolizují 8 triathlon 1 Tilpina 1 Szatmáriu 1 Špora 44 Storage 6 ture 2 Sukenikem 1 takera 6 Tasmánií 3 Thamnophilidae 4 Tamerlana 1 utlacením 5 Štávu 29 summary 4 Turkuckých 1 stq 4537 týmy 2 Tabellarischer 1 transponderem 6 Trébons 43 Tribal 27 TKZ 14 Steinmasslová 1 uhlírum 2 Sultani 1 udržitelnejším 2 Stážista 2 Sylantjev 227 symbolizovat 5 štírí 1 terstští 1 Stropkovští 1 spoluobdržela 1 Tlapexcua 1 Swaene 2 Talissieu 1 t?je 1 Trichinopoly 1 Urdešic 1 šší 1 Urio 1 Vdovinou 1 spulka 1 Údálosti 1 Suprový 57 Tölz 1 teens 1 upovídanému 1 Technovská 5 Tykadlovka 2 twoje 1 spondylochirurg 22751 svuj 6 Valentu 14 úkolové 1 Tautovu 143 trestat 125 Špidla 1 tenderem 1 Spiritistentreiben 2 typicum 11 Thorondor 1 talalínen 3 úmerou 1 tshiVen?a 1 S výtvarnými 1 Ukweli 1 Vadává 3 Thiersem 2 Tereshina 1 ÚTT 23 Triplane 2 Tromřy 1 Sudetenquelle 1 Valchai 5 svetelském 1 Stremešná 1 tragos 1 štouchu 5 Tsurugi 1 themissglobe 1 Tutek 1 vanu 4 Trenov 63 umírnených 27 Srpina 4 Treštine 25 trunu 92 soustredených 1 upletena 1 stoctyriatricátý 1 stopdetskepraci 4 Trichius 1 Vajsberg 2 Swindschitz 1 verdoglobin 2 Uncasovi 34 Surfer 1 Užljebic 37 tiesnava 1 UnionPay 26 svetícího 2 ustríhané 3 tenera 1 szš 4 Uložil 1 tablas 15 tarandus 12 tourist 2 surfinie 1 svetlocivá 14 velkokapacitního 1 Trypetheliales 1 tradukado 1 sprostému 3 Tungir 27 stupnovalo 1 u?Chrudimi 5 vamberák 3 Strevíce 33 tokeny 2 Spáciluv 3 Tertula 5 sutovou 11 späten 2 Velosnes 6 Tržba 1 ustaraná 5 Ünsal 3 Taškurgan 3 spende 1 travessia 2 Sumaského 2 Tyringe 1 Tišnovským 6 Velas 2 ÚTIA 68 spyware 1 Trebomislitz 2 Tahríf 1 Venkobachar 1 thermofobie 1 Troutovi 1 strahlt 1 Šramané 1 Superrozlišovací 2 ucastniku 13 Vettera 1 Trén 3 ticularis 1 Švýrarsko 1 Suarí 7 Utopenci 1 teotihuacánská 17 tycek 22 Typove 2 Triod 1 Tatarovy 1 s ukrižováním 2 Tailed 4 Uptight 1 Tunisanku 1 Theopolitu 1 Thesalia 10 Transistor 1 Sulaymanem 2 Teofily 13 tropanové 27 trivialis 1 suberiny 1 succubech 4 superbe 9 tonalit 1 tropicko 1 Stegodontinae 1 údáván 1 Sternbergových 2 tetováže 2 úboc 2 teksty 10 Tkánový 1 Szentgál 1 Tralinsem 1 Vaiksaar 1 Vachuštiho 1 Superspecies 4 Svetoslav 2 stradacem 14 spáru 1 Triffidu 1 Tuhanská 99 Takahaši 178 Tre 87 uhelnatým 5 SSHFS 4 usaci 2 thornei 1 tický 2 syntetikem 11 Tramtarie 10 TekWar 55 Verovice 5 Tríbec 2 úpravárenská 3 švihání 7 Tulear 1 tezaurované 3 superlehkou 2 Tarongoy 1 Tadeocusovi 1 TradeLane 1 s cirkulací 6 vachmistr 1 spoluzakládajícími 1 tootsie 4 vacans 1 umbrijským 2 Tartúší 2 Šyliu 1 trichlorethanu 1 Šterneku 1 udzungwaský 5 Vallone 7 tankodrom 11 Varnu 1 tamboura 48 Telní 2 Stanovilo 3 spirochetami 1 Stochode 2 Truchčre 17 Suchomast 2 Uctívacum 1 Štirínského 1 Staníkovo 2 Strafrecht 1 tiktak 1 staypoland 2 Thüm 2 subcordatum 1 s uvedením 7 Tempęte 2 Stiliana 2 transfázovým 80 Springsteen 2 Tygrum 1 Veroliho 1 Vegere 1 Starohornonemecká 1 Vermaas 1 ulcerující 3 strážilo 2 twill 56 údržbár 30 ustanoveného 1 velkovýkrmna 1 verace 2 Vanaivan 4 Tržne 1 Spanochroa 1 Vecernícková 1 univerzalizace 1 Sprachlabor 2 Uhrenmuseum 1 Stehlíkovu 1 Trangoše 1 velkoletoun 1 Thoune 1 Tiantajském 1 termohrnku 1 Thuringopoloni 4 Stalloneová 18 utajovaný 1 Tolko 1 sprvna 11 telmateia 1 Tirnaviensis 2 strnádka 2 upozadovat 2 Tjo 2 Tesání 1 Sumniková 1 verfertigt 1 Tenos 1 Tvorivé 3 tagala 2 Syngman 1 Špurová 1 Strachotický 2 stredoceští 3 Timma 1 Tonojaka 1 šoustání 1 Usonis 1 tobaka 3 tiberiadským 1 verklaringen 1 Throwbacks 1 swam 16 Svetí 15 telcské 8 Suchbátara 8 Spálenecek 1 Umangit 1 stocholmském 22 vadnutím 6 Süleymanov 1 tüttöä 8 tengrismus 2 Tisícum 2 Tikehau 1 stochastic 1 spekulovaným 1 sparingu 3 triphyllos 8 VCC 1 Stredonemeckém 1 Tandara 2 Sousosi 2 Tingley 7 Timing 4 Ulit 17 Vála 3 Suaru 5 tulením 1 submarine 1 Testimonies 10 VCT 2 Venturella 8 úrocen 1 Thaiszia 2 Tichodromatidae 67 sražen 172 toxických 400 textilních 45 šumavská 3 Švedláru 36 Stott 273 stimulace 1 spells 1 Ústretech 2 Vecinovou 1 Stouska 1 Stygivenator 1 stühlinská 2 Trubeckým 101 Vel 10 stirbt 3 uucico 132 ústavne 3 TBTO 1 urskou 7 übertragen 22 udí 1 špione 1 Totecovi 20 Uša 52 Unipetrol 8 teokratického 1 Udhampúru 1 SycoTV 1 stékalo 4 UDEUR 1 trnoslíva 251 Trutnove 2 Tojolabal 1 Szynkiewicz 1 ‚Toto 4 Šunije 1 tenemet 2 STSC 3 szechuanica 1 sponton 3 Thébskou 1 unsterblich 8 Stubb 6 Trabantem 1 tjugo 10 Uffingtonu 1 sulibanského 4 svízelka 1 Turkom 2 umistovaného 1 Varyšová 454 uvolní 1 Sydneysider 2 Staniulis 4 tudoru 18 Superego 1 Umeni 5 Verwer 2 Supercarry 3 Tillmana 1 Strumós 1 Süßwassergastropoden 14 Staates 2 Sulitjelma 2 Stupavské 3 stomatologicae 1 vces 7 Velkoobchod 1 tkánovci 1 tragoedie 15 Trematoda 2 VDEI 3 urážely 1 stranme 1 Teuffelu 1 ušpinenými 1 verobala 1 tomaranai 52 Stonarova 3 Štangleru 7 TEPCO 8 úžasném 1 Stollárové 3 Sweetchuck 7 Svanidze 18 Trunu 4 Synopse 3 študenti 1 s chronickým 6 uchopíme 1 Syndrone 1 Ukrižuj 1 štetkami 1 Turpilinus 12 syndikace 1 Uddhavu 207 úhlové 1 ušetrím 1 Uhodilo 1 Tavitian 2 sucouskou 19 uzamcené 1 Thorianit 1 Úrovní 1 stardávného 236 Trhové 1 trhavo 1 Štarmanová 1 tianxiŕ 5 USAS 1 Trunken 1 SYNERGY 4 Tschechoslovakische 1 STETS 2 spedici 2 valecnehroby 1 trojrovinný 5 variometru 58 Stanislavu 1 uctená 4 Thessalonice 2 Urchac 1 Varadarajan 2 Štípe 2 Valentinetti 1 storyTellerThread 1 Tarujo 1 Šulman 10 Trapattoni 1 Trojanovicová 1 terningar 37 strevu 10 Trigo 2 Striepeke 1 tvrdoš 1 Steklovuv 1 VelikéhoRíše 2 svrchníku 8 uldskou 1 topasy 1 TEž 1 strednica 5 Techonínu 1 Totalum 7 svolávány 2 Tanay 1 uzeny 1 Varilovou 2 Svisa 1 strebe 4 Transversale 1 tvárenky 14 Suida 1 Tehdejšímí 1 Subantarktickými 1 Sterilovaná 80 uma 1 tojan 2 umoren 1 Tellersack 1 Thorgersonovu 28 Stranka 11 Tinseltown 3 stežnové 1 Telisha 4 supervulkány 52 veda 25 Ursa 11 ústnímu 3 Twillight 3 útratou 11 Svaryšov 1 sulfonátové 1 velký a kudu 2 Taeyang 2 Tiktak 2 stáhni 345 strýci 1 Varglien 54 Thovt 1 Srebrenickou 3 Valenzano 5 Stadtsparkasse 16 SUPER 1 Tchenga 1 Stillinského 1 Supersubmarina 1 UniVBE 1 urdík 1 termometry 2 Urheim 1 Trepotavým 2 Straširybka 9 stredomoravských 1 Tokránské 1 systém podobný 1 Titeru 2 Uvárazmiš 1 syrší 2 Tikalových 2 Stirratt 1 Strmobýl 12 Vernier 27 Timaios 5 Tetera 39 stabilizován 1 supaii 2 Swate 1 stredoveko 1 umožneným 6 trii 1 Stevencondie 2 stoduleckém 1 taf?ilun 1 šupáku 2 Tomitschan 1 Underlig 1 tribunií 1 ulyncován 2 TypeScriptu 1 Tuktin 18 týrané 1 Turbe 13 Trinecký 3 Sveteckého 15 Springfieldskou 2 Terep 11 Tributylcín 7 treštení 3 staroboleslavskou 1 tepetl 1 Trunicí 2207 stabilní 27 uvažován 2 swaté 1 Urbau 23 vclenila 2 švarného 1 ukiažu 12 uhlobaron 4 vertikal 2 troubám 1 Spievajúci 1 Tšcická 1 teepek 10 Tauru 5 Taylorovým 2 Venkatty 2 uštepacný 2 Termoregulacní 3 Valére 43 Védánta 1 Verneriho 18 Syrová 7 Tavíkovic 119 Tiskové 1 Šubry 1 Tenera 4 štábnímu 13 Svršek 1 TESTA 1 tnbasket 279 usilovala 1 Tomarops 14 Štedrovice 1 Ullery 1 umstritten 1 Transinesta 2 transportery 12 Travicná 6 Vercingétorix 1 spolocenstvo 1 Tigrinové 2 Tindfjallajökull 1 trestniho 16 Streich 9 Stehekin 2 uairean 1 Stephaniestiftung 1 Tatlurutit 1 Vaslinga 34 veselice 2 Stâni?oara 3 Sternová 4 s vývojem 1 VDU 25 Strocek 1 ?nz? 1 Toppnera 3 Týpek 1 Tokomololo 2 supposti 1 taifátu 1 Standringa 1 Tangakai 1 tohundre 1 Tádžického 1 s maximální 57 svetr 4 tygrici 1 úcko 2 trípouzdré 1 Tebbit 1 Vayovej 1 Upp 1 Stamboljevu 1 surovcem 4 Tomiak 112 úžine 1 Vaughtovy 1 tricátníky 2 Subbotina 1 supervizoru 1 Verreaultová 23 Vanessy 1 Stahlii 1 Tomkowicz 1 Valbiska 1 únavnému 1 vesmirnou 1 Velkobocká 1 specieller 1 Verwirklichung 4 Vazalem 1 svedsky 3 usekává 28 Thráky 1 Ubaldu 2 Swartkop 24 spouštecích 5 taxany 1 T?c 1 vašského 2 spektrum 113 spravedlivých 5 svlecenou 1 Szarski 1 tlustejším 1 veitchiorum 1 Vaudaux 82 spekulacím 1 triethylentetraminu 73 Vecírek 1 uradlivasc 2 Tilietum 1 Usacova 5 unterm 1 vejmutovkovité 2 Trofin 58 Trakcní 1 tentazioni 2 tyvende 56 stagione 7 toltécké 1 ustawi 2 Stínek 1 traitis 2 †Troodon 1 uhnije 2 šplhala 1 sympathií 2 Uconv 2 Velikonocnímu 1 streelingskou 1 tedere 3 ucnice 2 Telesino 1 Thornsern 22 Thimonier 1 uvízlým 2 Unambal 1 utz 14 tríhvezdickový 59 trenérkou 1 Užakov 1 Tavullia 1 UvrD 1 Turnbullova 1 veselohernímu 24 Suess 1 tündöklo 1 Teoctiste 84 Strážné 2 Uspenská 4 Sukniewiczová 1 Sunacni 1 Tratove 1 Verekunda 3 Šugúr 52 typování 1 štukolustro 2 Ufenau 1 Thuly 17 udelána 1 turbodynam 1 sukne… 1 Ústupu 18 Stoletý 4 Stori 1 Tiquipaya 2 tajnu 2 Sprátelili 4 Trauttmannsdorf 2 typizovány 1 Štepárna 1 Trialogu 1 TKZee 2 Tokušimy 20 Vestecké 46 syntetizátor 9 Telles 1415 titulem 1 Touched 2 topcase 26 SSA 11 Uc 17 uzpusobit 1 storka 1 Umrzl 1 Svátostech 1 Vasjutinem 1 tradie 1 Tadten 5 tomber 3 údolnímu 1 Urgon 7 subregiony 2 Studnickovy 1 Tellova 1 tupounum 20 Tanenbaum 1 usušilo 2 Tayliah 2 Triggers 1 Tuxtepec 1 Valdésovou 14 Tury 204 Tudíž 2 tiang 22 Trebuvka 5 uvázaného 1 troucím 2 Takti 1 Vavricka 3 Tourdjman 1 UTFPR 19 tranzistorem 2 Velkovýkrmen 1 Tenomerga 3 Vésines 1 symbolisations 1 VCube 2 Vermio 4 Sumnerem 1 ujú 1 Spieth 1 strukturálnejšího 12 Tereziina 1 Sundara 4 thoricitého 1 Thajové 1 Steinparz 2 Unias 1 Teichmana 2 Streckenwald 3 Spiritui 1 tvoríš 1 Stuivenberg 4 Spojováním 2 tekstovi 1 Trmalovu 42 Stezky 1 tsitsistas 4 útlumový 1 Újhegy 1 verích 3 Theodorétos 1 unifoliata 1 Tassovy 5 Verboci 275 Terre 1 Tlakomery 1 Tinzová 1 Stillefrede 9 utáhl 7 Traves 1 Svjastoslavovi 6 tipování 8 ÚHA 985 úcastnilo 1 stihacka 1 Unicorne 1 turnianského 4 Tuda 1 Theresianischen 64 Stríbrnice 2 Trúc 40 Vdovec 15 thiopental 2 spanning 27 valin 18 Šujského 1 spolurektora 1 Tiffou 1 toužimském 1 trístopých 2 Ukládat 1 Tajumulca 1 Szepesalmás 1 toxicaria 8 Stanovnice 14 uhlíkatý 1 Strebersdorfu 1 uHHHH 2 Syla 1 SSMEZ 1 Versagern 1 teslínského 1 titthankara 1 Universytet 5 varianci 1 uncula 1 Torjan 1 Tuburtina 6 tuberculi 1 Televíkendem 26 Šulek 1 sprengeliana 8 Švitrigaila 14 uprchlíkem 3 s jistým 1 Titchmarsh 1 surcotu 6 Studnicková 6 Švédu 6 spoluiniciátorem 8 udivovat 2 splývavost 1 Tiptonline 1 tenn 1 Sytné 1 Svlékají 2 Uth 3 utazásról 1 TOPAtoys 21 strašilky 1 thology 1 s vyloucením 1 Tavaliny 1 Trejsy 8 ukládáni 1 Studenky 1 tutlegi 1 Vasdekis 2 Torela 1 veldenzký 8 tehotenský 15 tresavka 2 tkalcováním 1 Studenevský 1 Topkredit 1 Stabius 1 umravnovacím 1 Tobiasen 1 Suudlus 1 úcastnují 1 Ucides 1 Trewyn 1 Vatroslavem 5 usd 1 unklbil 17 Valencií 4 Svinarove 4 Tamiasciurus 27 vandalského 2 Sympatetická 1 traxerat 1 Stínítka 1 Typflu 23 Teplého 1 Terejlis 1 stahovatelnému 3 Touškovská 2 Vatukoula 1 Ticlopidin 1 tanzanii 77 supernova 2 Trkací 1 Vápenské 1 Stirlingský 1 Trábií 1 Tautonu 2 tardo 1 Übersichtskarte 4 suššímu 1 styracifolia 1 Tropiciele 1 Tolstopyatov 1 Truschka 490 umelkyne 1 tamahagne 1 Štepáncine 1 venuval 1 uvážlivostí 1 supernabíjecka 3 Titkos 4 Süssera 8 splétá 1 Tunisská 14 trapy 4 svetonázorového 1 trísvetelná 1 Tagliolini 5 Valdický 1 Traußnitszmühle 4 Úredníky 14 Valhaly 1 Stroskotanie 1 stríkáme 2 Taruciai 1 Svätenie 6 synagogálního 2 swi 6 Turnišce 3 szcpv 7 Varšavští 2 subnormální 104 úcelovou 4 Vesteckou 194 vecírek 4 váženejší 1 tanecného 10 tamburínu 1 Trachyderastes 9 svalnatém 1 Transsylvanians 3 splavován 77 spaliny 1 Vcelarského 1 subornata 1 velikomucednice 1 štokavskými 1 Tymoshkina 1 Szemében 5 turnovskou 1 stredofrancouzskému 1 s pátým 57 Terni 1 Taikoyama 1664 udelen 3 týráno 362 Velikonocní 2 VEDECKÉ 20 Traxlera 6 Tensai 1 Turbesselského 31 Strega 16 Vanna 100 telesech 2 stotinki 1 Utheruv 9 stephen 1 sumhasliga 1 stredostavovský 1 Strokace 6 turcianské 1 strov 4 tenebrosus 3 uklidnovací 1 tacrolimus 41 validita 8 sympatictejší 33 tchangského 1 Trídený 12522 tu 1 Sussi 1 Studnový 2 spisi 1 Vašinová 3 trváme 1 Stereofotos 1 Upoutané 19 sterben 9 uhk 37 velekrále 1 Trichoptilium 6 syrakuským 46 umelcovy 1 spostranním 52 sprežením 23 stratigraficky 1 Umlaufuv 1 stužková 3 traumatizuje 3 Spojovat 17 ventilacních 1 Vešínove 2 vejírovkovité 2 s bílým 50 unikal 3 Vasjuganských 35 Šustrová 149 teplou 1 tetrafluormethanem 1 Stormberg 3 Umbarem 1 trigeminu 5 trígólové 388 UKR 23 tahá 5 Tríci 1 treponemovým 2 spalujeme 63 Šumavského 2 Sturnidoecus 1 strobolium 2 tríraménkový 2 špicce 2 Stephanowicz 175 transplantace 1 surrat 1 subregentem 1 Uzgenský 14 Telu 4 Sudického 1 stítonoš 1 Strukkampfhuk 1 Ursova 2 Uzzanese 1 Steszewského 8 standleyi 3 VADS 1 truhliky 1 Vegaea 1 uniqueID 1 ttfc 3 Trochtová 5 verkaufte 2 Sousmoulins 31 Šrámkova 1 upírovití 9 Štechovické 50 Štáb 138 spokojenost 1 válcována 2 …už 3 variegated 1 Talbots 2 Tetralin 16 Trostburg 1 Steudnera 26 uzlíku 1 Toadette 1 Vejborný 1 Užduobulis 1 s operacemi 6 Urbání 1 Tuireana 1 Streská 4 terry 1 sympodium 1 SVÉMU 8 Versigny 1 uvedem 1 Talentos 1 trictvrtehodinových 1 s pyroklastickými 12 stereofonního 14 Subtypy 2 tvrdošíjní 4 thorelii 1 Toshka 1 štedrovecerními 2 suteishi 5 svépomoci 2 Velpeau 1 tutlajícím 1 Svetlina 7 troškou 5 spolehli 100 uspeli 2 vakf 1 vercoren 1 teleßizi'o 2 Tárnyiková 650 termíny 2 Üzeyir 5 sutovisko 1 svetlušce 4 theatrum 8 Starocernsko 1 Spartas 7 Twardy 2 Teplodar 1 úzcí 1 ucte 1 Tropár 4 Teheránskou 314 spoluhráci 1 stredoproudý 1 vertepské 18 Tomar 3 stareckých 30 theatre 1 špinavejším 64 Trabzon 1 Uspavanka 3 Velbrück 1 tríminutovým 1007 válkách 35 Stálo 1 Thayú 12 Velenovi 33 Topp 3 Vaksdal 1 Susreti 10 údelníky 6 Turre 1 Umirem 1 Stredoškolskou 1 úcastným 3 Sukhorukov 35 útraty 8 Terézváros 1 Štrublovy 1 Teylerova 3 Twyfelfontein 2 Úsekem 1 trojválcovém 2 tumulte 1 vektorizaci 1 starorakouštiny 1 torkretovací 1 tradicionalizující 1 transpresí 8 Thane 2 SSSaNNS 1 Torišime 2 Stribogovi 2 Troispoux 1 srebrenické 2 surdus 1 tundrit 16 transcendentního 1 tyrannosauroidae 1 trínožkový 3 trecenta 2 Ústupová 7 tesnících 1 Talmové 1 strandem 1 Verpackungsmüll 2 Spreewaldské 2 Sturta 1 tešetickém 3 Stanicno 24 Uprky 1 sundávány 2 Steamin 1 spisok 1 ÚACH 1 turbokompoudní 2 Tsuboi 1 Traumfährte 1 spoon 1 svetlotiskovou 4 Stríšku 4 Stobaios 1 Stösselova 1 Tczów 3 strašidelnom 11 Stracovská 1 triodového 1 spiced 5 transpondéry 2 Taulignan 2 thorianit 1 ŠvýcarskoNárodní 1 Sübahnhof 4 Triconodonta 1 staronordských 4 Tecklenburg 1 souvisejícho 1 Sturmayr 4 Stejnegeruv 8 Steud 4 vegetarian 28 ucítí 1 Tauernského 1 Sziszem 1 ÚHOSu 57 Stryj 3 Vanha 1 Suermondtovi 1 tiskách 8 tretre 4 Tocha 1 thakchinu 1 taphos 1 tavvas 8 sunové 2 Sycová 2 transfázových 1 Vechtovou 59 tetrarchie 2 Ventôse 1 Thamela 1 Tagging 2 Šumburské 2 tichej 2 terebinthinae 4 Tornjak 1 trágico 97 Václavov 139 tolika 18 Vassili 9 universae 1 terasovitému 6 syntázu 1 Tenglo 2 Välkommen 3 telesaci 1 také Charmatova 1 tolkienologové 2 valium 1 spectatores 1 Verkehry 25 Stranglers 1 Stanczel 11 Truus 376 telesnou 55 Sporilove 1 Ulrichsberger 31 Szymanski 14 tavného 49 štetin 2 spolklo 8 Vancurove 1 Valentinove 1 Verbong 29 UNAM 176 spermií 2 tifinar 1 Theravádový 1 Uhlobaron 1 Vacíkovití 9 STOVL 4 Sudejov 21 Tym 1 Trunde 6 tobogánu 2 svatohavelské 3 Stonetalon 1 TIRFM 3 taninovou 61 uctíváni 13 velšskými 1 Variat 1 Stonar 5 Ureho 172 vesnický 3 Unadovo 1 Thecocarpus 4 stupnujícími 6 ujednal 4 spartiaté 1 stances 1 storiografie 4 triolami 1 Sykkö 2 Trigonopleura 1 sufixálních 2 Suryo 1 Šulija 1 Šrílu 1 ušmudlaný 1 Turbánek 4 Uvažovat 2 Sunstriderem 6 spejí 18 turi 1 Varasto 1 Upnor 5 Tristar 1 strážnica 3 trifolium 35 Stánek 2 towarzystwo 1 Veikvedalis 1 Tósok 3 velurové 11 tahákem 4 Tarábková 6 vaganti 3 Varmijská 1 Spagnolli 400 Uzbekistánu 8 Šplhavci 2 Stoops 4 Šujské 3 umenim 1 thyroglossus 1 Veriety 249 strídavého 2 Thérané 1 tnen 1 Sýpku 4 Stredooceánské 3 Tazendou 3 temnosvit 1 umožunující 1 Švrcovem 1 špinavejších 19 tapiserii 25 splývaly 1 terratogenního 1 Trintignanovou 4 Usoudila 4 tchangští 1 Thrissobrycon 38 ustálen 1839 Stuttgart 1 Varleth 1 STABEX 1 Templetonovo 18 Taínu 3 SuzukiSplash 1 theorematibus 2 Tscherntschitz 1 Spolocnost 31 Souvislý 4 Tissi 3 trevírskému 1 Turcynské 1 Ujgursky 3 Verneráku 3 uprchliky 1 Turneuv 1 Staatskirche 2 váznoucími 1 Tivadara 3 Tetsuro 6 twisted 344 údolích 5 trpytivých 1 Standello 2 théna 2 termodynamickému 1 stereomagnetofon 1 upozornete 1 Surovosti 2 Telekomunikacji 1 suviyöwsä 17 Strihoruký 1 Usphazanes 1 Trunícího 92 teologickém 1 šrcení 3 Stradinské 137 Tenista 6 váženém 9 Temarim 1 Überarbeitung 6 Ukrnafta 1 Suenaga 9 vareni 3 Storsjřen 3 summity 1 Tidnum 6 Stojcov 12 Takonín 1 trichlorisokyanuráty 12 Terkelsen 2 supruga 1 Vestlund 1 trasuranu 37 Stockau 4 teroristi 3 velkorozpoctové 1 vedle Helgeandsholmen v 1 usanza 1 tathágatové 1 Tirukanámalé 1 tyhlecty 1 Uygurlar 13 Týrání 3 Sušicky 1 Tripulantes 2 spontaneum 1 Uramfit 4 stene 28 THQ 12 Srdcovky 1 Svate 19 Ullersdorf 2 Stolnicení 1 Sugarem 1 Takakurou 1 Trollopa 2 Stavím 2 Vališové 1 Subjectivité 1 S podobnou 1 Udalski 1 Tagmadertu 1 Tluppa 8 stržích 1 Tokerau 3 TBV 1 tuntong 3 Tavené 8 sulphureus 26 Ucayali 25 Supercross 1 s práním 3 Strhovací 8 titanosauru 1 upušteném 23 studovnu 1 Standing 1 Tauscheria 1 úzkokorozchodných 202 souviselo 2 Tanozom 1 Transamerican 1 Stooping 1 staronordických 5 Tipeckem 1 splynutým 1 souperního 1 stríbrošedém 110 tycemi 12 staroliberální 1 Spremna 1 trpaslící 4 Svák 1 strojema 1 stanovité 2 Sutjiadi 65 Treking 1 tenbu 29 Tážaly 1 studanky 1 UnauthorisedUserException 6 Trachelium 3089 tlak 1 Spiridonovobudské 1 Spasska 3 Tukuv 1 Švermovka 5 ussurijští 1 Svetík 4 tefrit 1 Uttu 3 srdcového 2 Suverena 1 Tolmerem 3 ulevily 5 stavivo 11 Tacomou 3 Trnový 29 ultrazvuková 1 tisrokuv 2 Toncar 4 Thornhillem 5 úzkostným 2 UNIR 8 Vértesszolos 1 Subterrel 1 vandposten 13 Valentiniána 3 ښteckou 1 Teoretickými 3 Teoría 5 ubuntu 4 Urea 1 udelanými 1 Thog 1 Tarnawatka 4 Tipsarevicovi 2 tradendis 4 teplosmennou 1 Stirnemannové 111 Trnky 16 tklivý 62 urcovány 1 száz 2 Turmsem 1 Stüdlovi 1 Troublemaking 1 Svetmodelek 10 Théodenovi 2 TOGNER 78 védské 1 Svitace 6 Ulitsa 1 spolecenskovedními 150 úcastnící 6 Turesson 1 unamquamque 1 Utonou 2 vehicles 4 vaju 1 Trhavé 1 stloukal 3 Sviadnove 2 Ülker 1 thalidomidového 1 Suessionu 3 Šrávastí 1 Vaganerum 15 tetracykliny 7 unge 18 uch 3 Tanfani 1 Vecnoje 1 uzivatelskerecenze 2 Tiritofola 2 Szponder 7 talentovanému 28 vector 4 Svijažsk 1 spájela 8 Stevenu 1 Surikovuv 2 susan 3 Ultrabook 1 svazijskými 5 tratto 2 stredofrancouzské 3 Trondhjems 1 štetinatce 1 transgenderovém 1 studovati 2 UKSK 1 splanchnicky 3 umístnil 1 SYSMIN 1 stratosférickou 26 spektroskopické 1 Tuskers 5 svat 8 úsporném 3 Thrasea 1 valárního 2 tatíka 1 Ulská 1 Verdekem 11 uverejneného 1 Stuchlou 1 stredotónovému 2 umenímilovných 2 traverzu 1 Taoth 2 Tourtrol 2 Tritschlerová 1 tuld 4 Togrul 2 Urbine 77 Sterne 3 topických 1 Vangolovská 1 Terveluv 1 s úcastí 2 umenovedu 1 Unnan 11 Troyerstein 2 Ušna 1 TEOR 3 útocnosti 21 Venetové 1 Telce 1 VERTS 3 Stra 3 Teirmu 2600 úcinky 1 Trassenarchäologie 1 studének 1 Stronski 31 úzkostná 1 unbinililnatého 3 Súrjavarman 1 trying 3 Taxany 4 Taliskeru 1 twardy 24 Turco 1 Vetchá 4 spravili 1 Verbóc 3 trnobrichých 1 technologiceskaja 1 tucanorum 1 Vátsjájanove 1 Tiagem 1 Szépvölgy 1 straníckej 4 springfieldský 1 Talvborđ 1 trnáci 25 UDA 15 TOEI 41 velkoprevor 48 Tanecníci 2 Urešová 7 Tleilaxanum 18 Tcheuméová 9 veslovat 7 Vatad 1 Svobodin 2 Stomie 4 Tíwanaku 5 superdelo 1 Typhoonech 1 sourde 1 uzemena 18 Stehno 1 Svetlin 13 Tayna 1 Torente 1 Teišicuron 1 sukovníku 1 universitire 4 Stupeur 8 stiskli 1 Trmalem 2 Sů 1 Usterberg 3 Tsujimura 1 Vaccaniho 163 usazení 1 svatokoruna 1 Talmai 17 svarovanou 2 tancovat 1 Tenenbaumovou 1 teheránskou 1 Špýcharem 1 Teucrio 35 Špejcharu 1 Stierfelsen 1 ubírá… 3 Surakatovová 11 sylvín 1 spontáním 3 Unileveru 1 Susquehanncockové 1 transkeiských 4 Tapešovo 2 topiramát 5 SYMPHONY 1 Tschestlitz 2 Tranzschel 2 Tarteletta 3 torpédovat 5 Szomolányi 3 spamboty 7 Stádia 1 Suatozlav 1 Šuvarem 1 Úcastenství 2 štipec 1 Trebijano 6 špinaví 1 suster 1 stromolidi 20 Tacho 2 veroukám 2 Unichem 3 Strasserových 1 Vansa 8 telekomunikacními 1 Titogradské 12 striptýz 6 ultrajemné 9 Tshabalala 1 Teepleit 1 Steigem 3 Twinwill 1 Tawwab 1 s CD 22 Tartas 1 Tartéssem 2742 stezka 4 vchodum 1 TANAGHO 2 Špackum 2 Starway 2 Tung 9 Spojnicí 3 Vachaty 1 Storry 1 STIVÍN 1 Tazendskou 1 Tuei 2 utažských 1 sposobie 1 Stelmuže 1 syllabu 2 verzweifelt 1 Šukajeva 7 tepaná 26 Velmistrem 3 Valeriin 5 Traktat 8 Spolane 3 Straga 4 Teurthéville 11 uchlácholit 2 transsylvanicus 7 úhlavnímu 5 Valchování 1 Unterpertholz 4 stupnována 3 subretní 1 tríhlas 58 statecného 1 Suppana 3 Velki 1 superzralou 7 teddy 1 Spearmanovu 1 Turmuhr 1 Triumphale 2 Vadja 1 vanha 26 Uvolnené 6 textarsky 31 Tridentském 1 Strážkovickým 2 tricátky 1 Trett 3 tkacími 1 Spekter 3 trampskými 1 spríznencu 28 umývac 582 standardu 28 Vaším 1 Spielmusik 28 tenkostenných 1 specularius 3 uložište 10 Sturnidae 1 tournamentu 11 transportovali 48 sve 1 uhnívaly 1 Upe 2 vesela 20 Tinguely 3 vejprnická 9 Velene 1 Titman 26 Titu 18 Valentar 53 Sphaerosoma 1 Torrensovou 1 SPIS 736 typickou 2 tvorbách 6 Urmia 1 trulhřyghda 1 Tanagry 2 Správcovskou 1 Tetonského 17 Sturckow 6 úlevách 7 Spinoly 2 Venujme 1 Trahisons 405 Varu 1 sze 1 Vachem 2 spravní 1 tubetejka 2 Tridib 1 tehejšího 1 tmavošedozelené 2 tethyde 219 tribunálu 6 sucre 3 stríhány 1 Ugrekelidze 1 Theilkuhla 1 stlacenin 2 trískovém 2 stopinj 4 Teergang 1 ÚHKT 1 Tetracycline 2 Štocka 5 spolcovací 9 Stydlivého 1 Tögrög 7 Vavrina 180 strojního 1 Subírov 1 tankistka 1 Turawou 12 válením 6 Vercauteren 12 udavace 5 umelecký 4 Vetteru 2 TRAVEL 1 Státotvorným 6 Trasimeno 2 umrlcím 4 uspechu 1 Temm 2 Tjekkisk 85 Veitmile 1 Toužimskem 1 urvanou 2 Velkostatky 1 Uskem 2 Ternt 11 Strikemaster 1 uballitovou 1 vdekjeprurëse 1 Veiviseren 1 Suivre 1 Stamplera 1 Verroia 11 travinobylinných 1 stygge 12 Theiler 2 Tornionjoki 1 vápenátého 2 trichlorethen 2 Vetustissimus 11 velikostních 7 strídáni 1 vcelnicích 2 tonometrií 1 stranickoorganizacní 2 Šulekova 261 Tiberias 5 Tenkl 1 varóv 2 Upíru 33 venkovem 3 Tansi 1 Utrpeným 9 Swansonova 2 Týblová 12 trílodní 1 Umblu 2 TVARKu 1 stratoskop 1 ufjf 70 Valdek 2 Suq 3 Strasburger 1 Spirkin 15 Travniku 2 Tetzner 1 Turdoschin 1 Stechimio 1 Taruhito 1 Surutkou 1 šterbinového 7 triumviry 6 Verdonský 17 Symoné 1 vagales 4 Šusteršice 1 Vesturbćr 3 Starbeam 1 Thebisberg 1 Spiezské 1 Untersuchungshaft 1 Sovala 1 Tendrovská 1 unbewaffneter 2 usmev 4 Spoink 20 Uzijahu 1 Uojcze 5 Trencavelové 2 Steindluv 1 tonilloret 1 superlabelu 1 Unterturmführer 5 telc 3 Štollem 8 Trebícko 1 trampas 15 Úr 9 Stavitelské 6 Tréluyer 1 thewhiskyguide 1 Stibioniobit 1 tontos 16 Sybaris 1 ulicnická 1 Sveradov 1 tkový 9 Türkmenbasy 1 Stahlbergová 1 Tusk — 1 Thoosidae 1 Stahlwerksymphonie 1 Tändeleien 1 Tríd 18 Tomáse 1 Tlesko 1 Štauderovy 1 strádanou 1 Trebechovicím 1 uhlovite 1 Superbes 5 ubíhajícími 8 Štetínského 1 Specetení 4 u nás 433 uskutecnily 8 Svátka 21 Sughd 1 tricarinata 13 Tester 3 titánu 1 umyt 1 Spiesertor 2 Thedoricha 1 utržíce 3 Toužínské 1 Starwoodu 2 tref 1 spoluuvádela 4 subsidenci 6 spletena 103 Symfonického 4 Tigger 1 Speil 2 Truguet 1 spolcene 3 TACK 1 turbijjon 9 úkazum 12 Teruo 1 verbírských 1 stephanon 1 tyzikální 4 Topalovovi 106 Tching 33 trávícího 1 UDSA 8 urychlenými 1 Strelcuk 1 udržená 11 Trp 1 Ulánbátár 3 útulkum 1 Sytrusu 1 vanickovou 1 ÚPSG 970 stanovena 2 Trescore 1 subthalamu 1 standu 38 technology 2 s prvním 2 Ukrainischen 1 spôsobené 2 Suvorovova 2 Testudinaria 25 Superba 2 tríciferné 15 Vespula 1 spácum 61 ulica 1 Verpflichtung 1 Tyttlova 1 Tokarcík 7 Tähan 25 ucedníkum 1 Thethu 1 Tertullianem 6 Tiercé 4 Transmutation 3 stancích 2 Touchback 12 spotrebitelskou 1 Trowem 1 Toldboden 1 starobelorusu 3 Stejnokroje 16 Vander 1 umsítila 5 vesica 3 svéhlavých 3 ucpána 2 stáju 1 Theodose 2 urgován 6 syriacum 2 Taovi 1 torcular 1 umelekcou 1 Trpícovice 24 úsmevu 1 undicesima 1 šroubovitému 116 Štastné 2 tajci 1 Stalinodar 1 Vasovské 10 Valanciunas 27 Teotihuacán 2 Sterlingová 7 tvorícímu 1 übersetzet 1 valkova 18 tazateli 4 Thébaud 6 Sturnella 8 Vanbrughem 2 státotvornost 1 Trzcinska 1 spekulativností 1 themusicinitiative 1 Tigrinština 4 Starostolce 1 Štechové 1 stairway 1 tríhranných 4 Thaçiho 13 transuranem 1 Szlachecki 5 Tutajev 8 Tindemans 1 s Microsoftem 7 Štampachu 1 standartizaci 4 Táúse 11 subjunktivu 3 Uttlovou 8 Vernovi 7 Tanithem 1 stonoženku 1 Tacholf 1 švihovské 43 Valse 1 Udana 1 Tábit 29 Tissot 1 tize 2 studentát 1 srdecne-cévních 1 Tiompain 2 Tronchetem 2 UTONULÁ 1 Szögh 2 Stachyothyrsus 30 Souznení 1 Toponyme 1 Tuílem 1 themovými 3 Stojespal 1 Takashimaya 1 Unterauer 9 Telec 1 svrhnuté 1 Spastický 61 usušení 4 Treasurer 98 uživatelský 1 tonbaia 2 Téria 9 Thalheim 1 Spahice 1 symbion 1 Sunjatsenova 1 UIl 1 Ünver 1 Vermettem 1 Termokrasové 11 toreador 20 tuniku 1 Trikalsilit 11 Takizawa 1 Svobodáku 5 sysfs 1 týždeníku 3 uvažme 2 Thirlmere 66 sponzori 3 tetragonoides 1 tmavozelenohnedé 4650 úcelem 5 úchopy 1 Tonquinu 38 ukázkových 2 Stribrnka 1 transvaginálním 1 Talmühle 2 tští 13 transatlantického 1 Svrcovice 1 štetca 2 stiletem 3 transplantovaným 12 Spouštecí 1 staroasyrské 3 Thranduilovi 36 Spontini 1 Tortellier 4 ?tefle?ti 1 Sphaerosepalum 1 Vergilovu 1 strednokambrijské 6 Ultrajemné 1 tesnily 6 Tarabotti 1 Stimmate 2 Tipsportu 1 Vargasová 42 Urcitým 10 Tešínu 17 svažitý 1 transversales 1 Troerinnen 12 teh 1 Tanguayovi 27 veletoku 20 umelcove 4 Survived 2 Trespoux 1 Stiansberské 50 trajektu 1 soundtrackového 1 Teilblock 1 Ukládaná 2 Thalétem 15 starorectina 1 Suicidé 1 Tequendama 35 srdcitého 1 valtínovskou 10 Tropplowitz 8 Vestin 244 Tanvald 2 tarzálního 1 Thout 1 theiofytália 1 švagrova 1 Trevisaniho 1 Thomke 1 Stachovce 1 vetronohá 1 Topografickému 30 Thiokyanatan 1 Suchenius 1 trvaru 1 turkofonnost 2 Sprangerovy 4 stredometrážních 1 Trichophorus 4 Tuntschendorf 4 Verleger 81 Tribune 1 Uvarovovi 25 Unchained 2 útéct 2 Tatomir 1 spolucestovatelem 6 Velešínská 2 Telfair 215 UJEP 19 Tripolské 7 tournois 7 suivant 2 velkouzenárství 2 Štrkoveckého 1 starochorvatský 2 spišskonovoveské 2 srpic 1 spodových 1 tríosá 1 trarrň 1 tupej 1 Tetragonální 1 vakuolizovaná 1 Stamitze 1 Sowjetrußland 56 ڞasná 1 Supports 1 Vandellos 2 transformátorový 9 Tobe 3 Tsuyama 147 strave 3 titanic 1 veratrol 2 Truchsassové 1 Stoicheiósis 1 Usd 6 sušický 1 VeriChipem 1 Usporádaností 6 stínen 35 Tety 1 Taxonomie pocátku 1 Touretteove 1 Tungova 6 tunery 5 vägens 8 starken 1 staroslovenských 1 vaginal 1 Verteieigung 2 Sternkunde 1 Uvolnovaný 1 Teresinka 1 Valldal 1 Tittova 2 Týrovicemi 6 SÚC 2 Thurstonova 25 Turnerem 1 Torquatto 7 stalinisty 4 stadiumguide 8 trenérce 1 s Milanem 7 Tunc 1 Svíbský 1 Tityem 1 Tataruk 1 stomodeálne 1 Tlapallit 1 trialový 2 svazujícímu 2 tobola 22 trpyt 1 tmelových 1 srpatkovití 1 Umbonium 1 verfénu 2 tricetiletí 1 Staney 1 švédskojazycným 3 Theodorea 4 Tromjegan 1 Terian 2 športski 1 Tormauer 6 tiers 6 stegosauri 1 spraakgebruik 3 Trifidi 1 sužováné 1 Thust 1 supergravitacních 2 Tiberillus 1 Survivre 1 Tigrios 4 Transfluthrin 2 vertelu 1 Toress 1 Spiltoir 1 stćin 3 tesnejšímu 1 Strafgericht 1 Trakiškiu 172 trojúhelníky 1 Svik 3 Sweetness 1 vedla 4 tili 65 Thanner 10 surovinová 1 Surchobu 13 sremská 1 trianaei 1 Valarómu 1 Stachou 13 sunnita 1 velikej 6 Sulov 3 Tümen 68 terestrických 2 tigecyklin 1 Uneticko 2 tenedius 1 tomhom 6 Sporožiro 1 Tósokberénd 12 Tomaová 1 veridanské 1 Tambosi 1 tornjakové 1 tius 1 Traianu 1 Symphostemon 1 Strohblumenkranz 95 usazuje 3 Spectrograph 8 syntetizovaných 3 Swedan 518 Trebišov 2 Venceslav 513 Tampa 4 ternatea 1 Strkovský 8 Tumbes 1 Tampei 1 tendrovými 2 Štampoch 1 Uboldi 14 Takahiko 1 trimenon 1 Stéle 1 tabákoví 25 stavitelná 1 SWAB 6 svícením 1 Tromsřysundské 1 Transcytosa 2 ubehnutých 1 Teoretizují 1 spía 7 Stratonice 6 tecném 1 Trubickou 1 svinovští 1 Sztacho 1 UHEREK 18 thujon 1 Szerynga 2 testovitou 4 úterních 2 Turkestánem 2 Stórafjall 1 tyrozinkinázových 5 Tlaloca 4 Vesterskov 1 Vasiljevic 38 stélku 1 verneovka 1 Valuských 1 sulaukus 1 Steinsstadir 7 tríminutové 1 Tsuyashima 2 Theg 1 trinácticlennými 1 spurgeongems 4 Sparka 1 Umarovým 45 souperce 1 Trzepowo 1 Velšupis 1 upové 1 Tairiazoume 11 valit 15 Stevu 1 Tchajpejská 1 Svinnej 2 Stodenní 8 vdech 1 spulu 4 Tescou 1 Stiegerichs 1 supplicio 1 s plnohodnotným 32 spoluzakladatelu 2 Ungrateful 9 tantiém 9 trosku 31 Velena 1 Treustädtu 1 transplantovaného 310 uvádení 1 Užtvinimas 1 Tamamschjania 2 t??i 4 uxš 4 Spooling 1 Ulverová 2 Strašácích 1 Tihani 4 traktoristou 6 vápenným 7 ŠULC 1 travelbug 16 TCA 4 Starobeloruština 1 Šušinském 16 teoreticko 2 tanaitské 10 Stisk 1 Svkvele 1 ‚Velké 470 Suché 1 švihového 7 Unifikované 2 Streibl 52 uhynou 9 ubral 1 Tahltani 1 Szentgotthárdem 40 sumou 1 tuned 1 Tailleventovi 3 Údrnicích 1 Sujtó 2 troubivé 119 Vasilije 171 suší 1 spolupacientovi 1 Vampirismus 6 Tourrettes 2 Tsou 2 Ultrametal 4 Spiss 1 Temporární 1 ‚Švejka 2 synchroniques 1 s cykly 2 stríškovou 1 Venushymne 2 strecink 1 Standesbeamte 9 spatrené 2 Stanmark 6 Tawney 71 UML 14 Tabby 1 vancouverskými 4 turbodieselový 1 trmenovou 1 Šullerovi 2 Ulihracha 5 templárskými 292 úzkosti 1 telugského 10 Theem 3 Swordmaster 1 Swedwood 2 TWH 1 Szinyelipóc 1 Tzenketiové 2 Toscanim 4 Vaher 19 Spinetti 6 Tadjier 4 Sudeley 1 substituem 1 Suetka 1 Spelet 1 Unterwolfsbach 1 Strevicnik 2 Vavreckové 5 Typhlosion 4 Velaine 1 styzenu 1 Stradovnik 3 Telemetry 3 Taillette 15 vdecila 176 sporný 1 Srcani 1 Svjatoslavovo 1 squatteru 1 Trojspreží 1 Thoriem 41 uzde 1 Trevinnius 1 Vasilijovy 1 unikiny 1 tenebra 1 Vassarem 1 Taiiciho 4 taeda 4 Štifter 6 Stepanovicem 1 Timanfaye 1 svatojánskému 276 subseteq 1 tubley 3 Táng 1 vbudována 1 Szatmára 1 tretij? 322 ustanovena 1 tercínách 1 velocimetrie 1 trídicky 14 Strevle 2 svažovaly 4 Summon 8 tatranském 11 svítícími 8 standardizacními 4 traumatizujících 2 šupátkové 3 Strassenova 1 Trasierra 1 špringršpanelové 63 Strategický 1 Thorst 1 striptýzu 1 správcovu 1 Sylbaran 74 spolupodílel 3 Uvolnit 11 Stýskání 2 Thiembronne 8 termogeneze 3 Stavar 4 Unterbootsmann 1 Suchonguv 1 Vallisoleti 4 Umožneno 2 vész 1 Teledom 2 spermacetovém 51 tramvajím 3 Tignous 3 Techovína 1 Triprim 22 Studenka 1 subvillosa 1 Tulliouv 4 tmavozelenými 1 Ššeta 1 s Rytírským 1 stravujícím 2 Štangarová 1 Syringodium 3 triethylenglykol 1 Thébaďde 1 spirits 680 trojúhelníku 7 Suteethorn 1 s jemnými 3 Strindbergovu 1 Suzukiseiji 1 TrackManii 1 termobonding 1 terepeuti 1 sveteckým 1 Tunkská 1 Tarkasem 1 Tešeticemi 1 Sternhaus 1 Thallovi 1 usmirovaly 113 Usnesení 1 Vechcio 9 ušlého 1 symbiosis 1 velkodružstva 1 Thurny 1 tentyl 18 Taoismus 1 vaišálský 1 Vasamuseet 7 Steinerovi 1 ukrivdenosti 15991 Vesnice 33 uskupeních 2 uccellare 1 Sumervuori 5 Tribuc 2 Vandeleuria 12 stredoafrický 90 správ 1 valamit 9 ultrafialová 1 uhnízdená 1 strudoval 2 tolai 1 Sulevele 45 Speyer 3 spqr 1 Topolovy 8 uklízením 4 ubourán 1 Stücken 1 tredecil 7 Sýrový 3 ucelil 1 trakarem… 1 tantalová 1 Steskal 1 Trabajan 4 Velkoveské 1 teht 2 Toodeloo 1 ukrainskiej 390 Starr 1 SRNEC 1 ucení marxismu je 2 Stichoneuron 1 Vétérans 5 terrestres 1 Taganrogském 3 Spoonerem 4 upharpoonleft 1 Tymová 10 Týkala 1 TvrzBudkov 21 Údlicích 3 Valkyria 1 ?a?ârâ 9 Staro 12 Trencianská 11 trancové 1 transmitto 1 Verfahrenstechnik 1 Suiyuan 5 Uprímný 1 Valakas 1 Spinosaura 1 Tyranosauri 1 tarou 8 Strupcic 1 tlacícím 1 Svetovidov 2066 tábor 58 strelnými 10 Thunová 2 švestkám 3 triethylamin 1 Tertaas 3 Štván 6 Techanovicích 2 spirituals 1 Turistickém 2 Tergi 2 vejírkem 67 stupnovina 4 Stanislawów 1 šturecký 1 stereogramu 2 valchári 4 Vaajakosken 1 Tlabbar 1 turnusem 15 Tokugawu 1 Tobl 1 Strandských 1 Tsukina 1 Verohodných 1 tetovské 1 Veou 1 Tronus 3 Teufelskreis 1 Stanckeho 1 Spadu 5 tamburíny 1 Urjumkan 1 Tarnovských 1 Suluktu 6 starostuv 1 Szekerese 5 Stupacky 1 tonograf 2 Vaclau 8 Sulejmanovy 2 TEAC 1 stepovalo 6 tsar 1 staweni 1 VAJZ 1 Strabus 13 tautomerie 2 umanitoba 3 Tengu 128 Turecký 896 tropických 2 valuta 6 Sveinn 1 triunfar 1 tríctvrtový 3 Tiberiada 2 Uchytily 2 Vergeroux 15 strukturována 1 Ushkvarok 2 Švábinský 6 Suresh 2 Stoppardem 2 tarotem 2 uzemnená 50 Stereum 1 Stromeyer 3 Steffenem 1 Stebbinsova 1 Valckenborcha 1 uzdravitelky 4 Tellnitz 6 vazace 41 Srbija 3 stilbenu 2 štetcová 1 Tarvainis 1 Szemrze 4 Trekker 4 Teratophoneus 4 Theodoropoulos 1 toužíc 1 Sulfotep 2 stíraní 1 Stanislavas 1 Venovací 1 ublížily 2 Stüler 1 srubky 1 Svázaná 4 Thomisidae 60 Úlohou 62 Tádž 2 Staurothele 3 Verenikin 1 trojpístová 3 Szemere 6 TENORE 14 ukotveno 2 subterraneis 1 Speel 9 Turkestánské 1 Újlacska 20 tavolník 3 TEDTalks 1 triaksioktaedry 146 trestne 1 Sušata 1 u rucního 1 S pojmem 1 tremblez 2 Vanderbiltova 3 Surjoux 1 trypanon 50 stolky 1 Únetickou 5 versio 1 tylového 4 TRIVIS 1 Ulrychovci 1 superholografu 1 tmavošedém 3 Tluksu 25 tešínském 1 Veci 726 válcu 2 Stonesiella 1 Stýbluv 7 Uhlírovou 1 Stráníka 9 Targovište 1 Varfalvi 1 subdukovaný 1 Treforem 1 VANHERPE 21 tlapách 203 upálení 2 Údolské 2 Vancé 1 Tokioki 1 tortugensis 2 Urmston 3 Tálos 1 Šumadijski 2 válecnictvím 1 útocištem 14 Tylicki 7 thar 2 uroproctodealis 40 Tantalos 2 THIOLLET 1 übervaldská 4 Tapper 5 Sportscar 6 Talosianu 66 TFT 1 Uhrického 60 Tešov 1 Strítežskému 1 Timoša 3 Télefos 1 Taveta 2 tuóchá 71 Varhanní 1 Srodkowoeuropejski 1 Tydlidum 1 terpenovými 4 Thecocoelurus 5 Vendulkou 2 Taibo 51 tykve 1 uzance 11 stal 3 sporangiem 1 Vánecka 1 Tvaroženská 3 Vénérolles 283 telesne 37 Tippett 3 Summe 7 umeni 1 tjnesperskalhota 1 Taminu 7 Sullivanové 1 Treptoplax 1 Verchnojanský 1 tufitický 6 Spezii 1 Velkolosinské 249 Ur 1 utilistické 1 Strojíny 1 sukulentu 8 Vcelíny 1 Valonem 1 STARK 1 tiebie 9 uspokojily 1 Stozlatkový 61 velkoklubu 5 štípatelné 1 veliko 1 Vermayze 1 s císarem 2 Suhrob 1 Surdeval 1 Trashbags 1 Toborzó 1 Tusí 1 Tareena 9 vagine 1 Tantalový 65 symbolum 1 studioso 49 thajská 1 Spacesuit 2 ultravakuum 1 superoxidu 1 suboxidu 2 Vampyres 2 vdecném 8 Thrush 1 Trzcianki 3522 Trenér 2 stoupou 1 Tündöklo 13 talírovou 1 Umaie 1 Vejanem 1 útlakový 3 suspectus 2 Sprungschanze 3 Storer 1 Staline 1 Tušar 1 submatici 829 Tennis 1 Subsphere 1 Uttarakhandem 1 Soussio 4 Tunisien 1 Vesninovovou 1 Tranebćr 1 Talgadem 106 Tvarožná 1 Tognerové 1 Trumpas 1 Szpotanski 73 TSV 1 Spectantia 1 Valentíkova 1 Sportovala 9 tógu 16 svépomocných 1 Staatsbürgerrechte 2 Trovaso 1 Theismann 236 stavech 1 Thopsonovu 107 teplické 508 suchý 1 Stronnistwo 23 Starohorských 5 Swidnicka 1 tarvastu 1 Varsavskeho 1 Tupinambarana 73 teple 2 statkárskému 2 Trichter 1 Toonage 1 svetlocitlivost 1 štukovýmí 1 Vasilicikov 1 starokrecanský 1 Trpitelem 13 svatyním 1 Szécsmezo 1 stáhnutém 1 SZABÓ 1 spoluvládám 2 verejnepolitického 80 Ukazatel 3 Tembo 4 Treca 3 tumultus 102 veleli 1 Upamietnienia 1 Sucheta 11 Threshold 2 supersportovním 2 Sultantepe 1079 spolku 37 vajecník 1 Trisiston 1 uchvacovacím 5 thrashcore 1 Strjama 1 Spalinowymi 1 Tratwa 1 Vartislavem 1 termoanemometr 14 Vejnar 3 Stojatý 2 taktovým 2 Tyrconnell 1 trísmerné 4 tgh 1 Tachenius 4 vedutu 1 suscitator 259 Tag 2 Vedžebten 2 Szereg 1 Torredonjimeno 11 valencními 5 Transrapidu 1 Tatíci 7 Souslovím 4 Trojánská 1 Steuartova 2 Streichholz 1 Städter 1 Turjé 1 Tribuncev 2365 turistické 1 valecskému 2 Tvarte 2 Trřnder 1 Tutkovského 1 Treib 2 veneziane 5 tefrity 1 Tátafest 2 Tidens 2 Syriaca 2 Vaindl 1 udrzitelny 4 Theosofická 10 Tribulus 1 velmist 1 Szkolnych 1 trigonomického 1 Trotuszu 1 Špotzova 1 Trolí 9 velšští 1 strýckovo 7 ukoristily 1 Tódžúró 1 Triariové 2248 svobodu 2 Vajgly 165 úcinných 18 Ústrednímu 1 Streetheart 4 Vanackere 2 svobodnej 1 Tsurui 2 Tarcil 1 tenutovým 1 Šturcovými 21 Súdánští 1 Trafiky 1 stalinuv 1 TEARS 1 Trintá 4 Veltlini 1 thorharmen 1 Svinř 1 VAJDAKITE 338 stoletím 2 Tshombé 2 Veletrhu 1 spisovatelů 1 tetrapentakontan 1 Tesemmovi 2 stucek 8 Touchdown 1 triakový 1 varidla 2 Tichákovy 1 Szczepanowska 1 šplíchá 1 Stafano 1 Steinfelduv 1 Valoise 1 Treský 1 Stonávku 1 Strzegomka 2 Trichiinae 1 Sungnyemun 906 sul 2 Strieborného 1 Tušetové 1 Storolow 11 tyrozin 3 Tysk 2 strontium 2 ursoni 2 Tokušev 8 testaceus 1 stínivost 1 torunski 11 sútrách 1 STÁL 1 spektrofotometrem 1 tympanogram 2 tató 1 verbundenen 1 Tlmacu 8 Varankin 2 Starim 2 temperovanou 1 sukcinyltransferáza 61 upresnuje 9 Tomaš 1 stadardní 1 SÝPKA 12 Tomoe 15 Vandiny 1 urediniu 1 utrimque 1 Spolumanželky 1 trojaut 1 Toolebuc 2 Troppez 4 ? 2 Tragatsch 1 Starobylost 1 Utneme 1 súvislosti 8 uhlu 16 Šura 5 vendémiaire 1 Tauntzien 1 Svatá… 1 tykadlovkovité 1 thermogenin 1 veršovcov 1 Vatatzovi 11 Teneriffe 1 Turnscrew 1 vetkáváním 2 Vaterländischen 2 teatra 6 sumárum 7 šrapnelu 7 Spolupracovalo 1 usnutími 8 vejírovitého 4 Supersmradi 1 theodosiánské 1 tenditida 11 Thersandros 1 Statick 1 Uspokojilo 4 Transdisciplinární 1 Terraferma 1 Stejstav 1 Trikotno 13 stélou 4 VCIK 1 Tabbed 2 Steimarovi 1 Vašmuciova 1 Tokáty 1 Uniformizace 1 Steckle 4 vajecnými 7 tusen 1 Uehling 5 s obcí 19 Toxicity 6 trhácích 31 težkostmi 2 stanoviste 18 tradovaný 2 Tommaseo 5 Tremešného 1 †turnagra 2 Trapistky 31 útrpného 1 Valentinianových 1 Velikolepostí 134 splynula 1 Stroggy 5 Titanii 3 Švanduv 1 Swingerhead 3 tuatara 1 Tetrapods 11 Tejral 50 stojícími 1 Taiwanskou 167 Tovaryšstva 35 Trn 14 Venga 9 Suutarinen 1 superbetto 1 Ultracentrifuga 14 Valpuržina 268 uznávají 1 Ufimskoje 37 Tarquinius 2 válcovali 1 TICHÁNEK 1 ústav… 1 Suspenzní 1 Suhopolje 52 uveznením 1 Staurojoeninidae 13 Umírání 46 správnejší 2 supíkovického 1 stouditu 2 tranzistorovému 1 Szepeskkárolyfalva 1 Stereoskopického 84 Tatínek 4 splašení 180 šterbiny 11 sporulující 2 súdy 1 tricknology 1 StaveniUSilnice 10 Suldovský 1 Suvského 2 úneticko 1 Valkynaz 1 uberblog 2 Stodolovu 1 Tararo 1 Sutong 1 Tiburzy 1 TIPE 1 Tisknuto 1 Spoluvytváret 10 spojivkou 3 Stainhauser 1 utešenky 55 svátecních 79 ústová 67 Spoluautor 3 strum 2 Tolemanu 1 trojskýho 1 Subparametru 511 štastné 35 Tejo 2 Trojbarevné 261 ujímá 53 Velkého 14 Strašnov 2 Šrídhary 36 Switchfoot 1 Sutyaginová 1 térpapír 5 Sukov 1 Synodendron 7 Svacinka 1 strappado 3 trpytivým 1 veleknežek 1 Ukáži 15 Valbuena 12 staženým 3 Vadily 2 transplantátech 3 Tarnove 5 utopickými 1 stvorivší 2 Superpuchar 1 Stachuv 1 Vetráky 4 vestníkem 1 Ticketing 20 telemetrické 11 Travní 1 stolují 1 trípalcovými 132 vápencích 3 Ureyem 2 Udílet 1 Szukam 3 Thaulow 23 Trstenické 1 Theirem 215 uvolnila 1 Sýrového 1 štatistiky 5 Taulant 1 szaibelyitem 1 teodiceu 1 Tuleškov 1 Tiswas 1 Syndacat 1 soupisovém 75 Thymus 3 triband 1 trasy Pražského 1 upleteny 1 Sudbina 1 trivializací 2 spodnoturonské 2 Tristani 1 Tuneru 8 Stoneham 4 TiP 65 Truku 1 verens 18 strucnost 2 Thoirette 2 Tiamtü 2 thyreocyt 1 VENERATIONI 2 Stiassna 1 ÚLUVu 4 twa 1 Sturmbanführer 1 Studijní´ 9 trikového 4 svetovláda 3 stínovat 4 Trajkovic 1 Turgenevským 3 Speciace 25 ventralis 1 tolerovatelnost 9 UNSIGNED 1 Vanousek 1 Taškári 2 Temnice 4 strouhách 16 Vare 2 Úsecník 2 Tilera 1 Tikkes 4 Transkanadské 3 Strašlivé 14 tajena 12 sprátelený 1 supplemento 1 trískne 7 teamy 2 urceností 1 Verlaqueových 1 Verdick 3 Ubem 4 Udelená 25 ucpává 4 SSPE 1 Tetrahydrofolát 1 timúrovskou 4 Swiatek 3 Splendiano 2 Sremskim 1 spravelivý 2 Vanderlyn 1 tnet 1 sumatránka 74 soupravách 4 Tuneová 2 Tuuka 1 tibeticum 3 stopkovitou 21 teroristu 15 Templár 1 Stomatochone 2 Väljaotsa 76 stredou 5 SYD 1 technol 2 Štauber 10 staletého 1 Traxalem 1 Teihu 5 Typhlopidae 1 stagione 1 velezrádná 6 Taeuber 8 Vendl 19 spartakiád 3 Strhané 4 springfieldská 2 Túrovce 1 Uitsaaikorporasie 1 spinigerum 604 symbolu 16 stonkové 1 SPTS 1 Stovingtonu 1 turpia 6 Vernovic 1 tungu 2 Talafúsa 2 vážne 1 Twintail 1 TUTKA 1 s lidskými 4 terras 3 tatíckem 5 transmutacní 1 Tudelu 9 Tríbarevný 1 tržil 7 steru 1 Tarmaširin 1 Titogradská 6 UAT 1 Szegedský 26 Tercem 10 symbioticky 2 Stranglehold 1 Udžikacua 22 tresem 8 trubcí 1 Umhau 1 Tőugussaarského 7 Umbral 2 Takáts 1 Tlúk 20 Svatost 11 tucnákum 54 Tenhle 897 uzavrít 2 Theresiopolis 7 Tre 4 tatranskými 1 Tild 1 Spoluvynálezci 1 Strusievici 1 stíni 2 trávníkovou 1 Utáhne 5 Tebi 1 švamberském 1 Tripucky 4 Universities 28 utrakvisté 1 sparsetka 4 stigmatizováni 2 Tápající 6 Tekomárie 1 strelíciovité 1 Stocklinovými 2 TextEdit 1 Spirálkou 1 težkoatletickém 1 SuperVáclavov 1 Tim Story 114 transeptu 10 suspendovaný 1 Tripolskou 1 Tortkara 11 Tresov 1 svornou 1 Trabzonští 1 taref 1 Superstes 5 Sušící 85 spouštecí 35 šuang 135 staronemeckého 3 Trávní 4 tubulosa 3 Válcoven 1 Sweyhat 20 Topla 1 Sportsklub 11 velkokališná 1 tanatofobií 1 uvedomení 1 Trevoho 1 Tolypeutinae 2 Ulitz 2 svetlešedého 7 Trivento 1 Svarome 1 Speranským 4 tricetinásobne 2 starobrnenská 6 velkosériová 1 thermophilum 17 Trkmanky 2 Started 2 Tormey 6 štítí 16 vavrínem 36 Stavový 18 Tide 1 Suchánek stavebne 5 Timurem 3 TOG 1 Tikiri 1 Tuia 1 spills 1 Steyermarkina 1 Suyá 3 varroáza 1 Uthred 2 Szigetmonostor 24 stock 1 vaclavu 1 Trudelia 9 traghetto 4 Taurisky 1 Stenothyrsus 1 tonneru 2 Statu 2 Tralflotovec 2 štamgastum 2 Southendské 2 Tuzenbacha 2 Thilleux 39 stíhackou 1 váljak 322 úradech 1 Vahide 202 Teil 16 stolickami 2 velkobasový 1 transplantacním 1 Testimoniorum 1 STYROL 2 Transfuzní 1 Thorlichena 8 trollum 9 sušen 1 Stumbeckovy 38 svažité 9 Talil 1 Sozat 2 Tegových 1 tykadlovými 24 staroslovenský 2 Tenedu 8 upozadeny 3 Starquake 4 tcheka 4 Štepánkových 59 strážnice 3 Špálovy 1 Varte 1 Šporkových 5153 veci 188 srbským 1 tyrozinázy 1 Vama 1 Spengly 4 Spencerove 1 Szuhó 1 trepetal 23 Teolog 1 uzavru 4 Uemuraová 1 StopTTIP 1 Streatfeild 2 Vehlasní 3 Spády 1 vänder 1 sternopericardiacum 6 Trumanovou 53 Strediskem 2 Vet 1 Vedega 2 spoluautorských 193 Štýrského 1 veternosa 1 tatemono 1 talolle 1 upgradování 1 Suttnerem 1 Štyridsat 4 štavelu 4 starofrancouzštiny 1 vadlo 4 ÚPD 2 Uredd 1 Terky 2 Svetlíka 2 s rustem 1 Steinheilových 66 venezuelské 9 Vachouška 1 tuskallisen 1 synotu 20 Vertonghen 3 Tjun 4 Thajkou 1 svihov 1 tétu 65 Suzy 1 Vesien 1 universitato 5 Taddea 1 stromech… 1 Uppdraget 1 Toutatise 1 Velše 4 Taliánský 8 transmisivní 1 SubEthaEdit 3 S ním 1 Termofyzikálne 4 termostatu 1 Vásárosdombó 1 TURANDOT 1 Tartessonu 1 theballisround 222 štítky 1 spoluregenty 1 Urbandictionary 31 Tuniské 1 Teutoburgerwald 4 Velomobil 1 Strídaní 1 terizinosauridního 3 Trulyho 2 tetrachloridu 1 Tieteberga 7 uštknut 1 vdaka 1 uFluids 5 šplhavec 1 trámave 3 Tolentinskému 4 Stojev 6 Supercar 16 Testamenti 14 Vedlice 2 Trackmanii 2 štírech 5 Uitertová 2 strážily 27 Spîrleaová 2 Stluková 1 Trimates 2 Vatetchethor 1 Sparkling 1 vajnošskou 1 Spangupis 23 Theofila 2 Teliga 1 S turínským 1 Superstimulátpr 3 TCAS 1 Štolbovi 163 Temže 1 spargenii 2 Úmyselné 1 Stiphrosoma 1 travinou 16 Valcic 41 vcelím 1 štety 1 Trendový 1 spocívá 1 Sozontovyce 13 trojsecné 1 Tramtaum 4 s rozhlasem 2 Váchovi 1 Šuvu 1 týmemem 2 Stavebná 4 tmavezelenou 10 Sumitomo 3 strausii 210 vejcích 1 Uhliar 12 Tokaje 1 Tahuantinsuyo 1 Turrilites 215 úspeších 1 Taglang 1 Telecopier 19 validity 3 Verwaltungspolizei 1 Ueberlegungen 10 strážníkovi 1 teckský 510 touhy 1 toxoalergický 1 Šulhov 2 Tondano 1 TUHBO 10 synonymiky 1 Tiefbauschacht 5 Valjalská 2 Standardpanzer 1 tvorcem 3 trimethylpentanu 1 traumatofobii 1 Tehiezela 6 SZA 1 Uderilo 5 uvedte 1 Strazzulla 1 spolupoutníky 1 Ulebach 1 sytuacji 1 Stratifie 1359 svetem 60 stalinské 1 teddou 5 Startování 3 Strycker 1 tabularium 5552 verejnosti 1 Straecheho 93 takzvaní 8 soužit 1 Šupinatý 1 Trompu 68 spoluzakladatele 1 Touretem 7 Tenebrionidae 1 Strenuella 2 Tortová 58 uklízecka 1 switchery 1 valósággal 1 svetloplachá 2 Tormentilla 9 svara 1 Sylmore 1 Užitným 1 vekuroniumbromidu 81 ústavoverných 1 SPeeDY 1 sur?m 2 Tlumacovská 1 Varhaníka 4 Svetlovu 15 Tormesu 2 Strakka 1 Stiburus 5 tuvinského 1 …Vesnice 1 Stežejkový 4 urcíte 1 Sunström 3 UNDONE 3 Tremšínu 2 sportovištím 2 Tethysu 17 Ussherova 1 Techova 4 teeth 1 Teplovzdorné 5 Ubik 2 Tuanake 1 sthenos 30 Týništi 1 Tamorinými 2 Univyc 1 Verticillatae 1 spráskání 1 svestka 1 subdiakoni 8 století… 2 Taša 2 Supola 1 Vadím 6 špatností 4 vetrají 1 théophilanthropes 3 Steinhäuser 1 Svidnice 3 triplit 15 Stuttgartem 1 textologických 6 tavená 2 teneramente 1 Stohodinová 119 ventilace 2 Vacherie 1 stutárne 878 spolecenstva 1 Vaidišovovou 2 Tude 1 Stracheyem 3 ڞicích 2 Tejcek 1 Tadahiko 2 üi 5 Trenchant 2 Südeuropa 2 Ternynck 1 sprechgesangu 3 Týdeovi 1 tarimdži 1 Tronem 9 utero 4 Universitätsbuchhandlung 2 Veselte 29 verifikaci 14 stammtafeln 4 Uvezl 2 vábnicka 8 tasemnicí 11 Usámou 25 Trískolupy 1 Storbynu 28 srážejí 1 subkapsulárními 2 VeVe 1 umožnovaný 3 thilleru 2 Vermögensberatung 1 šterkopíscitou 5 Ufské 1 Tarnak 3 trístranných 5 verejí 2 Šterbinovky 1 SSADM 14 SPŠE 15 sten 6 sunnu 1 Szulyóváralja 1 Štrompf 3 Triclinium 1 Tent 4 Soustredená 1 Svolávání 1 úpravabokolí 1 Validaci 71 strojírenském 2 Uraniidae 1 styda 1 Ugaldová 4 Teplicich 726 umožneno 1 Tarab 1 Umlcme 4 svetoobcan 2 Trifecta 4 transkriptázu 13 toxictejší 1 Tykocina 1 swobodae 2 Strobily 14 Spoluautorem 23 Tocharové 515 ujala 1 týkve 2 Tyee 1 Vajoletpass 1 Valujev 1 Soykovy 1 stamnoi 1 sursurunga 8 Ufo 1 triratnam 1 tenoucký 1 sulfatován 1 Totenkopfovo 1 Thirin 2 TELE 1 Squentz 20 Tigery 2 Valleé 25 Soziologie 1 usporádalu 1 Sterndahlu 1 Supuringufírudo 45 svobodomyslná 1 Taissja 2 Uchaud 2 Statton 5 TFIIF 1 Stanojcevovi 4 Vellerot 1 variovanými 4 spektrometrická 1 terranští 2 utich 1 Starostínský 1 Spangdahlen 1 vetkávána 1 Ultralet 13 Tropea 9 tumbou 245 Trencíne 1 Šturmovík 1 tBuOH 1 Surinka 1 tuneláru 1 Trativodná 5 tsg 5 szék 1 tapetový 2 Útlovláskovité 2 Tassenberku 1 Sympatrický 1 Uvšech 2 URC 2 Tinternu 3 Trampský 1 SportLife 1 VERNÉ 2 Storojenko 2 TVW 6 Stínadelské 1 starum 124 Studénky 2 trídimenzionálním 7 tamburem 1 tibiofibulares 1 Stali 1 Stanela 1 vaterländischer 2 Tenseyová 2 Sundbyberg 14031 Velké 1 tranféru 1 szurkowski 1 Vajnerovy 1 superiore 1 Stretával 8 Travestie 1 vasis 2 Strahd 2 Taden 1 tribunovým 3 ukáznenejší 1 umelými… 1 Vedžó 1 Suloinen 27 tlapami 1 subterminálne 7 spleštule 2 Timantovi 8 strelovitou 5 trojvrším 1 Tricholepis 1 trubickovými 1 TLCS 54 veritelem 1 urzonu 1 Urlaeva 5 taktované 2 spasmolytickým 1 svedecná 1 spessartu 4 Thurstonuv 7 svatoštepánská 1 Tirosh 1 Struníkem 1 staparský 2 svrchnejší 7 stínit 3 Stafrace 47 strojová 1 Unkut 1 Spicilčge 1 Swietokrzyska 34 ustupujících 1 Suchodól 3 Tisenhusenu 1 Valoptecu 7 Sugarloaf 2 Strihavku 4 Uhlomost 1 Todennäköisyysteoria 1 Spálila 1 Versailském 1 Teodul 1 Strohdiek 1 Telghet 3 srácu 9 tonometry 1 Tacivem 4 Vasicek 1 Stinkymu 1 Strawhat 3 velmocenským 1 Tosarem 1 spoucívá 1 Stockalper 3 tuneluješ 6 Tarsier 1 Trebetického 3 usmernovaly 1 tecza 5 velmistrum 1 ulevoval 133 Venkow 1 swinie 1 Totenkapelle 30 štýrská 42 štafetách 9 Tema 2 synergickému 1 suliti 1 Užockému 1 Sulieman 2 strepinového 4 Sufficiently 7 štychu 163 Turin 3 Tabanidae 6 TiNbTa 2 Štikovský 1 Tuchlin 1 Teodóra 3 vakuometr 1 Tehas 85 soutesku 3 trmickému 8 ultranacionalistické 1 Teenou 13 Svatebcané 33 Thelonious 2 Tigurinové 1 svárícími 1 Tytgat 2 Tassaert 16 vakoveverka 1 Triebitz 1 stárkovská 4 tetrathionan 1 turnusovány 1 úctyhodnosti 1 stiskovými 13 subkulturách 7 torontský 3 Trauermarsch 1 UŽITECNÉ 45 tramvajovými 1 Vestrae 1 ThU 1 synthetizace 1 utilitaristického 1 Turaidou 7 uprednostnením 1 strídáme 1 Sporicz 1 Teato 8 subcordata 3 Stipem 2 tobemoritu 1 Štástková 3 trien 2 štokování 1 Ustaly 1 tesnina 2 talento 1 Vénitienne 1 Strawa 126 tenistu 1 Tharaconta 1 Urbanitatis 1 Svaljavského 1 úsekWashington 10 ukazovátko 1 Trilepisium 8 universitami 1 tirannus 4 svete… 3 theórie 1 transhumanista 6 Verteuil 1 suniity 10 Utišující 1 Tostesson 3 unsre 1 Stevensonovy 6 Trojkrídlý 7 Trebnic 9 šroubovou 1 udržovacímu 3 Tháp 68 Specializované 349 Spojeným 2 štavelem 3 Tešou 1 s divákem 4 trístupnovém 1 trachycarpus 9 svoláván 2 souteží 7 tankovacími 5 speciálum 34 Tuaregové 2 Uljanovském 1 Toomkool 3 Usages 2 Sriwanichpoom 1 swiatlopisania 2 Taisko 1 Studentenkurier 1 Terranské 1 Upilovaná 1 Tempelmanem 1 trírocního 3 Szalkai 153 útocili 7 Vašinky 2 trojboje 1 straseci 1 Tvrdolistý 1 toufu 12 Turda 1188 svazku 3 urceolata 1 studnický 1 subtilia 1 velkoobjemová 1 TRIDCATINA 1 s životním 15 Toaleta 2 urážejících 1 Srževica 5 termometrie 2 Thére 8 Ténéré 1 Tegetthof 30 ublíženo 5 Stolowe 2 trípilírová 1 Theleniusovi 1 Talaudské 4 spotrebište 7 Tantura 6 Šulajová 2 Sved 1 Strastiplná 1 Turkutaských 3 Unterschöllenbach 1 theóse 1 Tríkrálovým 116 Šusta 2 tretia 1 sukham 2 Tatér 2 Tériade 1 svárilo 2 Töbring 16 Takeuci 1 Thioredoxinreduktáza 1 Strahovski jako 1 tetrahydroxyberylnatanových 1 Stampler 1 Vavriny 1 Tiériho 1 ungerührt 11 Urychlovací 10 trstnatá 4 Varnick 2 sweta 1 thyrohyoidea 1 surete 1 Taldyk 1 Todtenwald 4 Utriusque 1 VesmirWeb 117 Úredním 2 Štávu 18 Tiengen 2 Tijn 2 squad 2 sparených 1 Trautmannsdorfy 72 Srbije 2 Vekua 10 uhlák 3 Timme 33 Transrapid 8 tyf 2 vakadua 5 Squadriglie 1 Turngeschichte 1 spoluprác 2 ternstroemioides 1 Valnetis 5 stínadelského 1 súfiské 3 trínohých 1 Sydou 1 strouhátko 1 Šustrova 1 urma 1 Stohování 1 trenincích 1 s Jetrichem 11 staroruském 4 umocnili 9 templeri 1 Stillwellit 5 toList 1 utlumujících 1 subvesikální 1 Újcsanálos 2 Trnavan 2 Urbancovi 2 trifluor 2 vazum 16 trvalosti 11 spálenou 1 špickovkách 15 tenoru 1 Toramus 7 s nímž 6 spoluvydával 2 Ultimou 1 Uxtalovi 6 úsporneji 77 upomínající 3 Stroup 1 Springquell 1 uremií 6 stargate 45 strojovnu 1 uklovou 1 suavioris 20 uloženi 4 Vartry 1 sufragánnami 1 subnosné 13 topograficky 1 utlucena 11 ukázkovém 6 Superstudio 4 ummy 2 variole 1 Verschaffeltia 1 Úzkoúhlá 75 sourucenství 3 Štorkánová 1 trolleymotion 1 Tuchsu 11 Velkém 1 Sun?alláh 3 Tošem 1 unciálová 6 Svinné 13 Stánky 3 Valušiak 7 talentová 1 Talvin 4 Trebecský 1 stuttorv 1 Štefkovi 1 trímístnéhop 2 Urich 22 Strelnici 9 uplatnujeme 1 SyD 4 Venturu 5 Starohaklovský 3 †Thescelosaurus 8 szép 1 ugaritskou 4 Vecná 439 spolupracovali 7 TSF 14 težkopádná 116 topenište 1 Stauferuv 2 Utvrdil 2 správcem farnosti 1 Syntek 1 systolickou 10 Tarasconu 6 Vetserová 3 uraženému 1 sproštuje 2 Studeniková 6 Stench 2 Tuxpanu 2 spínala 1 tyrannosauridum 1 Stygg 2 Vergéruse 3 trailstezka 1 svatomucedníka 1 Tergolape 8 tuhová 28 staroegyptská 88 tankeru 4 Tlhoko 1 Uspokojující 2 verfasster 6 Tmavohnedá 2 Stoparem 54 spalující 7 Tanizaki 1 staroturectiny 1 Usouvztažnovací 3 Svetlomilný 1 summorum 1 španelských 3 Spadovo 16 vanilku 78 stolování 27 Vestfálské 1 Sver 1 subreddit 2 Stávání 1 Torquesy 6 Tokare 1 Vagonmaš 1 s Tancícím 1 subsidencních 1 superhdinu 1 Telegraphem 1 Stríbrníci 11 trubní 2 Sterea 29 Trencínského 1 Vadnou 1 Thornby 6 Tarantík 141 stadión 8 Thoroughly 14 Trezor 2 Sudici 1 trainigový 1 Upd 2 Topmodelka 1 Valdštýnovi 4 úhlovému 1 úcastníkom 1 šourkového 1 Tošnerovou 1 unáhleností 3 svetlovod 1 Tektronics 1 Touškuv 38 Supremes 1 Vallierové 1 svetloyar 1 Thyeste 1 Szolcsány 2 veste 1 Traubové 1 tokoferolacetát 37 Valli 1 Tesme 5 Talanowa 69 úrodnost 21 Traunu 1 Transilvánii 10 Tostăo 5 stríbrití 7 tocharské 1 Textum 5 triterpenu 1 Ucpaná 6 Toska 6 tetovacím 19 telomer 1 tripugionacantha 1 Toplusu 213 Spisy 2 Suffolkem 1 Svahovité 1 Sukkulentenk 1 splynutými 10 Sugihara 3 stretnutí 1 s ctyrnápravovými 184 Trnavy 6 teatronu 6 stupu 1 Talgut 16 Turingove 2 Urrasané 1 stlpce 3 stabilis 17 Suluské 2 Trattenegg 1 Ssk 1 stomatitide 104 stromek 7 týmovému 17 verte 25 uvadec 29 strukturován 10 varnsdorfský 2 Supermodels 1 süßes 2 Triennal 9 Sunnitský 21 tesneji 1 Šulákove 1 Suvským 1 Treskutou 7 urputným 1 Thalea 7 šperkari 1 turtoni 1 Strory 2 Spamy 8 Speg 1 Thevenet 1 Sprogis 76 Syringa 4 Štorkána 1 SPEL 7 Souticích 2 strižna 59 Varšavském 1 Trestuhodný 3 tournante 1 topspinový 4 Sulamith 1 Uhtreda 31 Valls 1 Ubavic 2 Sulzberguv 1 Trojen 1 Steklovuv 1 tortille 3 Syranka 1 Vakinisisaony 18 Spitzera 7 vesicae 35 Tuhé 3 Velšském 1 Velehrach 11 Tabulkový 1 Varecky 1 tuäraid 4 Tranzschelia 28 úcinnému 4 Thies 1 twistových 1 spichována 1 Talamo 14 trojdílným 1 Telegraphie 21 Tse 1 Szláv 3 Spreyopithecus 1 trochanterem 2 Vejtopa 1 subtesty 1 Štemberkové 1 tegyél 70 supina 1 Vejraška 1 ??úpravy 1 Valfre 11 Teganissorens 1 Urovnaná 2 Vedosloví 1 tápajúcich 1 Špornová 4 vanitatis 1 Stedeford 4 Strachkvase 4 trojcetnou 1 Stahujete 8 Tiwi 1 Vámosújfalu 4 svatoondrejsko 4 udiví 1 Tilti 1 Theutburga 1 stopadesátitunové 5 svatojakubského 2 Tragoedie 1 Standera 1 Tobbym 367 Vchod 79 treska 1 Vajícku 171 track 15 údu 1 Termalice 1 Th?o 2 Spolknuté 5 startéry 1 vážne… 5 Tubertus 1 Šubicem 1 stošestileté 3 Velechvínem 3 Tristranovi 1 syringu 3 stoupáme 26 Soused 1 Uršulinka 428 tocí 13 strede 82 Swanson 1 Strite 2 Sunglow 2 štítníku 2 suturami 8 Spets 1 spolupráci mezi Tretí 4 Titon 1 Tristramit 2 Turako 2 Tattenitz 2 spádným 2 Thákurových 4 termickém 2 umazání 4 Valujki 12 spratek 1 tacens 2 Téme 15 spanilou 1 Vásefí 2 Uzovského 1 Transpluto 1 Sunmodule 3 Stávali 2 TARPu 13 Tylži 1 s doplnkovou 1 Tzennetakisuv 4 transsexualite 7 Tiberiove 88 strucná 1 TECNAM 1 verbenaca 1 Uvízlé 251 tísni 1 tvorril 1 stingeru 6 Stainach 1 tiventilový 2 užijte 100 trendem 196 systémum 8 Tuxtly 1 spaceru 46 trhavin 1 subsidiaritou 1 Tsygitsa 1 ukoj 1 Tojoduv 1 Uhajmir 198 ustavujícím 3 tácky 1 tiliarin 2 Venustus 1 unerwartete 2 usmernovacího 1 Šumavabus 1 Spanilou 8 StS 17 univerzálnímu 2 Veitmíle 2 úsekovém 2 Tesin 2 Tomašovovou 3 varhanického 1 Temetvény 1 tanha 1 UÇPMB 1 syenogabro 1 Turženai 6 svémocne 1 Tržestitz 23 stepokur 1 Thordarsenem 1 Velebím 3 stévií 1 Tingzhu 2 Vernieru 2 Sturzenegger 17 švagrovství 6 spešnými 5 Tomel 1 SPORITELNA 1 Sounesse 2 veselit 41 Strážky 1 tonoius 2 Tagsdorf 1 Tapolybánya 6 Svámi 12 Tríleté 1 velbert 1 travetinu 26 Spolkovém 6 Stances 16 Tęt 4 Udáneský 1 tvoriti 3 Tschenstochau 51 syrským 1 túlale 4 syntáz 14 subprovincií 1 Spento 1 trimetrová 1 uzancní 1 Spielzeugland 4 Ticinu 2 tmavozeleného 1 utrhnuta 2 Stappord 7 Valbrišských 2045 urcit 6 Tetrívek 2 tajacu 37 Spinosaurus 2 Vehlovská 1 s vyšší 227 Tabule 1 Tamestit 12 Spasitelem 1 Ultrakonzervativní 1 Trczka 1 Tyrconnellu 4 Streisandovou 6 stredoafrických 2 Tanglewilde 1 Teokracii 1 Uckul 227 umísteného 1 théravádský 13 Šustov 3 uznatelnost 1 valutových 2 sycivým 1 Steedová 21 Ventre 1 Traktus 2 Stourtonu 1 Temperamenta 1 texasského 1 sulfochlorace 1 tauej 5 upravovací 3 Stepanovna 11 štenátka 1 spoluobvinený 2 Submarino 5 Temporál 41 Strindberga 1 spomenice 1 Superchameleon 2 Tomuhle 1 Uživatelskému 16 Uhrina 1 vaznicemi 5 Stojanka 4 tobi 1 Stoneovými 2 Veela 25 Srovnej 7 Striuna 1 Suvaro 1 Vebris 530 spektrální 1 Üblhöra 64 Thákura 14 TUBE 5 staroutrakvisty 1 tumšuctina 1 Suburru 1 usiadzie 90 tornáda 2 Tracheje 1 Thyle 1 telemarky 1 torte 2 vetonské 1 Štajnerka 9 symphonie 1 šveholí 36 Stockwell 1 Telalim 2 Tagb 3 Sternea 1 Tjřtafossen 5 udírnou 2 Tylorova 1 Triclinio 244 Ukrajincu 62 Vergne 14 vchodovému 4 TMDS 3 Supersense 1 Suessionensis 1 Taai 2 sunuly 6 Tian 1 transice 37 transliteraci 1 Udrupisu 1 Taju 1 verdi 1 Tichodil 1 Storrolduv 19 Svícková 32 Theodorakis 1 topeny 1 s podélne 12049 veku 3 strunovcu 2 UMoria 1 Uastyrdží 1 Stréblovým 10 substitut 27 Tylová 1 veen 3 Underwooda 1 Stadtallendorfu 1 uierda 2 stratených 1 Umac 1 ‚veda 41 Surface 1 souvisesjící 1 Treideln 1 Tokapo 1 Syntézní 1 strobilodromofobie 2 Stalingradci 35 Tuly 1 usmlouvali 69 textura 2 uzamykaly 81 tríclenných 4 Stroggos 1 temporalisté 2 Tribonianem 1 s bezbariérovou 3 Trilorne 2 úhon 28 tribbly 80 Spockovi 63 trojrozmerný 9 vertebralis 1 Soutampton 1 Turnergasse 2 štípnul 1 Thwala 1 Vespone 1 Stodevítidílný 2 varostroji 1 verändert 1 Teniersu 1 Thorncrown 11 Valdorf 1 Stromateidae 2 Stojky 128 usazování 1 Vanovskému 1 Vehkapuhto 1 tetrahydrocanabinol 555 Stevens 3 Trefcon 31 ustálí 27 Svatavou 1 svítiplynovým 1 Stíbal 2 Turauské 11 trichlorethylen 1 stuttgarského 1 UKtek 1 Svatopolský 2 Teguldet 8 Tuapse 1 vekšeho 1 Veleš 1 unweit 2 Specjalny 1 Stammersdorfer 57 urážka 50 svatodušní 9 Travelin 1 vanadocendihalogenidu 8 uznatelné 1 technikaatrh 1 Turowskim 1 spermatoforem 1 Suspendovaný 1 Teruelské 1 Topela 1 Uleanthus 1 taijaki 2 TELMA 1 tepé 8 Südkreuz 1 Sozialpädagogen 10 Tenors 2 übern 1 tukaního 4 Toilette 1 svíraného 1 succ 1 tibetisch 16 sympatizujících 1 synge 7 Vedoucího 2 Vamby 2 Subparametr 2 Stritar 2 stížených 45 Úlohu 1 TruUT 13 uverejnují 4 soužila 2 thémní 1 tupohlavcovití 3 Štochlovy 1 Vereinsheim 2 tapiseriím 1 súcim 26 Vaugrenard 12 Urubamba 56 Tridentu 235 uskladnení 1 szebb 1 ukoristitelné 1 ugulská 7 vázane 1 Strkovic 1 Tabuc 91 Sviták 3 strelcovu 1 SSRNJ 3 Trachelostenus 1 Vap 5 štúdie 20 UNRRA 96 stejnopohlavních 3 Ulbr 1 TRUDOM 2 Vdává 1 tummaverkkoperhonen 1 Tyrklo 2 Stollweg 1 Triumphet 2 Urocolius 1 s regionální 256 upadla 1 trobriandi 3 Tumolero 1 Taicó 1 Széntovajok 1 Taleesa 1 utaví 216 unese 7 Terex 12 Stadlau 1 Sunogová 15 trefila 2 strategoi 1 Tamassy 147 Turn 1 Tagzettel 3 Tigerem 1 Spasen 4 sutaška 2 Uzvednout 1 TransEurop 4 Špaková 1 Troubridgeová 140 Trondheimu 2 s primerenou 1 Trimolet 1 Spoleczno 1 subretou 1 Struhalík 1 struskovém 1 superlidí 7 Thébská 1 Starcevica 19 Terstský 7 tukanovití 1 Vertinskaya 23 ušním 4 Sučvres 1 Tortoreto 1 strednehustotní 3 Trida 12 upomínat 5 vetkne 1 Tomassonová 1 Verrovo 1 tmafohnedé 1 Tarzania 18 tvárecí 2 taverník 1 Sueto 14 Tigra 19 Stropkove 1 tahoto 1 s ctyrválcovým 2 Stryjenského 4 Superlegalizace 4 Tollinger 1 uhraná 1 TurkPetrol 14 Tenev 10 Vendin 1 Sxtuparo 2 Spolužitím 1 subalterního 12 svatokrádeže 14 trate 3 tokugawských 8 tríaktovou 3 Tadas 1 Tloustnout 1 Strudelhof 1 Sportklubben 1 turínská 2 Velišovi 13 Tieftrunk 3 Varhanická 10 veleríše 2 taxacního 3 Trpanjí 3 Tucuxi 31 Tirreni 1 trýznivejší 11 Tošihide 1 ŠpanelFeliciano 1 Stínavska 2 Tarouccovi 1 Staubecken 1 Usagiho 1 Vešínova 3 Sybilu 1 Ubeidya 9 Straškova 1 Sriptiky 1 špenátových 361 tuhá 2 urozeném 1 Sywynfordovou 3 Svatoborská 44 Stecher 1 Sunicová 2 Urou 2 Szépe 4 s telem 1 turbodmychadlová 1 televizie 3 Tyronne 1 stratifikován 5 stevarda 1 Trychtýre 37 vcenovacího 1 trachytickým 2 Surques 2 Turícke 1 trioxidy 10 Tatou 7 trásl 1 Stuju 1 Varlamoffit 4 trojtelý 1 svíticích 21 Tupoleva 1 Stránai 2 Suseja 2 udržovati 1 Útlumem 1 Usídluje 1 TAGGED 1 uschlým 1 úzkopásových 1 Thomassio 1 suomalaiset 2 Tyllner 1 Strojírenském 1 vergrößerte 1 Tokoiu 13 soutežitelu 12 techné 1 ublízilo 2 synergid 1 uspaly 2 tanzende 4 sphaerocarpum 4 srpsko 2 Unmemnschlichkeit 1 Tschetschou 2 tschonoskii 14 Überlingen 6 usmernovacích 1 Ungarelli 3 syntaxis 9 Svatojanských 1 Sporogony 1 splajn 3 Stothart 23 tóra 1 tokugavským 1 tulejového 1 Stellanello 1 Stojícího 4 Tahmáspkulí 1 s migrací 2 TWDC 1 Theodhoros 1 vápenye 10 válet 2 Toleranci 7 tourismus 1 Štrbac 2 Trolix 185 Špotáková 1 Struharík 13 Špenát 1 surinamštiny 1 trenícek 1 Su?udiyah 3 uzemnují 12 tetragonoloba 4 stejnosmernému 1 útlumovému 1 Velatický 1 southamericanfood 1 spásaní 4 Univé 1 Stralczynským 2 swastika 2 Turrinus 6 Understudy 1 supervyspelou 2 Spirhanzla 1 Tissau 3 Vernajoul 43 sporitelne 1 Šubovka 71 strunatcu 2 theFutureTextBox 3 Tauralaukis 2 Spiegelu 12 Stiftskirche 17 úhlavními 29 tbl 2 stinava 1 ukafaca 25 Sousloví 2 Tautvilem 7 Tharp 1 strážícím 2 Svarožné 1 s prímou 3 Upoutala 2 tríbodovému 4 Tomašic 14 Vaculová 1 theaflavin 1 Usbúaja 1 sprengelioides 1 Turnovsky 1 štancováním 1 tertské 1 tabletkách 1 velkorážky 1 úcinejšímu 3 Svatotomášské 1 Tošin 1 SPERARE 2 Stenitz 3 Šramnický 25 tui 846 tradicního 3 Sweethearts 8 STUDIO 1 Šteklová 16 ŠTEDRON 1 StreetTalk 1 suffixálním 52 stredoevropskou 5 stochastickým 4 Tremelay 1 Užitého 2 varu 1 Svinokomplexu 1 tashkorganica 5 tyranskému 1 vápnitejších 2 transverzala 8 tlakomeru 2 Tomcattin 1 Vacena 1 Veriteli 30 Svatokrížském 1 Trostbüchlein 1 Svalovinu 1 Tulatova 13 Staškovan 2 Toges 1 troyské 1 Úmonina 26 Teuta 28 technische 1 ventriosum 1 UROS 1 tumb 1 tierces 2 Štípl 1 troufalejšími 1 Tutnjevac 1 Vdumcivyj 1 Trondheimfjordenu 27 Starto 2 spongilit 1 spatrivala 1904 Teorie 1 trémistka 1 Uctíváno 1 Talotti 1 Stefanešty 1 Unfallsäckels 5 Spovedaj 1 Stankovskému 1 Stangemu 1 tunelovány 1 Suprasalský 7 UNIC 1 Tellese 1 sylvána 19 supermoderní 1 Trogoxylini 2 Thero 1 Trnoviticki 1 Süvari 7 spoluzakladatelé 1 Veglensis 1 Tomljanovicová 2 Veaugues 2 Thyborřn 1 tekojärvi 2 sowieckie 7 stredoafrická 3 Sunyaev 1 Starotopolciansky 2 Trigavou 1 sPzB 2 Varianov 8 tetrace 1 šuárština 2 tenkozobé 11 úzkohlavá 1 Valentovými 2 Turlough 86 sunt 1 uspenskii 2 Urmana 1 Urgut 2 Städtewesens 1 velkoprostorovém 1 ülya 20 vejcovitého 1 stredoegyptského 1 Tiled 3 Veddel 24 Vermeulena 2 turanu 3 trnícky 3 Turová 1 tubožská 1 spájeli 5 srnu 1 thelypteris 1 Tompsonem 1 Tarca 1 trossulus 1 ventingovou 1 Tolmanovy 11 spekulativního 2 tollánská 3 stylité 12 Statistisches 75 Traiana 1 STOEN 2 svecenec 1 vacíkovitých 12 ŠÚ 1 vadjalaizőt 2 Vasthy 12 stylování 602 tahem 14 stvoritelského 1 Tababort 1 U jednoho 133 Ullrich 1 Velikými 1 Stentz 10 turnajového 3 s M 62 Válová 1 TextPad 1 spalene 1 stylu nearai 2 Tauberovi 1 Truncatellidae 1 VAXcluster 1 Varsel 7 vazbové 17 Tibere 1 temnoplodce 2 Tresanthera 2 Tambovském 2 Tarifu 15 tvorech 69 Valašských 50 syrová 1 twentieth 1 údržbovými 13 spustitelným 1 Unbehagen 1 Tuloperiaate 4 vdecnými 4 Ueckera 354 trestu 6 Vestálka 3 venceny 6 Valvert 4 TRÍSKOVÁ 1 thurn 7 Trám 17 Štáhlavský 1 svetoekonomiku 26 Tengo 1 Tracked 1 Tiexin 2 tobaksrök 4 verbs 1 Vejminek 1 Strikebound 1 Terko 1 staccatovým 2 Turcorum 3 úzkoštítník 3 symbolizování 19 uložilo 4 Tkon 2 staroknínských 1 Tehomiho 1 Tadehagi 4 úhorovitého 1 validizovány 2 ton 10 Undertow 2 TURNOVSKÝ 13 Toric 10 Strípek 3 svetoekonomika 3 Srovnávat 1 Vachalou 2 tyrosinázy 31 Tyroly 1 themového 1 USSHER 1 Tugulusaurus 1 tuttugu 4 Totiluv 1 Tamuridis 4 Stomatologické 4 Štítem 3 Velatech 49 Umajjovci 1 Straeche 20 spartanské 1 Tiszacsécse 52 sulfan 483 stanovených 10 traganus 4 Splítek 1 Špacírek 1 ? 1 Tibeto 1 svalova 1 thiniský 1 thiokyanatomanganatanový 5 Vazektomie 1 stríbrita 1 Trebícskými 130 Spektrum 2 Valkem 1 tríštivým 3 Traskavina 1 Vagra 5 vaišnavská 1 Verily 1 ú? 7 Szydlowiec 1 trolleybusu 1 Teulé 1 thérávádový 2 Tirtišnik 1 uchách 1 Titulesca 66 Vánocemi 4 štetovnice 13 spletitou 1 Ströme 3 Vanum 1 Velionele 1 Tencínskému 24 Tammiku 1 s gymnastickým 1 Tósálí 9 Typhales 3 Ústupenic 2 Tillstrom 1 StudenkaChurchAndVicarage 7 štúrovci 14 Trípatrová 1 Stridsplatsen 1 vampirety 1 Váchovy 3 sungorus 1 Tiertex 1 Taušev 3 tvoe 6 Vernérovicích 38 Vernova 1 SPECIAL 1 Stanle 1 Vazem 2 Vackárových 121 ujištuje 108 Spící 2 sužovanou 1 Teicha 1 udomácí 1 utrácíval 9 Titian 2 sufixové 1 Verás 1 Spenserove 1 uzamknutím 1 trommel 29 sváru 28 s jeho 1 versaut 4 srpnovému 1 universets 11700 Ten 27 trajektové 1 Stadenem 1 TOPAZ 3 Trešnicka 100 Veliš 3 Taitai 1 Swratúch 1 Supramolekuly 24 Sunjatsen 5 strukturováno 1 Valeckou 12 trek 1 Ülük 1 trunaj 23 Ultimo 1 ukrainophile 1 VancouverZákladní 25 usmernená 7 spárky 3 Tolmacov 18 Spalanzani 1 Svitme 1 Telepredsádka 397 studentem 10 stévie 1 thípi 1 Sušicané 1 Tongwen 1 uquebec 3 typhlosolis 1 Spongomonadidae 325 Svetovou 1 Tmejová 1 Toriconu 2 svolavatelem 1 Tilkens 1 Varasdinum 1 Vakrušev 20 Statistics 1 Spinnerovou 2 Stoutem 1 Thogotovirus 41 Tacuma 2 Vacovské 3 štav 25 uplatnovaný 1 Szentiepulc 1 Tušanj 2 Tartskou 1 Tereš 1 spoludržiteli 7 Tendenzen 2 T? 1 tordaš 5 Ukijo 1 šulba 2 Udávána 8 Vakovlk 16 úpisu 1 tamu 1 TOKO 1 Spöringem 2 Velehory 635 uctívání 1 tvurkynemi 1 Starrey 1 Vaiatu 1 stvoritelsky 1 Starykh 1 Sprádání 9 supermarketem 1 s Hradem 1 Vés 2 Valentiniánem 4 termoelektrickém 20 UNWTO 1 turpanu 4 Speakeasy 2 trojkombinaci 1 uzovskysalgov 2 Urbancice 10 Stringer 30 Ukrajinkou 1 Tolijovité 4 srpan 55 Tritonu 4 Vacca 1 Teophilus 1 ulláh 31 Urbanizace 4 Spídala 2 Teruffi 104 Standa 18 Stráského 1 Südchinesischen 1 traducerea 222 tlací 4 Turnix 10 Stonarovsko 1 statkového 1 tricetitisíce 1 taufe 3 triologie 1 Valic 206 Sub 1 Vagaský 296 trakce 1 topotecanem 1 Twarog 25 starousedlíci 2 spolupodílu 1 Towarystwa 1 Torngavské 2 umrznul 1 tributylcíny 2 Tarapoto 13 Štýs 1 Unejovicích 1 VáclavaA 1 Tomásse 10 urnových 1 Vectora 1 vertueuses 3 Thula 1 Titelbericht 1 Turizem 1 texaskýho 6 usmirovacích 2 spermatický 1 trinástinásobný 1 Vergina 1 sumbaensis 24 Vakuf 1 Telcov 1 Tibetforscher 11 úcelného 1 spoluráce 1 Sugga 1 Vanillosmopsis 16 Tibi 2 Stiklastöđum 1 švédskojazycný 27 triumfu 11 Valdické 3 Torniem 1 VAROVÁNÍ 2 Tilastot 28 upevnený 3 Tomym 1 uškrcených 3 Šubrtem 4 tois 3 Valdivieso 8 Tindersticks 1 treponem 1 spláceti 9 trolejbusovým 12 Takato 1 Spínadla 1 Szútor 1 úhorovite 1 Terrassona 6 tenorsax 1 Vcelina 33 truhlu 29 strašidelných 90 Štika 1 Veroina 1 uplandicum 2 surfovém 2 stojina 1 Tornimparte 1 Svárava 1 Velvárek 1 Tichovská 2 težarstvem 1 thalassické 1 spolupanovníku 1 toxoplasmozy 6 ubezpecoval 2 Tarinka 214 Verdun 259 tercie 4 Urgull 1 Trafalgarský 1 Suraua 22 tlumivka 1 tütar 3 Šperhák 153 triptych 2 Venkataramana 2 Toupin 3 triadvacátou 2 šunem 1 Takimi 24 triploidní 4 Treutler 1 Updates 1 Telarańas 2 Vangioni 3 Ucciardone 56 Tulen 1 Turcian 8 Updikeuv 2 Tigereye 9 Tomcík 2 svatokrádežným 2 universales 1 Starousedlá 1 štovíku 1 umytého 3 Tiáru 1 Vallendor 3 Spycher 2 Vanourková 1 Srdcového 7 trtin 2 tlumivou 1 Strechun 28 úleve 8 staroanglictine 62 vajecný 1 trombopenie 1 Súdwesthoeksk 5 Váhický 28 Topeka 20 sporit 1 velandum 11 úhlomer 156 soutežit 23 stríháním 4 stovkové 40 Stodolní 23 Stavelo 2 svkul 2 Terap 1 Varfolomejevic 107 Stay 58 Tetauer 2 Teeger 1 Ulvöspinel 1 tytam 1 tetrahymena 1 Stenavu 2 thesei 1 varinským 2 Tetleyho 34 uchyceny 2 twirlingových 1 Tažko 1 Trzebicki 1 Suphanburi 2 tibii 20 spáchají 1 sútrické 1 Tryskou 92 strunu 15 Toužím 8 symbolista 5191 US 1 Tonovi 3 vademecum 2 uvazovat 3 uznaném 1 Timmers 1 Svojkovický 1 Suderovi 1997 umeleckých 1 tricepsu 1 Tlayacapan 4 Tutong 1 Tyrantské 8 Velík 1 sroubí 1 udivenou 1 stephennashi 2 Taxillus 1 Tselios 1 TRkk 18 vacek 1 tisku 360 Tyrolsku 1 Strgulc 1 urologickým 1 velsškou 119 spodek 69 symptom 1 Sporeruv 1 spektáklum 1 Štepánem 1 trebice 85 urdsky 1 Thomamuhl 16 ubezpecil 1 tilburskou 5 Stoeckel 8 Trpcic 3 Symphysodon 1 Šulan 1 transtextualita 1 tobikomu 1 Trojjediný 4 VALARM 2 Vájuem 1 Srázu 7 Svitanok 2 upraviti 8 subsidií 1 VESELÉHO 11 tuberculatus 26 Spolecensky 1 sumendus 1 Transevropských 1 Tobing 1 timukua 55 Startovalo 2 Temelínu 1 stratocasteru 1 Tamworthským 1 telestreograf 46 úniková 4 TVOJE 1 Tsakadze 1 Staint 111 Stockton 2 Tchä 1 Tromlitzová 1 spagnoli 613 upadl 1 varuhus 2 transaminována 302 vecný 3 uskoci 3 Torgetu 1 Stalone 1 Stredobeskydské 495 Split 1 tamponum 2 Stereotomy 2 ucetnictví 3 údajov 67 Thoen 1 Stefanowski 5 tvurci 64 sukulenty 1 Vedas 4 Trináctileté 1 Tryonovým 1 Tennenbachu 1 spí… 20 Stöve 1 Thorgerdur 1 svetega 1 Tolkáppiyam 1 Veratar 1 transfokátoru 1 trilobitových 1 Urogové 1 tpeg 1 Stareckova 1 s maskou 1 trejv 1 Tortuous 2 Stielhandgranate 1 Ssirum 6 Valldemossa 7 Štokr 1 vales 1 Trsicích 1 sukien 1 Spectaculator 2 Starechovicemi 3 svetácký 1 Tibattona 96 Stallone 2 Spúšt 1 stínala 1 superguru 1 triptychového 1 velkomoravského 1 velmužu 11 válecnickým 1 ungaricus 1 Stasanor 2 VERTICAL 8 Twoje 2 Svojšské 24 Thou 22 Vacenovský 1 Unhoštsko 4 Undercurrent 2 Stilbe 1 Stylobasis 7 Tumanov 1 Vandermarková 1 Strukturgeschichte 25 uklízení 2 Tálikóty 5 tyrantský 1 TDLo 7 spektroskopickým 16 ukoristen 3 Stretávání 57 Trinecké 1 umoristica 3 toulcovitými 1 s agarditem 5 Utvárí 1 tuórum 27 Unified 1 uzivatelum 1 Techsport 1 technickoprovozních 2 Spojaru 16 trojlalocná 1 Vestingmuseum 2 tięn 163 strelné 2 Trojíce 42 starozákonního 3 Stavebniny 1 uccellino 1 Tiridatove 62 vdecil 107 typografie 1 Tatéž 1 Streonćshalch 2 vaar 13 Triskelion 2 Úspešných 1 tabantaabsho 1 spisane 12 Verou 1 Usilovnými 2 Survilla 1 Übersetzers 2 Upavédy 1 Surabu 1 švejkovskou 10 Stüdlhütte 1 Velhudy 1 vclenováno 9 udány 1 Sziklavárhegy 2 Valko 1 Spradlin 115 špinavých 1 Triblidiales 11 Stranded 1 Umbarským 1 Topolské 1 strechou 1 theadvertiserseries 11 Umožnovala 9 Surugy 1 Srnímu 1 Tálik 1 tretj 646 televizí 1 tumbón 2 Stravaganza 1 STRECHY 1 Urdangarinem 1 Toothuv 1 Ulaidu 1 Starzynskiego 1 Vercellanaovou 14 uschováno 1 štrasburských 1 Stenskär 1 Urtidsnatt 2 Trajet 5 vehnalo 1 supportu 2 szabadság 1 Tahuando 11 Strindbergove 1 THEVALIN 2 VELE 4 taiteilijan 5 Tunström 5 Terumotem 39 spolecenstvem 5 Teutschmann 1 trafit 6 Ventidius 2 spálenina 111 sportovnímu 1 Uníne 1 Tuwu 7 umístete 1 stereoskopickému 5 triptany 1 veturilo 11 Tobu 1 utahovaném 42 Tiroler 1 tyrantská 3 staroirštiny 1 Teddem 2 Trojspon 1 Spanauka 15 stopáže 1 Szajlu 1 Suchovrbenské 1 Topciderem 17 Vee 1 Stangleru 1 T?? 4 velsumka 6 STABLE 3 Tuchomericum 1 Tsianga 1 Sulfonylhalogenidové 12 Svetlomety 8 Spritz 2 Trevoa 1172 Stanislava 2 Veils 97 vedami 1 SUPPRESSOR 8 Stralman 1 tecnologie 1 Uladzimirauna 3 Údolie 2 ubohostí 2 Trćna 1 Spinelidy 2 s Tomem 1 Torringtonem 2 stratí 1 VCard 1 úznává 1 Ultim 1 utrhni 3 toxikomaniemi 22 Trogir 7 Tímura 5 Teem 1 thioredoxin 1 tenem 1 Staminodium 2 Velur 13 veterinárem 2 s iluzívne 135 Transportation 3 Toka 1 ustanoveném 11 Szymik 2 vehikulum 1 Úplne 1 Stejnokrojové 11 Tašaz 6 Vasiljevském 1 tells 1 ts' 2 ušák 1 Tengernsee 1 tselingádu 10 Strejda 4 Vávrovicích 2 USARTu 1 Svanhildou 1 Stillfriedum 2 Varili 1 trainstation 1 Unterfeitzing 5 vášnivému 3 Tómasdóttir 1 Veky 10 Traktér 1 Travali 2 utíkáte 2 Sutec 1 triumfov 1 svetlinoví 1 Šuridžó 1 Vacquiera 4 Suchanecki 1 Sümegi 1 Spitznerovi 1 Sporozoiti 2 Trytona 1 srázném 1 Svidlerovi 8 Švábu 292 stan 1 Tirfi 1 urodynamická 1 Ustrígel 25 Valér 103 Valiant 1 Sveinna 43 vazebná 1 supsp 1 válecníku… 6 ultramoderní 3 tehase 2 stvorená 1 Vertrauenssache 1 Tremouillem 2 tympanometrická 9 Thesea 3 Turkicu 21 Úpatní 3 soyez 3 Svištovky 1 sverující 1 Tataroglu 2 systemických 3 Torfowisko 2 vallhund 1 Strummerovým 2 Turkmenským 2 Štetinatcovití 1 Truchanov 2 Tirsch 8 uklidil 103 únavy 2 tibb 4 tef 2 Tovariš 1 Šugseb 4 Surniculus 1 uddavatil 30 Tišnovská 3 Tamariscifolia 14 Tarelkin 7 Tekovského 1 tonizujícímu 1 Turkot 6 trlicník 117 Velhartice 5 tlumeném 3 Svádel 1 Triadvacítku 21 Toriyabe 1 Uniš 1 tengriani 28 Suwon 5 Tušpa 4 Usingenu 1 subordinatae 7 spilitu 19 uvázl 5 Territorialverhältnisse 1 Tamrac 1 Šutrovine 1 Steeva 2 Sztykiel 1 Tremetousia 18 svatováclavského 1 Španelskem a 38 stéblo 1 taši 1 Stiftsarchiv 1 starých Spartanu 9 SrO 4 svatovítskému 1 Spolzov 1 vacA 1 Spoluvytvárel 1 Urtheiles 15 toulat 406 Štepánka 2 Uctive 1 Turkowa 1 Sypesteyn 224 sprátelí 1 Velus 1 teretifolius 58 soustredovala 1 trirát 2 tencících 4 souznením 4 úpatním 1 Tempestou 1 Talhada 5 Szirmay 17 Troubles 1 Thallova 2 Svantovítove 1 Srinikornchot 1 Tuul 2 SŠF 1 triacyllipoproteiny 19860 Václav 2 Vanajanlinna 3 ustup 4 Tigurinu 1 Unglücklichsein 1 UherskyBrodUjezdecCross 1 Spielmodus 1 Tessalonice 5 tudnak 1 Svak 1 stresovosti 523 turistiky 1 stupala 1 Svjatošine 1 Ulsterskému 2 vargasianus 1 Streptoccocus 2 Tasia 2 subchelátní 1 Undák 1 Uža 1 sprtovní 21 Talence 1 Tomisaku 2 umíchat 8 Steinbrunn 4 Stockenberg 1 srpodrápými 2 svv 138 spokojeni 15 umajjovského 4 Teppei 2 velkopolomský 1 Stenitze 130 Turiec 2 ucezuje 1 Tokovanském 1 trojrohá 1 Szabadelvu 1 supremacistické 4 stremchová 3 tuholistý 3 Timanské 88 taxonomického 3 Valerjanovic 22 stydká 1 tovero 4 Ukinrek 7 Sródziemie 1 Taiohaënus 8 Spirálová 1 Spoodle 30 sušine 1 strahlite 13 úzkostlivou 2 Taurize 4 Streichera 2 Stoubcy 1 Švajcrová 42 Supercoppa 1 uzený… 6 svislítko 1 touškovskou 1 unipolárním 7 triadvacetkrát 1 Surikat 1 Toobym 1 UEC 3 Spartiaté 1 ustavního 39 Vâlcea 1 TORRADO 1 terciarka 1 Thirnow 1 Synkopického 1 Symbolistickým 1 s podvinutými 1 Svícickova 1 Tacuina 2 trístupnovému 4 Vanlay 53 Troilus 1 Trickovski 70 Svépomoc 7 ústavami 4 vetrák 16 tešící 2 truvérských 1 Tarlów 2 Ungulata 1 Tulitikkutehtaan 1 tsushimensis 3 Vašulka 1 Tenebra 2 Soze 7 Soysal 1 szentendrei 1 superkardioidní 1 techologie 1067 Uprostred 3 tegn 4 velkomezirícském 1 Sunrym 10 Suske 2 Turkynemi 8 Transworld 73 Svratce 1 Spektatorského 2 Tepenné 14 twitteru 10 tabulkovým 1 Ústrojím 1 südslawischen 2 Teatri 1 Šukalletuda 1 tešnovictí 1 stenting 93 tecou 1 Thrakesionu 3 Sustainable 1 Tildenu 1 Sunnyina 1 valáškom 1 spustl 1 švedštinu 1 Upomínková 9 SPDM 2 Velp 5 Tiburcia 9 sundává 5 Srnojedech 1 Sturly 1 Svartálfheimu 1 s Michalem 1 souvetské 1 Staffordshirskou 3 Svedomitost 6 Užhorodská 7 stapl 186 stovku 68 sprinterském 4 Szyszak 1 StellaBlue 1 Szergény 13 Vandellas 1 teismai 1 Thyde 1 TempioPausania 12 umistované 1 Svandberg 6 ulusy 1 Srazu 1 teplárského 4 ukrýváni 1 Tatianovo 48 svetlost 1 uyarthidam 1 Thurdays 1 Velbertu 1 televízna 1 Strmna 2 Velkokapitál 8 Valstrona 5 tchumuské 1 Svanhilde 2 transaljašského 1 Sphinxkopf 1 Urnen 1 sovchozech 2 Vauriensis 1 Tulta 8 Storoževoj 14 syrištový 7 Tyjátr 3 Tamejším 1 Turkmani 1 Steydler 2 štuku 1 Staalskibsvćrft 1 valediction 2 spleteno 2 strojenými 1 Vahš 1 valgum 7 Spíž 1 Transinet 1 Thinktank 3 Velickovského 1 theatrologica 8 Tasovská 34 šterkopísky 3 Unicorns 1 Véde 1 Toreli 3 Terou 80 UL 1 Tiganské 3 tec 1 Verešcaginem 146 stálém 1 Thonsenu 10 Tugela 7 Spincourt 2 subparalelních 6 variským 3 Tomyho 1 s upraveným 1 Ussurijskému 1 Summerleea 2 Vaszi 16 symbolizujícího 1 tankiství 7 spolehlivejšího 1 Toužetínský 1 Tailyour 1 Spletený 1 svážnou 1 Therza 1 Turacher 2 Tokajskou 3 transkortin 1 Trombotické 2 svvaclava 1 SVOBODOVA 1 teploušem 3 Tscharke 11 spolutvurcu 2 Sumka 1 Suchedniowski 144 SSD 3 strošek 6 systemizace 7 Teodorika 1 stondt 1 velkorozponové 1 Štvrtecka 1 Tlacená 1 Steinhövela 2 Tersacz 11 Tísnová 2 Trpicovice 1 spatrilas 1 titanaugit 5 tráveninou 1 Sukra 2 UCEBNICE 530 teritorium 6 strhali 2 tetrafluorid 1 Untermarzoner 1 Tellurový 5 spoluzodpovedný 1 syntetizátorovým 1 Vandecamp 3 Thorsnessová 2 Tskaro 39 sprinty 1 Trináct let 1 spoluautorský 1 Špidlenách 1 TRIG 1 Tängride 1 turbiditné 1 Štechmiler 3 Tavarija 6 vadžru 1 Uroglena 3 Taurusu 4 spinner 3 Tlucné 126 švédsko 1 úpne 3 Trestanci 2 Touristbus 58 teriéru 99 Šporka 3 Tollem 41 stácírna 2 telegrafnímu 6 velebností 1 Storkensauen 1 Turfánce 1 usazujíce 1 Užgorodský 7 uhynulý 2 transgastrická 1 ?waté 1 Synagogou 1 tleskáte 23 Tobolowsky 8 tencóny 1 Tworkau 56 uhel 1 s úvodními 1 Urgu 1 Terchovské 1 Terezcina 1 Veckarka 5 Tescelin 3 Šprinc 161 stylove 4 Spätgotik 1 Velhartickém 2 Sufljor 1 štátostrana 7 tubusech 2 Troyte 13 Thar 1 Torpédovna 74 úhlech 6 tejpovací 1 sulcatipes 1 Striptérky 1 streamováním 1 tápavých 2 Tábara 1 Soutickým 5 Starorecká 27 uspat 2 Spornhau 1 surajpurština 2 Správuje 1 TheDet 1 Trienkewitz 8 tlumocníky 1 szwajcarski 6 Vernerovou 3 Tanjong 100 strojvudce 1 Urnersee 367 tureckou 2 Šumbery 2 umgearbeitete 1 unpaginierte 1 Vaišéšikový 1 Ustiugov 90 terre 4 tricinctus 1 Valuzkas 1 tristaclenných 2 Tahirov 89 streleckou 4 TShark 30 vážnejšího 2 Souperit 1 spadávku 1 tadarid 3 vencu 1 Topicscape 1 SVETLOV 8 Subjektivismus 13 Trautmannsdorf 2 svahoch 1 superlaser 1 tupijským 5 synodická 3 Vejmelkovou 2 Spätwerk 11 typizací 1 Tjeenk 3 Sportler 4 strílnová 11 Springbank 102 stimulovat 1 štutgartského 2 Terrifying 12 Stojecín 6 Tyfus 1 Tellumno 2 spoofování 381 úcinkování 1 tricetidevíti 2 Verstaatlichung 3 tripeptidu 31 Valencijské 2 Tokárová 1 švýcarska 1 sporický 1 s pozoruhodnou 1 substrates 1 Tecauovo 126 Trish 5 šte 23 trpaslíkovi 1 termoreaktoru 1 úsmevech 2 tapiragé 4 Vaihinger 1 Urodziny 89 starovekou 16 Uškovic 1 VaTM 1 Vermehlo 1 Uruvély 18 Tribecom 3 Stauracanthus 1 Tunshellefossen 2 Tepozan 17 udu 1 specifkuje 84 Ulan 1 stredislo 3 Veicoli 1 úzkostlivého 3 sústava 4 Turtiainen 4 svedcích 3 Veitche 1 Ustanovka 1 Tuddy 1 sukkulenty 1 takjubin 1 Vekerzugské 1 Struhara 1 Teisia 8 úklidových 2 vate 1 Treslong 1 Valacaruv 4 stredouší 1 UNCIP 5 správcovou 1 Umarbeitung 1 Stacke 1 Tetsuove 5 Stereaceae 2 terciárského 1 tresavý 1 Sveavägen 1 Tintanië 1 Svatopavelského 1 Tizayuca 1 Tinicum 1 Tapan 1 superschopnostem 4 Szathmári 4 TKP 1 Strabatenza 1 Trebechowicých 1 tropismech 1 Stoiciu 1 Stroutové 7 tidu 12 Swietenia 1 Vaidalis 1 Uvalin 1 Tichatschekovy 1 telefonovala 1 štástná 11 uspokojivých 1 s konektorem 1 Suchowice 15 truní 1 tysošt? 288 šroub 393 španelštiny 2 Traubenberg 23 sulfátu 11 steaky 1 Toupie 8 úctovacích 1 týtýtyteroitt 2 synergistou 1 spékavé 1 tonkiensis 28 symbionty 1 Tremanotidae 14 vážícího 17 Vesuvius 1 sterusy 1 Teemeister 1 uvržením 104 upelis 1 Twinbrook 1 VBSH 2 velmoži 31 TASS 1 Szczytowa 53 strílejí 5 Svoju 1 teuflische 4 Studentským 1 Szarowe 32 Vdavky 3 Torkelem 1 Veršvas 6 toužilo 2 Verkehrsunternehmen 1 Venizelových 1 Suchohrdlích 1 Terauchi 2 Spolecnos 4 ultramontanismus 4 Tuplák 1 Taipeiská 2 Telmanka 4 Ververgaert 3 s urcitými 1 Uhh 1 Spitzennadel 14 ultras 1 Sulwiz 8 Tödliche 143 uranových 1 Tenziometrem 1 VALLONE 10 Szilveszter 1 ükstoist 1 Tschernebl 16 Therrien 1 Tulasnem 5 TEEP 1 Tegaja 2 Sternweiler 88 souperil 2 Valmadim 1 Tonieho 78 Tregubov 3 Staroslovensky 96 útechu 104 válecky 4 Tír 5 Stanz 3 Unterwald 2 Trikameralismus 1 Stridnbergovu 16 stravitelnou 13 stoperskou 2 Soyers 53 vadit 1 Suzanka 1 VENKOV 4 Stésichoros 89 SŠ 23 Udrih 94 spocívaly 1 valentinánu 1 Takelmové 1 s ovlivnováním 1 Tenkráte 1 Sutrasamuccaya 1 Töpferovi 1 teretifolia 3 Steinemová 1 Tschonoskuv 1 Srovná 1 tapetárské 2 svážnicové 1 staroromantické 1 Velázquezovým 5 Universi 1 strárí 1 tornacipoben 11 Stratosféra 1 tpwd 6 trubicovitých 15 sušárne 1 uchR 1 Vespasií 1 trezalková 3 trístupnovými 246 ukazatelu 1 thurui 1 Tacqueta 4 Thakurová 19 stránkový 1 Tantalon 1 Trebonický 3 tangary 1 turbokompresoru 1 Tremat 28 stíhacce 37 Tape 19 temperovaný 2 velkolosinskému 1 Tippouv 1 trachodont 370 stríbrného 1 SUBERO 1 úžasnejších 1 Šteyerová 2 Tourtirac 47 Velenovský 1 Toskalharji 1 vendrynskou 40 Tyrolka 1 tyehin 4 svijeta 90 stredomorských 1 užerka 2 swem 29 Trpák 5 úcinnejšímu 7 Stiftsbibliothek 5 stafylokokem 1 Tundrovyj 36 Tlumice 1 turbovrtulvými 1 Vajsábelem 1 VBRG 149 spojeni 1 Sukupolveni 2 Stephanu 1 südamelt 9 Trójca 29 Verhaeren 1 Tatarska 1 Tolagnaro 1 taricovými 1 startupu 1 Svitavách a 1 sowards 2 stalinistkou 1 Verengung 12 taras 6 velrybách 1 Strmo 2 VACHALA 467 Ti 3 Steppes 13 tonoucí 1 Tromotriche 39 suchému 1 Sudo 1 srednia 1 sundanou 3 Telnický 1 Valida 2 taraxacoides 1 Tantalovým 1 Uechtritzuv 5 Úradujícího 1 Stredoveku 4 Totiviridae 1 Varnsdorfskou 12 Tepl 1 Vachir 346 úveru 1 ukonejšila 1 strojanových 4 tvarovém 1 udus 1 ušlachtilých 7 Stadionova 1 Sterenga 1 Unwetter 1 Šupuka 1 trenceových 1 sudú 2 umenovedci 1 Travunané 2 Tilling 6 topology 3 tourne 46 strílna 1 UNISPED 1 thólu 8 spalovala 2 tonadilla 1 Stresem 1 teatinském 13 trýzne 1 TetralobusA 7 Ústrašice 2 vailla 1 splanchnický 1 uruguyasko 2 Treutle 1 Sourgoubila 11 Truchlící 3 Václavíkova 1 udržujícímu 4 Theaitéta 39 soustavnou 5 Upoutávka 1 Tegmentální 1 Temnik 8 tiskarském 1 Statholmu 4 Tretja 1 utokum 1 Svee 1 Tošenovským 3 Vernadskogo 13 Tovje 1 Svenskřya 1 strunovcích 2 útoceno 5 Syranech 1 tašticce 5 uvedomme 1 vascular 24 sprátelit 4 trojcípou 1 stupnovaném 5 SoVoSo 1 štítarských 2 trhutkou 5 úštecké 3 UPD 3 Tempier 4 treneri 32 stopar 111 Tamar 4 Southsea 121 Užitkové 1 Sounovského 1 tuná 1 Trocznow 1 uersorio 2 Thórdarson 13 Vajglov 42 trubadúr 1 surt 188 Úhlavou 1 svatometodejských 1 Tuhši 6 trenovým 1 Taikjú 1 technokracií 1 Treichler 8 Tzimiska 1 Takaji 2 Špun 1 Terestre 1 Trebockým 72 Terasy 14 uchráneno 64 štedrost 1 Thaxt 1 Spojilo 1 Ticleanu 1 Tefflerem 65 traktáty 1 s cizinci 4 utrápil 2 ultimát 1 titulovaným 1 s úvodním 1 Unikkoniityn 1 Tarapitou 21 Turturro 7 Ulus 1 Talismänner 2 tácku 2 šterbinovitá 38 upevnovací 35 trocha 3 Uggé 1 sugestivnosti 5 vejmutovkou 4 Tryggvassona 4 trináctiúhelník 1 Theatervertrag 1 Tefritické 1 trb 3 Veranzio 1 Spookym 4 Svidnická 3 Temnotou 13 velkomoravská 1 SquirrelMail 3 Taosu 1 Sprungovou 5 Straucher 2 Sukoró 2 Vanikova 1 Tedjini 9 Tolstikov 4 Tirianovi 1 Tillemann 46 Umbar 1 Spiessovi 1 Staford 4 Strida 3 Spézia 2 sveticím 7 Szostak 16 Tetouru 1 svetlostálý 1 sutartines 2 Ugadi 1 svetoverekordy 3 stadiální 1 Verchneudinského 1 Tahitan 1 VARITAS 50 Spar 1 uzivam 3 través 1 úcedníky 43 uprímnosti 7 tancovacka 3 Sportsmanship 2398 úpatí 341 Total 61 úhorech 1 Verku 2 Steinmetzakten 19 vernejší 2 Veerské 1 spolunocležnicím 8 vergine 19 Úboc 1 tajnustkárských 1 SOUŠ 1 Thunudrumi 1 TTIMEOUT 1 Valguma 1 Urbes 1 starafrica 2 termidoru 2 usmernovacími 2 Usmrtili 1 trampotami 1 štíhlounká 282 tepelný 28 Thelin 6 Tercer 1 teriérové 1 Urgentná 3 Takigawa 1 Suobežne 1 Thermentrophy 1 sý 1 Uluivuda 6 Suckow 1 verejemi 4 Turócziová 17 Trauchburg 1 tretiruka 3 šunga 8 svetlomilnou 3 Srážku 1 Tortricoidea 2 Svetlém 14 Svéboric 1 tawhídu 1 s ne 1 tünuva 2 Ursperg 6 Vellamo 1 Suprematystów 2 Temnosmrecinského 1 s tlacítky 1 tropanolu 1 Vanišuv 1 u jednotlivce 33 stínítku 85 tepnu 1 vedmám 1 Starchenberch 1 Tardiff 1 Trzstyenicz 1 Suai 1 Umvolkung 1 velá 1 TNásledující 1 štetinolistým 2 urotropinu 1 Tautra 23 stácena 36 Takahiro 4 Tsusiophyllum 1 Stupinem 2 Šurockinová 1 spojene 2 Up 7 stejnegeri 1 Štvrtockého 1 Tilkovský 1 Turnograjska 1 Szabolcsveresmart 9 Ulrichovi 7 verbíri 1 špicatejšíma 1 Umbriedgová 2 Veletovský 10 Umatilla 3 verein 1 troctolitech 2 tortillové 1 trihexyfenidylu 1 srozumitelmá 6 Spun 1 turé 2 tilae 5 Theophrastova 5 Vaculíkovi 307 Ujcík 1 Vćrnet 1 Utal 1 thulb 2 tríventilovou 56 Užovka 1 Teconto 4 stachrský 2 Überraschungen 1 Varászló 2 testovanisoftwaru 1 Váguru 2 Thabitovo 6 Stunkelová 2 Trebnicemi 2 TRYZNA 10 Uhrík 4 Udehejcu 1 Sweetshop 1 syntrofie 2 Vasteville 1 tesnopisecké 3 subulatus 24 Vahid 1 Svatonoského 3 s rychlostí 1 Šwabow 2 sváženo 1 Stamicu 1 tríramené 50 udávala 2 Timelike 4 Stockhorn 10 Spolecném 2 Turren 2 triandrae 2 stavitelovi 2 trhlinatá 1 Talinnské 1 trentinské 12 vestavbou 1 Stavoindustrie 2 Südstadt 3 Tešilo 3 temporales 8 Veränderungen 1 umanistiche 32 Touží 3 Velvel 1 Syrianskou 7 úpenlivé 1 údelu 2 thota 1 Stictocephala 2 steenisii 1 Storgĺrdsem 4 supersekundární 22 vektorovými 6 šrank 1 Toužíce 1 Ufip 1 tetars 3 Stabilizující 2 Trichothecium 7 vápnitého 1 Tamiat 12 stations 1 Tasermiut 1 VENTRIS 1 Untertal 4 topographischen 12 Ulugbek 4 Synaspismós 8 vepsaného 1 svrchnekrídovém 3 Spilsbury 1 suasurií 6 starostlivým 3 Söylüyor 1 TRIMED 5 teniskách 2 spalni 1 Technopop 1 swissinfo 1 urbinském 3 spontaneita 2 šramoty 2 Vernost 1 Témice 70 symbolizoval 1 Treizičme 1 Spellmann 2 Telesync 2 Trec 27 vazivovým 2 surfového 1 Vecným 81 Stefanem 1 Stanice Syfy objednala 1 uzounké 94 ultra 1 tolerierte 1 Ürün 4 Umriss 1 Telemaca 9 VBL 1 Tulostoma 1 symbiotem 1 telefón 1 Tribohunj 1 Torisem 1 upínajících 55 travnatými 6 svú 1 Týral 196 usuzuje 1 Szalafo 1 toto plemeno polovztycené 3 triariu 1 uniformes 1 starozákonnní 1 Steuarta 2 Velkoprevorem 1 Uršanábim 2 Theodulpass 1 Tharon 5 Štepánku 1 urbankillah 1 Västerbottenskuriren 1 sublabelu 1 Strýkem 2 tenir 23 špíne 8 spirantne 11 Swana 4 Stegophora 11 tenebris 1 Tokmazeja 1 varime 1 Sváže 1 Swol 1 teli 1 updatovaná 1 tocného 4 Tomcányová 5 Tecky 2 Vagenende 2 Staicu 2 tuhandes 6 Valbonnais 38 Tekovské 39 travou 2 starb 1 TERGAN 2 Stairs 1 Strádalové 1 Suwanosedžime 2 Stigfossen 1 tereckými 8 Trebonicích 4 trapezuntským 1 Triestský 553 stoupání 1 Terrantez 4 Timurovcu 1 Systematicteji 1 ušetrenými 1 šura 1 sulfochinovosyldiacylglyceroly 1 Úsporou 8 stahována 2 Utopila 1 spormogonie 1 splítkový 1 Sugupuu 7 spike 11 Stodor 1 tvoril 9 tuláctví 1 Uvolnujte 5 suburbano 4 Traude 1 Superbovi 70 stojany 3 Svárovem 2 Uhercicím 2 Uverejnila 2 trísetletá 6 TTLS 12 Úcastnice 6 spinosaura 7 tepelneizolacní 2 Uljanovka 1 troskotovické 3 Turghana 1 varívala 7 stariny 1 Uprednostnil 5 sporých 4 stvrzování 1 Urshucum 1 Talne 2 Spaatz 2 usmev 7 sujet 2 Tulun 1 Tážal 1 Velkohrbovský 1 Tydlitát 1 Tacańitas 1 Springwoodská 2 Turnaikum 1 vähä 9 Tieghem 19 toccata 1 TimeWarner 3 tlustším 1 Untersuchg 3 Stachu 6 trinitas 2 umožníte 32 Vänern 3 tyska 1 tremando 1 Stierva 308 udelován 2 Steamzine 5 Tarleton 5 usmrcovali 1 teistickém 1 s trimetoprimem 5 Ugakiho 1 Svetru 1 s centrální 1143 úpravu 8 Teoretik 4 Tomaselli 1 Toivonene 1 Sunya 3 spotrebišt 18 Svätého 24 Štrbském 1 Terklau 20 úhor 1 Stonefield 12 Steegmans 1 Tralau 1 spermákat 1 surreální 1 Szijártóháza 1 Toneym 2 Tiefstack 2 tecením 2 štýl 1 trickovým 1 Tamerech 26 trochilus 1 Uholka 2 tulda 1 turbam 2 Tvaružka 6 tišil 1 tachypsychie 1 tátské 2 Vepríkova 365 ucitelský 1 Stilsferjoch 1 velvarském 5 USCSS 4 valašskomezirícského 1 SPETE 1 vašálaccat 3 soupire 1 Spectromete 4 Stavovskou 7 Utraty 1 tordovanou 1 Tadzari 7 Šponták 3 Vedry 1 Sperner 1 Unionbrotfabrik 1 Teodorosu 1 Tesido 25 turnerského 52 tajze 1 strevlíkovitý 1 SPRADLIN 1 statkárce 2 spolucestujícím 3 Talcottem 1 Valignano 1 vamberické 1 Vanderfjord 1 Sveržanský 1 Trondheimsfjordenu 3 Trouans 1 Tistavou 1 Ssturwicziek 3 Spyderco 3 Stuarty 1 Vahki 1 Teall 15 Topice 1 Thorborg 4 Srdecník 1 spolukustod 1 Superkapri 5 taiwan 1 Talih 1 Stradalových 1 Unguz 5 varjažských 5 Tolvajärvi 1 velkotrubnaté 2 Terzieff 1 …také 5 Timesitheus 2 Torský 1 Tope 2 Tevynes 1 Trifer 1 Verbálními 1 Spolupodílela 1 spotreba 1 Swalemen 1 Stacionárními 1 Straußeney 4 Štefanova 15 trpytí 19 Stankovský 1 Transabdominální 1 tematy 1 Storstrřmsbroen 1 Teutatem 1 trombokinázu 2 Stelfox 1 Vadžrajogíní 1 Tostăem 2 vedeckotechnologických 2 Thro 53 Tomicová 5 Tripolitsa 3 Superhet 6 symptomatickou 2 Theodorových 81 stanovilo 1 trichiasis 1 tenerensis 165 Strong 8 trubkovými 4 Šudži 1 Vadina 1 spojenectvími 5 tvárnosti 3 Traktorové 32 Stramenopila 3 uhlazování 2 Taxtako 3 ultravakuových 1 tropované 2 Tirnanic 1 Thogalovi 1 Stonásobkem 40 specialistu 1 Suctorida 3 Staeck 1 Vallagarina 13 torna 1 tradouwense 1 Tyersová 9 Tomatin 16 Tantal 1 submembránovou 4 stokusová 2 toulaly 1 spoluzávislosti 15 utlumí 1 Verjovkin 1 turbulent 1 Variantea 1 sutajsky 278 Spojuje 1 Vahlgren 1 treskl 1 stretchové 12 triquetrum 1 Trebechovicemi 2 tasice 2 Thibodeau 30 Trebonic 1 Tourettea 2 Teodolfo 3 tišších 1 Subaraší 1 stadtmagazin 1 Umínenost 4 Szemerédi 2 úrú 1 ucedík 1 Suberová 4 Tallberg 1 Taganrožském 11 Umgebungen 3 Uhrenbetriebe 1 svätom 3 Vescovada 4 Swinburna 2 Svadobné 1 Studéneckého 1 Tradície 86 Svitolina 1 Spyum 1 Tauony 5 trasovište 16 stereotypním 7 sukuba 12 Vallet 1 váhávosti 1 Verwegenen 4 terpenoidu 1 Verygames 1 Štedráka 1 Tedzhen 13 tasmánského 9 vanoucím 1 terahertzový 1 stavitelští 1 svatokrížských 9 trénovány 1 sozialpolitische 6 stehlíka 1 stylotvorná 1 Starowojtowa 1 svetležlutofialovým 8 USAC 178 Suisse 6 Verbrechen 7 struník 1 Tiankoura 1 vaskularizována 1 Tradewinds 1 stoupavou 131 svržena 19 Teepees 1 tinkeri 2 správky 6 unitárská 2 trístým 1 ujednávání 1 teleskopiských 14 verloren 1 tehtar 5 Tetide 2 stirlingova 8 ucte 3 Speciosa 2 Varnol 1 Statute 2 stonewall 1 Stabroek 1 Thánésar 1 Uhasit 13 Uražená 1 spiritic 44 Šumné 7 vetsi 6 Validace 1 Svatbické 1 strojecku 1 stopujíc 3 trapném 28 Vasarely 2 travinným 1 Szegi 7 Tschorn 1 Subjectu 1 Tarje 4 Spanky 1 s piráty 1 Svinenským 4 ufologu 1 Sovovský 1 ublic 1 Vahakulmu 2 Subiaka 6 Theodosiovu 1 svidríkovým 1 Syntaktickými 1 s Indií 85 teenageru 5 Stolárik 2 udržovatelnosti 37 teritoriálního 1 unbiunia 1 Unatínu 2 Souvestrove 1 symslovým 1 s výsecemi 42 Urbano 6 Speedo 1 tanarius 4 Tubala 2 Torrico 2 Tivercu 2 spinnst 1 Trönö 11 staveništ 1 upechovat 1 Trinovum 1 Suvičres 2 Sounwave 60 stah 1 Štefanom 2 stredomoravským 453 verš 2 Surabája 14 Throttle 1 Valorumova 1 Spinosaurem 1 spolupodepsali 1 Traethodydd 3 turm 4 tematizaci 1 Spalem 7 Tyrrella 3 sumatrae 2 Tastar 3 suberin 1 Túnis 1 strasakem 1 tristaosmnácti 2 Uitz 1 Štolové 13 tísnová 223 strakapoud 2 Vdecne 4 Superoktáva 1 SPEVOKOL 1 Strecový 6 uhráli 1 sponsonu 2 Tripoint 1 Sumbiar 7 Srebrna 1 Uzemnit 2 s prevahou 16 Undone 6 úverních 1 tomasem 1 Tumsas 2 špán 1 Stőgrem 6 Tulak 8 soutežitel 2 Stubickové 1 tetiných 11 štítove 2 Valdstejn 1 Transjon 1 Treviranem 3 verícící 5 Tithónos 7 váda 1 Tatrmužuv 3 Twitterová 2 TrackID 1 Vertalershuis 1 Tašovi 3 Trinisaura 1 Teenuse 2 Thaxter 1 Trstenický 2 Turksiba 5 trepacky 94 tkalcovství 1 terasovitém 8 vencích 2 tricykly 921 strecha 1 Trachsler 1 Stĺbi 20 Targaryenu 2 Umbrum 3 Turboalternátory 1 Svinorky 5 supplices 6 ukloní 1 Šterkopísek 1 Väkra 1 uncovský 88 uskutecnují 76 Stavebne 1 štercích 12 spolubratra 2 Urbise 7 Turbou 21 tampon 4 Spoluvládcem 13 Šustera 1 uhercických 1 Tessenow 1 tencímu 1 UKBTM 323 starají 1 thákuránír 1 témer 5 Specif 1 ulámáním 2 transliterovaná 1 urikázy 1 Tsebaoth 1 toke 1 tanšanské 1 Suchenthal 100 traktátu 10 Tesárske 1 Thákii 2 Uspolka 8 vešely 5652 údajne 1 S mnohem 2 Tirop 503 Trebové 1 Umwertové 5 Sparence 724 tycinky 7 stoupacích 2 Velkovévodské 1 vaporizovat 2 Subersach 3 svetrem 4 Štrobla 9 úpadu 1 Stanihurst 1 Tilottáma 14 Urceny 1 Tanenbaumovy 2 territorialen 2 stenotické 1 Stagnant 2 sprout 2 ‚umelecké 2 Tucheru 1 trojplošných 2 tornare 1 stentgraftu 2 Toolboxy 3 Steenwyck 2 stellaire 1 stežujeme 1 tmavešedou 1 Troegler 1 traky 2 Statkárka 434 Tohoto 3 Tetraonidae 1 Urvem 1 Unyoro 2 tóne 4 stíneno 256 strava 2 tentaciones 6 Úprkove 2 teisty 4 úpadce 24 trávolistý 4 typogr 1 Turków 5 Traumhotel 1 Spiritistický 1 Trinitá 1 vedea 1 Steidlerove 1 venkovské informacní 1 Urienova 1 turquoises 25 úžasných 15 Uvolnen 1 Sziegetváru 1 speranze a 1 Vasileonoiko 4 spotrebitelsky 1 usmcmuseum 4 VELEK 11 Tenmy 7 Trousselier 6 unifikován 1 transfoportní 1 Transzendentalontologie 1 velionocního 2 Štapfera 57 Špillar 25 Vajs 2 Špilberka 2 trínohé 1 sublimity 2 Ticleni 2 Tynana 1 Tergeson 1 urethrostenosis 1 titkat 3 udusána 1 užívné 2 sourcemage 1 UPGRADE 1 Trumbuja 8 Utumna 2 Turzovského 2 Tismenici 2 Švamberkem 28 Trhala 301 usmírení 3 terigénního 2 tapírovití 1 trvajícícho 11 utrechtský 1 stenosans 1 ŠRUMA 1 Vencluvkou 1 Vahríze 2 Strakonictí 1 Tobal 2 trilogie Back 31 syntáza 1 tríkralový 1 trojveží 1 Vareckým 127 Ulysses 7 Tecomaria 2 sycivý 1 Sugacult 1 verzeihet 2 tísnenému 2 Strimelicemi 4 Undan 4 Špitzer 29 Ultimécie 2 Trebovickým 1 sparovat 1 Takhte 3 správcovy 1 Svarený 16 Sovojovic 1 Sztankóczyová 1 Vadžrajánou 2 STOJANOV 2 Usaceva 1110 sousoší 1 Toxoidová 2 umelohmotného 4 varva 3 tourbillonu 8 Trískou 2 stredoškolackou 8 tržná 13 spásány 1 Treluyer 2 Tubach 1 SPÁLOVÁ 2 Sparattosyce 3 Tunç 3 Tedžonu 4 Suchomastech 1 tautomerií 2 Štubni 6 Srbovy 476 umístením 1 traducida 3 Termy 9 Štefánikovou 2 Vaculíkovy 44 sumec 3 Szczukou 20 Stoicismus 268 vejcitá 1 Tausky 251 sušších 18 stredisko 1 toužimská 1 uGal 1 Stelzigovou 3 Vedomím 1 Tomago 4 Urcovací 1 Synsety 2 Štýrskohradecké 1 strom… 12 Teheránské 32 telesnosti 2 TRANSPORTATION 1 titanovo 1 Suknickárský 6 Vejcožrout 1 svete bylo 113 trvalém 1 Tajne 3 Szürkebarát 1831 Suchý 3 trachytových 105 úcelových 185 Štefánika 1 Tral 3 tetragrammatonu 1 uvedomuju 5 Starzynského 5 svárlivou 1 Tenkterum 1 TBHP 1 ukrocení 1 Tummelisa 1 URBIS 1 Tošitojo 4 Terchovou 13 úh 31 tandemové 18 Tagansko 3 Uge 3 stríbrnocervenou 4 Technikum 1 Šušnjari 1 Synthetase 1 Šunten 2 tancami 1 vecoru 1 Šume 29 Stavebníkem 1 Uxem 1 Swarb 1 Ulbrichia 5 trojclennost 1 tetrahydroxokobaltnatany 6 Suttung 4 Spalato 1 Tamása 1 Thikse 22 Verzi 1 Stammausgabe 1 Telegrafistkou 1 Trzebssinio 1 Stanelis 1 subteorie 1 tvaružkári 1 Sybilliny 1 Spiralen 4 Valras 7 Szenes 1 Sugestivne 1 staminodiích 13 vetrosprašné 2 talmudy 2 Trivimi 4 trístránkový 1 Urheiluliitto 1 variantními 3 vespiforme 1 Útocní 11 Surteese 2 Splitbreed 1 územé 1 Tschiffelimu 1 úzkohalavá 1 Tjukalov 2 THORAX 1 spolufi 1 vaam 1 Versiliait 49 Tintinova 51 sprchávání 3 tužšího 1 Uthanen 185 true 168 usoudil 4 Thaletem 1 taishanense 23 Ulož 1 Speckaerta 1 thalioides 1 statkárove 3 vatelín 3 Verozvest 1 Teehuteatuaonou 2 Supplinburkové 1 težkoodenecké 1 taštickovou 1 Suuvedellä 2 Stokesley 1 Taurová 1 Úpolín 1 Vasknarvou 22 uvízli 24 Trojanem 1 šulánky 4 Tvanas 1 Venina 1 uzavríat 1 Trägrem 1 Szielnic 2 Veselinovicová 2 tetanurní 2 Trešnákovi 1 unisexovým 20 Srebrenici 34 tmavozelená 4 tricetiminutových 2 Sukenori 1 SSpS 1 spoluvýskyt 3 TADS 1 štípají 3 utahat 1 Storsjöyran 13 Vettelem 1 Tripedalia 1 tórtétete 1 Strakapúd 14 tezích 2 Utkalo 2 tocnickému 7 tercovnice 36 tany 1 Tigercatu 1 Standze 13 Tchor 6 Theatralia 2 uskutecnuje 1 úzkorozchodce 1 Stanowczych 1 TechnoAlpin 677 Spišská 3 Trava 2 Tridcataja 76 Technickou 1 s cinností 1 UvrBC 2 Strachujovské 1 táží 1 Vdovským 387 Váha 1 Valentýnových 17 uschlé 1 Uqba 5 Valldoreix 5 Verite 1 Tecuo 1 Tsilent 4 Syrákúsy 1 Tríhvezdickové 1 Touchin 1 UMKC 1 S? 1 titrován 1 sráživé 1 tarentská 5 tylžského 2 Thara 1 usmrkaný 2 Vaisigano 1 tr?j?ch? 2 Toqui 14 vedek 1 verlies 1 tragickmým 8 Tvrdky 3 verodoxin 3 vengador 1 stalagn 1 Umjarovovem 7 uhlírské 1 Teouma 2 Strykowski 34 UPU 1 Ulmanka 3 Taniwhasaurus 5 Thomann 1 vave 9 terestrického 2 upája 9 Tropfenwagen 4 synchronicita 1 takovýdle 2 Varaize 2 Umbridae 1 Takeshiho 1 Tsykalyuk 1 usvedcujícího 21 Tarvainen 1 Treetem 1 Ucidate 1 tatoué 3 Technojádro 7 Spinners 4 Verchojansku 2 Verlith 1 velesvatyní 4 svedok 1 Spécialisé 80 Valve 1 TEPPER 2 Thrácii 5 terapeutkou 7 Timková 3 Technoexport 1 trimestrielle 2 Ucitelovo 40 uctíváním 1 Tenczynskiego 1 teheránským 2 Varnemana 7 spolufinancována 15 Tolsa 26 spolužacku 1 Vachhtang 1 úctyhodou 1 údernicí 27 Typové 4 Verdoux 19 úredníku 1 usmrcujících 1 Veroninu 1 Taiwanioideae 2 velkoknežnám 46 usuzují 2 Sudanci 12 Valony 1 Teruggit 3 valentinovci 12 Togem 6 turrita 14 Vazište 1 Transhumanistický 4 Uškempirov 1 uhelnu 1 Venvet 4 Ungersberg 1 vejvan 38 Úcinné 5 Tumenskou 1 Verkleidungstrieb 4 Usu 2 stereografie 22 stimulován 1 Tantalising 5 vakancí 1 S kachnou 7 Stricta 21 týždenník 3 Spechta 1 Tachirova 1 Tertiaren 2 Strízek 18 turbodmychadly 1 Srdínkova 2 Tewanima 2 Trimalchionovi 1 Veklé 1 špionských 1 velikomucedníku 3 stredotlaký 1 thúpa 6 US-DEU 1 vatiradio 48 trampingu 2 Vandenburg 1 šovinizmem 1 uspesnou 1 Tagimaucia 1 Valö 1 Unterscheffau 1 Špirku 1 Souveniers 1 terminále 1 státoprávnich 2 Trinšika 160 Spojka 1 Triunia 1 Toychyyev 1 s Mohavky 4 Strandman 1 toluenovou 2 spannovské 1 Traianovou 1 Stroskotanci 1 stuckovým 2 StringExtensions 1 Tardieova 1 uštípnutých 1 Švecovu 1 Thaumasianthes 17 Standarta 2 vadózní 1 ultratóny 2 verhexte 1 späturnenfelderzeitlicher 1 ujasnovat 1 spolurady 3 trahisons 2 spínanou 1 subdiv 1 tahad 12 urbanizovaná 1 ultravysokém 2 Úcastní 1 Vajraové 1 spadnút 1 Unifaciální 3 Stace 6 Thérí 1 trmalova 13 šugo 2 Unteren 3 trípokojových 1 upnutém 9 Stenico 1 Treschklingen 1 Tantrise 3 Tacchella 4 Stanwoodu 4 telluridu 2 stiles 4 teplovodivá 2 Vanera 5 Targaryena 1 stonského 1 Vanarama 1 triungulini 1 tsetsautské 98 Trevíru 1 tubožského 76 spásání 1 tektem 1 Trant 1 typiky 1 Vászoly 2 týranému 3 štepárna 1 Trepanation 2 Stažitelná 9 težkovodní 88 tajnými 20 verouka 3 štastneji 4 Szansa 47 Úlehla 1 Tatíckovi 1 Trockenspinnverfahren 1 útoková 6 svatopetrském 5 Trudeauem 1 tippu 1 Tscheitsch 7 Sumery 2 Stravoval 1 strittigen 18 Úrocnice 4 ulehcovaly 1 Tabidze 4 varáku 3 tráslo 3 šupinatení 1 vášho 9 Velkolepou 1 Thraustochytriales 1 TOMKOVÁ 1 Utekly 1 Spodiumfabrik 9 strouhání 1 Speedie 4 svárovská 1 uchycovali 11 teticce 37 standarty 1 spitfiry 5 Taliani 313 stredovekou 2 svinovacími 1 Thirifays 1 úplových 1 Trigonopyxidae 1 Tafira 3 Swinomišové 1 tristudne 22 tóru 8 Steudel 2 Toube 2 Útoc 2 Stolzeovi 3 Sparda 1 Turfansammlung 1 soutavách 67 spoluhrácu 194 Stredoslovenský 3 Thomasových 1 temporytmem 1 Totovec 2 Supplementband 2 tartusko 10 Vanina 15 splaškové 3 teritorialitu 1 TFTR 5 Usclas 3 Toshiyasu 2 Tabelátor 6 Torrington 1 Šunow 1 válecnost 2 upósatha 5 symbolové 1 Tunupa 1 unterstes 40 státopráv 1 Thaletovu 3 Susskindem 2 †Struthiomimus 1 Tálínem 3 verborgene 118 Tomeš 1 Technovore 1 STOEVING 1 Szönyim 1 Trotti 1 tiff 1 Svahování 1 substantivne 1 Sumino 1 ulstaj 55 Ukradené 1 thyratron 3 Tĺgkompaniet 6 useknutý 4 trubních 15 Unavený 1 streamového 63 urychlí 9 Uveznený 1 tornera 1 Treguier 1 Trypanocorax 1 Stuthof 23 Umwelt 51 Starovekého 1 Syntetizéry 1 Ulvo 1 Sprengtportenuv 16 urcitost 7 velvyslanecké 1 Tisalverovým 4 Ullrych 2 uklidnené 1 Vajsabel 36 syrovém 4 Strimelic 4 tiskovinami 1 stolpe 1 Ucházely 1 Tschirm 1 tržnehospodárským 1 uuaer 1 stredoneolitickou 61 stejnosmerných 4 transketolázy 18 Spalovna 1 Turcanském 18 Talichovo 1 squalidus 5 Splž 1 Valleti 21 superskalární 25 stredovými 130 venkovskou 2 Tunisany 35 Tante 12 spékáním 16 Starkweather 6 utlumilo 226 Stredoceské 1 Trattou 2 Verberanta 72 Telecí 1 Šusinsk 4 Tritonem 1 Tulerpeton 6 tajemnosti 1 Testdisk 1 stratopauza 6 taxikárum 26 Spišák 1 velodružstvu 4 venuši 21 variations 4 Tominaga 3 trichinelóza 1 Tuulen 2 sudlicemi 1 tarnowského 1 syksyllä 6 Tatijam 2 Tixador 2 Unertl 6106 Sport 2 Trivy 1 s ministrem 2 tožském 1 Vavau 1 Verstille 10 TRL 157 Standartenführer 2 Uverí 1 Sukaria 1 Typovský 35 Sulam 1 SunnyBay 1 Štalsem 3 Uan 1 Theodosiových 34 Telescopii 1 Vallly 1 theodisté 23 Úcty 1 Tverrfjellet 1 useklé 5 Stablinski 3 Uchovala 1 Vaikuttajat 1 úzlíky 1 Stafylokokové 36 Torgau 1 vednéeský 1 udviklingshistorie 2 Spyropoulos 17 Trainor 2 torpédovitým 1 Törökvész 2 S Bolognou 3 utatým 3 Transición 1 Strednák 77 stydí 1 Tribalism 2 speciellen 1 Telekiove 7 Stoicheia 1 Tularda 1 Trauber 1 utines 3 Transkanadská 1 Tomoegozen 4 vagonzaku 3 Southa 1 svatopetrskými 1 spoluvezenkyne 7 substancích 1 Utloukl 1 Trepalium 1 splnitelného 18 Tušija 4 Vašínková 6 špíz 1 Theorieen 1 Tiboni 5 TATRAN 3 Tschörner 12 Tasmánci 8 Tőnis 1 Studentsky 1 symptomatictí 1 Tížil 1 Tošecké 1 ultimam 1 Spongiosperma 8 strihovou 300 toužil 1 s kotelnou 1 Švédštinu 3 Tumové 1 Turjaška 1 Tadamun 1 synchronous 142 španelskému 12 Tympanum 2 Trikojis 1 talte 1 Stellyiny 5 Td 24 Toi 1 Swenker 1 Trismegistem 122 tulák 1 Verschraubter 4 Uznávané 1 ukrytelností 2 Ufská 1 technogenních 13 umuceno 1 Thórshavn 1 Trainel 3 toulava 1 Tammsaarovým 1 suberát 2 tranzitujících 2 strhujících 1 submontanus 10 Trkal 5 stoliczkanus 1 Thomasen 1 Tjujamujun 1 TRIZAP 1 uherskobrodských 2 vanas 11 Uvítací 1 sudovém 1 unverwüstlich 8 Splátka 2 Vautebis 1 ureo 1 streptokokový 5 toekomst 2 tenebras 2 Ubivame 5 s nejvyšším 1 Tursak 1 Traumatologický 1 Únion 1 urbanizacne 2 Teutschenrust 15 Spi 1 Sychrovou 1 Temnozor 2 Twainove 3 Tsakiris 30 velkoprostorových 2 spotem 1 Spinelle 5 synklinální 13 útecích 215 Trebonsko 1 Treichová 17 Ura 2 transmisního 2 vélocipčde 1 sufijském 10 tenkostenný 2 temperovaným 1 Stajki 20 tobogánem 109 Timonen 6 Tamburello 5 Tká 6 Sufi 1 spermatickým 1 TYPICAL 1 Strejckovi 1 strangulací 2 Toulavou 3 Trénujte 1 tachyfylaxe 16 Šrám 33 veletrzích 2 Trimoël 1 Spívalová 1 Stangové 1 štetinu 270 vak 2 technologií… 1 Velíkovým 6 Stalingradskou 10 uváže 1 Tolsky 3 Streckenbach 1 Vancsa 1 tride 10 úponku 4 STDIO 4 Štrkovec 1 Treletsch 30 Vartenberkové 12 Ustrone 1 Urbinove 1 termoakustickém 1 ureu 153 soutesce 1 strihající 28 Študlov 9 Váchou 9 Strevícník 3 Synácková 5 Vadkerti 1 trichloramin 7 stíral 2 Valmitjana 3 Titch 1 Tróovy 1 Tarichey 2 Stonožkovci 2 theoreticae 2 Tannoudjim 1 Tüntenhausenu 1 splétanou 1 Tetragonotheca 7 Staphyliniformia 1 Šumovskij 1 Urvillovy 1 UPANIŠAD 2 Turvas 1 Šuda 1 TICHO 2 Tristramem 5 uhýbat 3 uustai 1 termosetický 18 Velkým 1 Ugrekhelidze 1 Thirunelveli 2 Valdemarovu 20 úmluvami 1 Trofimovi 6 Stádlece 3 tias 15 Šumvaldu 1 vasalem 1 Stemetsbach 2 tegit 2 Svaneke 1 trinidadských 1 Sphenopholis 1 Uprázdnená 9 Srnín 1 tystna 1 Stenkilovou 1 unfreie 1 Teplárnou 70 sprežka 1 triow 44 utrhne 4 Tresserve 1 Turnerliederbuch 12 TSE 1 Štípac 1 Tmavocervená 1 Tolperison 1 s USA 3 Treffenu 1 vandervinneni 1 Universitaetsbuchhandl 15 Urticales 109 ušetrí 1 stýplari 2 Timšer 7 trpkých 17 strojárne 1 umných 1366 tanky 3 Trophées 1 Stretched 1 tallér 2 tríadresný 2 uhnali 2 Unterschichten 28 Stadionul 1 střrste 1 Strandovou 1 Stueckelberg 6 trikolorou 13 vehlasem 1 udáví 1 Vajany 1 urychleností 3 umeme 5 Synthliboramphus 1 Treufelsu 1 Szólj 1 Tlili 11 tuhému 1 svahováním 1 Sparafucileho 1 Strádalský 51 Soužití 24 vepsat 1 tasmánsko 1 Swieqi 1 Takaura 1 trikosan 1 uvádecími 4 Tross 1 Úradování 2 trativody 3 Upíru 1 Varesano 1 Varischini 328 tvrzením 1 ufských 1 Turan 1 Straßdorf 5 Tragickým 1 Venicky 11 tcha 1 Stredoškolacky 1 šungitu 3 umbrijský 1 teriekke 1 stenogramu 5 Tedeschini 1 Talvinen 1 Väärää 7 Touloubre 1 Togtova 1 Talavašek 1 temnosvitového 42 trineckého 1 Stilleovy 2 st 1 Šumma 1 Thorpovou 1 Sureté 1 updater 6 uloupeno 1 Vadaktis 31 ucítil 82 Ussuri 1 Titanotricheae 6 Surville 1 svtelneho 8 stykacovou 2 Trojstupnové 1 tohodo 5 Uziela 1 stendhalovsky 2 triarchie 2 superhydrofobní 4 Starym 2 Štáflove 7 strašidlá 2 tešetického 1 Täle 2 Uldin 1 Thorfinnovy 1 trešinky 1 Termitový 11 trubicovitá 20 Tano 2 umorí 4 Tungdila 1 Vedžahorresnetova 1 s Danem 1 Sroga 2 Uncasville 14 Trincem 8 Vavríkem 66 souperuv 11 Uchida 1 sracková 14 symbolistní 1 specialistéI 2 troubená 1 uhligit 1 spřrre 4 Tucuruí 8 Tešínských 1 Topalang 1 Tiglieto 1 tidžáníjském 34 tradicionalistické 3 Tromostovje 8 tmavo 1 surreálností 3 Travenec 2 varistoru 1 Thákurovy 4 Varupis 1 stotu 9 tuctech 5 verzatil 1 Steyermark 1 VanZantovy 8 Sowetu 2 Velekneží 1 Stylemys 1 teoretizovali 3 Tetraodon 1 Vallverdu 1 sukýnky 1 trojmanuálové 2 valia 1 spshol 71 Torun 1 Tergessenem 1 suebicus 1 Taravelle 1 triboluminiscence 4 usvedcovaly 1 Tarnawu 3 Tinamy 3 Triopsidae 2 starobu 1 svíráni 1 synsedimentární 1066 statku 1 Storferem 1 S urcitou 2 sparringu 1 težným 2 švýcarkou 5 thigmotropismus 1 Švagrovská 1 Trhomenské 2 taureau 1 Vercin 1 Traylorem 1 Stirone 173 VEB 11 travinách 1 Šuadit 1 Trétos 15 svítily 2 tavernicalis 23 typologií 3 Straubinger 3 Véjí 1 spútaných 1 stredoproudodé 33 strepiny 2 tawallammat 2 šunt 1 Transaviaexport 2 uložišti 1 Sulwald 2 Surratt 37 Tiril 1 vetríci 7 trhavinami 1 toponomastiku 1 uzurpovány 1 svrchnojurském 20 Trebsín 10 útulnu 1 utlacovaném 2 Thaletovi 1 Steagul 2 Steinfest 5 Trebovských 1 tuzemáku 2 terasového 1 srovnáte 2 staršovstvem 1 úponce 1 Tepetlaoxtoc 2 Vámbéryho 1 tyúkhúsleves 4 týn 19 Stazione 35 tunelových 1 ÚDDP 1 traversála 1 velkokrížnice 2 ungewöhnlichen 1 toponymicky 1 Tulendibayev 4 TRIMCO 1 Únanovky 1 Tarciryana 3 uccellatori 6 tektonicko 1 Tigraju 2 Taegon 1 Tmavocerný 1 Sundřya 1 Unvert 3 Trauco 99 Valéry 2 Valpurgou 1 Starokrestanský 1 Vejvodovský 1 Tilluma 2 Tavistocku 2 Tluk 18 SPFFBU 3 tretinovými 1 Syncarida 3 trichy 6 Souroubea 1 Temotutafa 3 spurtér 9 UTV 1 Stallmanovi 2 tlacících 3 splývavými 1 Tagtägliche 1 Úcty 1 sprossende 1 s napr 10 Sumac 1 Vágbestercze 2 trjavnanské 1 Taffu 29 strojovnou 27 teplokrevní 1 stutecne 3 stymfálských 12 toužíš 1 Tegi 6 Telegdi 1 tetraboritanem 62 Toleman 2 uvedel 1 Strenberg 22 útrapám 1 UQAC 1 taiwanskému 6 Turambara 1 VeRa 1 Syntagmatický 1 Tagascouita 1 s operátorem 3 Stretchin 12 užitý 1 Temlovy 40 Tchajwan 9 vazných 1 Tuxského 6 Valdštejnsko 2 trichromázii 1 Trackable 1 Valentýnky 3 Stancho 2 uhlazenému 2 umistovanými 1 varadínskou 2 Trialestes 3 Speichersdorf 3 Tietgens 65 Útvaru 2 Szafran 1 uživeníschopné 2 Svetlocivné 1 stanoviv 1 strednevlákených 4 Tarigo 1 Staedtler 1 Trojciferná 1 Tetraponera 320 uhelné 2 terciové 2 Tiben 8 souteživá 1 Uguns 3 Sourozenecká 1 Svoboda† 13 Údajné 1 Sparattanthelium 2 trialistickou 3 Válecky 1 Talbutal 13 sulfonová 1 stylu? 3 tundrovým 1 Spamming 1 Teheráne 1 velkopestitele 1 Tanagre 4 trípodlažním 2 Trošcilo 1 strínce 1 VBLDb 1 Sturmbanne 2 Tiendalli 1 Vallace 31 Sportovním 4 stroboskopická 1 Velehade 1 thomisticum 5 Sutaju 11 Synoptická 9 stredolevicová 1 Verschluss 16 Unum 1 utkávajícími 1 Suyumbika 1 transcaspicus 1 svetríky 31 Vertumnus 1 Speedreading 1 trígólových 1 Tleskejte 1 strílíš 1 Torretty 2 Turkington 2 tusculských 1 Tuchkova 1 Velkolosinská 1 S M 2 Taurulus 2 upažením 13005 spíše 14 spikleneckého 23 Staroceský 2 starických 1 tentorium 1 vededcké 3 Steinkohlengewerkschaft 21 Vegetaci 4 tunguzská 1 tildena 1 uzamykány 24 stínech 15 Umeleckém 4 Srauss 1 Vaicem 1 tabulkavelikosti 1 strast… 1 Szimfonikus 1 synkretistickému 9 Valerianovy 1 uvázlý 1 Vätergruft 1 tarbíkomyšmi 1 Troddlers 8 ster 2 veršíku 2 stromecku 1 Statárium 11 Uomini 5 tlakotesné 1 Trsteniarka 1 urvali 1 strednezobý 1 Toninová 9 uspokojeni 1 vanhoepeni 4 Velkolepým 3 ÚPF 2 Uy?urq? 1 Veustera 1 Vedrix 2 Tiffauges 1 veritelském 1 Tyzzeria 16 umožnovali 2 Toien 1 Tepecingo 2 Veitíovi 45 UND 1 sprátelíte 3 Velengurin 7 Thompsonuv 4 Tullu 33 Teplýšovice 51 Vaca 1 UDAPS 1 struny 5 sublingvální 1 Tuapsinského 3 Unicastové 1 Špendlíkové 1 taabaggalee 1 Stenským 91 šupinatý 9 Srautas 6 Starouš 2 Thyrsostachys 1 Surdum 1 Upwards 10 Torgersen 2 Thévenetem 1 Stewardson 1 Verulus 1 Thonron 15 Trpík 4 urostlými 1 spopad 1 tabladdo 2 Tulkasova 4 Svorky 1 Stopová 1 velkoríše 1 Stylophone 1 Vaitaire 1 Splachování 1 Titelu 1 teofilantropu 2 Uridintrifosfát 100 teckovaná 1 specialisovaných 2 Trouvans 1 superapple 1 Südbau 4 veetorn 4207 systémem 1 Telecasteru 2 Talyši 1 Stéphaníí 3 Trojáka 3 tanczy 1 sulfamidy 1 Splajny 1 TEREZIÁNSKÝ 1 Urecca 1 Umwandlungen 2 studiovku 1 s hlediska 3 sýkorický 3 Traa 2 tanám 19 umocnená 2 Växande 1 urostred 1 Tombecka 7 Strede 1 Tikwa 17 Telegrafní 2 urbinskému 1 Sternteich 1 Thulského 2 Tanzímát 7 sršni 111 stojan 4 Theodorescu 2 UTIQUE 8 úcinnejšího 5 Strevacská 2 vertibird 3 Stránských 148 sýra 1 Unterschied 434 vesmírného 10 Tannerova 2 Tomasoni 1 Ullukum 1 Stávkokaz 10 superlativu 35 Sterba 5 unionistického 1 s clenem 2 Vancurovým 18 Statistici 1 Tabulkove 1 Totosaiuv 1 Strongyloidózu 1 uzkorozchodná 4 tleskat 1 Suezskéhou 4 Spisem 5 stype 1 Šušnjarou 13 Verre 1 superhrdinskými 10 Uršule 11 technem 1 STRESU 1 versionem 1 tvDetail 24 Tupadel 13 špalíkovými 1 Tsęhesenęstsestôtse 2 sphenoparietalis 1 spoluministru 2 temperových 4 toužimské 1 ultracistém 3 stavaru 6 Štavelotvaré 4 Územních 3 Unglücks 1 SRSR 1 Vešelénimu 1 Termoplastové 1 tríslum 493 Tanec 1 štítolist 1 Teremský 2 trojvrcholový 1 UXY 1 Súsedé 1 Tvali 1 Spiderbaby 3 srovnávajících 3 Svetelského 1 souper… 5 spoludržitelé 4 Târg 1 Talpové 1 Veríssima 1 starokrestanští 2 Ván 3 Vestnik 1 Steinbüchel 14 ucebními 1 Ukerskou 4 vadne 1 uleklá 61 Strašidlo 3 Unabhängigen 1 Tverce 1 sypavce 791 Typickým 2 TEMPISH 1 unášejícího 3 Stilian 1 Usmirte 1 Valcher 2 Ulf 10 UNIXové 2 Thaera 19 URC 14 Stežejními 1 TJchess 6 Tingry 463 stavovského 7 Tiflis 1 Suchdolští 1 Spékatelné 2 Tolhuin 3 Uvažování 3 Turcicis 1 télen 2 sprádacími 2 Traffordu 1 Šwarcburka 1 s?ziždo 1 Turnbladových 2 úmrtnímu 7 Úteku 6 Thallos 16 Uchem 1 Urtubi 1 spekulované 1 Ungdomskulen 9 upravovaného 1 Svojetínu 4 venu 1 valbrišskému 2 Tevetoglu 1 Sucettes 1 Strönberg 1 spolubratru 1 Tarnóka 76 Svazku 1 Tĺget 2 Tipas 2 Thawem 1 Telstaru 3 valencijského 1 srdcovkami 1 undekyn 3 Tomcalová 20 Turbessel 37 tretiligového 1 Swades 1 Terachovým 8 torpédovku 56 Velkoborský 1 Vadimsimona 1 tyasko 9 Štybnar 2 umelecky 2 Tovarich 1 tuhad 1 speradlech 1 úroka 2 s-t 1 vaudevilles 1 trasformazione 18 stipendistou 1 Ternovská 1 stredoskotského 1 transsilvanicum 1 Vaskojoki 3 stoických 10 Stupino 2 Úpadkem 55 svetelnost 1 Stredoevr 65 Streepová 1 Tuffey 8 stéble 1 Szerezni 1 Trombidiformes 3 urbánního 1 Valdštejm 1 Suderwick 14 ustáleno 1 tíu 5 Turnerovo 6 spisování 1 Szerboc 1 Sunloverz 1 úcetnici 1 Sretenovo 8 Tbit 1 Südpols 2 Trevesuv 1 Stephensonovou 5 Trailers 1 Valenciu 2 valcické 10 Stamsnijder 1 tetrahydrid 3 Vardu 2 Velezradnou 1 Tédžpálove 7 Urcic 1 s dohodou 1 Verleyove 38 usvedcit 2 vastoin 1 Szerdahely 1 Taneleer 7 Tigis 1 Veceslav 1 Tocníce 1 tugukesha 1 SpruceUp 1 UTAU 3 Strdic 1 unido 1 Udánavarga 5 umelcovi 1 uzurpované 1 tmavomodrými 1 Theaterstr 1 s nezletilými 1 Théropode 50 Trebonského 9 sredniowiecza 4 vetvily 8 ucineni 1 Stutchburym 1 Sousled 3 Uršulinky 1 Tereshchuk 1 Špitálem 1 streamovaní 1 Verdiensten 1 Uduit 1 váchalolog 1 Thúkýdidú 1 Trwy 1 Thierlsdorf 2 vermiculata 3 TKD 1 trúditi 1 Tradictí 1 Verbesserte 5 verhalen 3 Tatišceva 2 VAJDICKA 1 Tappage 6 Velkovýroba 1 ThePortOfSalerno 1 Urgac 18 Srem 1 unierzite 6 vešteckým 1 synkkä 1 SZTŠe 15 úvodníky 2 Sumbat 2 thagus 2 Tonaud 1 substochasticita 1 Strzelcy 8 tuberkulose 1 Varvare 5 Tow 1 Underhillovou 1 Tougi 1 Ukrajiny Kostyantyn 84 strukturních 8 thomasi 1 Ungavský 2 úi 1 Trevisianiho 6 ústave 3 TWW 1 usazováno 18 tenoristy 112 statecnosti 1 Úrednickém 1 Stavarská 1 trictvrteláníci 1 souperu 1 TextWrangler 1 trojhláska 49 srážkovém 2 tunguzo 2 Štrejnová 1 Tótpelsoc 26 Thráin 13 Troubletones 1 stereometrií 1 TurboDuo 2 tyreotropin 18 urychlován 14 sponzorovaných 57 ucnu 1 s kapalinou 2 spolocne 1 Sukemasy 1 Stratigós 2 trovare 1 Velrybe 5 ureázy 49 trífázové 1 Utmann 1 svižníku 8 Vesterĺlen 2 svatopostní 1 Urmiya 1 Subiecerat 3 Srdcotepec 1 tripterum 18 Tornatore 8 Topolanech 1 Talimaa 1 Uchovskym 1 sveitarfélag 1 TUMPACH 1 Tarony 454 USAF 58 veselohry 16 Steroidy 2 SVOŠF 4 upírského 1 Stomatopoda 7 verbunku 1 Štickou 2 Tricasses 6 vachtu 2 thaumu 4 tonzilách 1 SPAHN 7 Vartová 2 usmívaly 30 uškrcen 1 Svoch 1 ubližujích 2 Tikrítího 218 útlého 2 Taygétos 5 sufražetky 2 unavenými 1 Tišící 1 ululata 1 Strayhornovi 1 táliby 1 tali 3 Taaffeit 1 tangage 2 svorkový 20 stripy 1 Svatoondrejský 1 utopcach 4 tridy 1 Teliszewski 1 Tebartzova 2 Sukhavati 3 Sulejmanovo 7 thébská 18 titru 17 topografií 2 Tobiassen 1 Uchtomského 1 tachyonizované 93 sponou 3 superkontinentu 7 Träumen 1 Tsarsulsa 1 umelé 6 vazník 2 Staplový 62 Takác 5 …ve 6 Teuschl 3 vade 3 Uttlesford 1 spindeli 2 Szurovy 1 Tespijcu 1 Transformátorovnu 1 Udmurska 1 Vestpoketky 562 Ústava 1 stijlperiode 1 tancírnami 1 toastovac 1 Stanzi 1 Stamperových 2 Teprt 91 Ute 1 Trangula 1 verslavend 1 Thyrin 6 uvulou 1 Stroman 2 spáleništem 1 springfieldským 123 stretlo 1 Verrallovi 1 urvanou 1 Stenshuvuds 1 Sunetrou 4 s?vazbou 3 Thürheim 1 tocenku 1 Tithónem 324 telefonních 8 Südhof 1 Venerandum 1 Twinnit 1 stupnováno 33 tetrix 1 sušumne 1 Stinkym 1 Tverecius 1 Syllas 6 Trebova 2 štúrovského 1 vápenocementovou 1 Trillon 1 Stalosc 450 trvaly 1 svedivými 7 Ukradli 1 srr 3 subfosilií 1 Tremarctinae 1 Švangmajer 19 Tracník 1 Szamorodni 2 turóne 1 Stracathro 74 spolumajitel 1 Uroum 44 totalite 1 Typornamento 1 Tschaikowskij 38 Synková 1 Stellnerem 2 vbudoval 3 Vachtangov 1 Strymonské 1 Strober 1 Terekli 4 transsubstanciací 1 ڞasnákem 2 Stampfl 3 Stecko 6 stdio 1 Suomusjärvi 1 Spreitenbach 1 Tapolské 1 Vasylshev 3 tigr 8 Stola 1 StaSi 2 Védalla 2 Tachsi 3 Utua 2 vescus 1 triangleadj 7 sufragánním 1 Švábenictí 1 Veldsman 1 Trencsiner 1 šterkovitost 25 uchovaný 21 šrotovník 1 s výchovnými 1 stodvacetiletých 2 Spegazziniana 5 staty 1 ungefähr 1 Tozrní 21 urogenitálního 1 stodesátý 1 svatometské 4 Teneniai 1 tornata 5 stejna 1 soustvy 1 Stríhal 1 Talvéna 1 Tešte 19 topografickou 1 Valdorfka 3 utilitarista 1 umdrehkreisel 10 Synkopa 2 Velerak 1 spiculatores 4 STEZKA 2 vendické 1 Tauscheck 1 subdiakon 3 sover 1733 umístené 1 Tuncat 1 Spoluprekladatel 18 stíhacímu 1 Svetovine 22 uzákonil 2 spoluvyvíjet 12 souteživosti 1 Tegucigalpou 1 Tožtak 8 Strypa 2 Uthmánovi 13 spatra 21 Stamicova 893 stavebního 1 trippelalliansekrigen 4 uplatnenou 1 Tóder 1 uvrhnnul 5 strakonická 28 Swagger 1 s bakteriemi 2 squdrona 30 stélkou 5 Steinbeckove 4 Thevet 2 speravit 1 Veidtem 49 UTP 2 terrć 1 s verejností 1 útrední 1 Thyestese 1 Syms 1 Tmavozelený 1 valorizaci 404 Tung 1 ustouplá 40 velkolepém 1 Sprühregen 1 Unnerstall 4 Ulángomu 1 Szyja 6 Surcoufa 1 Tibba 49 transparent 1 Tenaserimské 1 Torrres 4 štepanické 1 spamove 1 svrchnepláštových 1 Tremontu 41 svedcilo 22 Tarvastu 2 Tešicemi 8 úhlopríckách 38 Truly 1 spolecentví 1 Uaa 1 uryhlene 5 spadlými 1 Telechips 1 triplárne 1 Vekem 2 Umsiedlerlager 1 Uzlouna 4 Vermikompost 2 Tosun 1 spanu 1 úcastnlo 16 Stempel 1 tumoriformní 1 Varvodicová 11 únosných 1 Spocítáním 10 uvítáni 1 Toneliiho 17 struk 1 torosaura 1 SweeTEST 1 tetrevum 188 TýTý 1 Strudlhofské 10 Stavaric 1 supertenké 47 Tumy 2 Uhtna 1 telugská 3 Vestini 2 Stelen 2 tubulinových 6 vejcoživorodí 3 Ucenliví 1 Üchtritz 2 Uljanových 2 strížkovskému 1 Tonksovi 77 telísek 1 vermanung 7 Treo 3 Tigranjanuv 12 vedcích 1 styletovými 5 Természettudományi 1 Szuc 11 trískové 1 treskvadragintilión 1 TNP Ceské 3 vejcovitým 1 Vernakulární 2 Staronúbijština 6 traumatizujícího 21 Symfony 1 verzeychnet 1 uvádzate 14 Uhrínove 8 Trebarova 37 Sterzing 1 stacatto 1 Tancující 2 unripe 4 uucc 2 Stavebné 1 Túlavý 1 Thuringen 18 Suduva 1 Stĺngby 2 Thuryho 8 subtilními 1 Tavoru 1 Telemachovi 3 Váhání 202 vedomi 1 Twos 1 Uriou 1 Svetozár 1 tetrachloretan 1 Suvirkšte 1 Vertovem 1 Štírovníku 1 Steckverbinder 6 tiempos 1 traan 3 Tretjakov 6 Tunisané 1 trestací 1 Trípásmovém 4 Spojenie 1 Tzuk 1 théâtres 2 soupaž 1 Ureterstent 4 spodnetriasových 1 svetovým 1 Uronen 202 Uhríneves 1 táborákem 8 Urickij 1 Sparkys 21 tmavšího 5 Sviby 1 Tibonidu 6 SPR 5 urcenosti 1 Sprungdeckeluhr 1 strajku 3 Strimicích 1 Sphenophyllaceae 5 Sudetenlandu 1 URRUTIA 7 Trolda 26 svetlíkem 11 Straker 1 Uskladnený 43 uhrál 1 Staršovstvo 1 srednego 1 Sveningsson 1 stodvacetimístný 1 Veldi 1 Tilladéri 3 ? 53 tavidlem 11 Stricko 2 Taratynov 46 tarifem 4 sprinterum 1 terraformovaných 1 unwahrscheinliche 11 variacním 1 Toboganu 17 Tronícek 5 Tekstilšciki 1 SURFACE 1 úsilích 2 úcastnickému 1 Tresoucí 1 Verflechtungen 6 tádžickou 4 Tloustnutí 4 Sturmbann 4 Vetšinove 1 Varanjouský 1 stupiditu 8 Vendome 2 s povodím 1 Suscévaz 2 Soundsystémy 1 Vaijsfeld 111 Teige 2 Surka 2 tovacovském 15 Stylová 1 Thérivé 12 ugeltechili 1 úctyvzdání 17 sverilo 7 ujmutí 1 s krestanskou 1 Talaq 3 Verina 1 taktickotechnické 1 trívrtulový 3 Treaties 11 Turdidae 1 Trumanu 1 VEDU 15 triedy 1 trvavším 8 Trojkoalici 2 úrazovou 2 umožneném 4 storukých 1 Ultharu 3 Trockener 1 Sourozencu 1 Valentinis 1 tlesna 1 tiology 1 Taranise 15 Starorectina 1 Tweedové 1 Stríbrníkem 2 Stallupönen 1 s Emmanuelem 4 Šumera 1 umschwärmt 4 stolárny 2 Strelickou 1 TIPY 1 Taušan 1 sovestké 2 USWA 1 Stolarski 6 Vefa 1249 Time 452 stromem 6 Tarazona 83 Taaffe 2 struvitových 2 Trachau 4 vandalskými 1 Sulislavem 1 strouhány 1 Tyratron 1 Tŕpiesem 4 trucks 2 Tranebjerg 55 testováno 26 Uzeir 27 Vásquez 1 Stukes 69 terária 1 Vešelínovo 2 Unnumbered 1 Stadtherren 1 statigrafických 1 Úchvatná 12 tmavýma 1 Touray 6 Velleda 20 svetelností 1 strihnutí 2 tripedální 1 tahostrih 1 udinského 1 Vechingenu 4 Teto 23 suverénem 1 Succubi 10 Varčseho 102 usoudit 5 Vesmírané 6 Velština 456 vesmírnou 406 Vek 1 Suaviter 712 upravit 135 Trója 1 Tancarvilleský 2 Švadlenková 1 tríkolých 3 trouchnivého 1 ueberschwemm 37 strune 19 ustavených 1 Valamera 8 syntetizovaná 2 Storvätteshĺgna 2 Újhely 2 Tonello 10 strahovští 1 ustrížené 4 tenens 1 velikden 3 Šuplík 33 Vergine 1 strední jury 1 Vestenic 8 Unterthürnau 1 Suratger 148 tvoreným 1 unadnil 27 srážet 4 Topolcian 2 Tamîioasa 2 Sozanským 1 Suzukui 13 Šprincl 1 sveteckou 3 veränderte 1 Tunchinensis 1 Vaségeto 21 šovinismu 1 Taxmeny 2 Štanclova 14 velkoknížectvím 20 UFF 1 Stojit 1 Táhlickou 7 Štabrnák 36 trčs 1 Teórie 15 Tinville 3 Vámana 3 Vetëvendosje 13 Specifickými 4 velínem 2 trínožové 1 strigulosus 1 Unterfrankenu 5 VERZO 1 Thúkydiduv 4 utlumovat 1 ucikomigeiko 1 štepánovský 2 tanycytu 1 Tridentskou 2 údesného 101 Vatikánem 1 Starovatov 2 tajchem 1 Štorku 1 spasitelích 2 Succulent 1 Vernírovicemi 40 téct 1 Tolstich 6 Spínac 1 vektorama 1 Vegastar 3 TRAIANUS 1078 TM 2 Umajr 2 Tatarskij 4 Unterseen 1 trumpetovým 1 Stenn 1 truchlícíh 1 Uuôden 1 Utrius 1 Tehovickami 1 tmavopurpurové 2 Tiarnaglofi 1 Stenzlem 1 Sweetý 1 Tyragetu 74 únosu 7 Šustrovou 1 s tehdejšími 2 ustek 2 týrovského 5 trosecníkovi 1 t?i?kwe't??nto 1 udýchaných 3 teara 29 superhrdina 40 Sovetskaja 8 upadání 2 Tribehou 59 tutte 13 Tollána 1 Šplechtovou 4 terranské 5 urbánních 5 tío 1 Stavropolskij 1 vesnickám 1 usm 1 stereomikroskop 1 vBrandýse 3 Vamberic 2 strapacky 10 Unda 3 Tsolgu 1 Trapezuntští 1 Topaševskij 1 Tveskägg 19 trídnímu 1 tvuj Buh 4 Sullivanuv 2 Ubytovaným 1 taloksi 2 Teilhardovo 1 vécés 1 trojkombince 1 tornar 1 Thiemel 1 Tirechtach 13 Tarraschova 2 svazáckým 19 tgz 11 tercových 5 Umino 1 Úkolum 1 urknul 1 sýteho 49 UHK 5 superfosfáty 2 supersaura 4 Stroszek 2 Szakmary 1 tetti 1 vedlejeí 3 VAREX 2 spletu 8 Turteltauba 1 TRANSMESA 17 Trastámara 1 Thanatonovi 1 Steinbhlink 2 TAPPI 1 Tinzmann 2 Terlický 3 s nejakým 62 stesk 1 Tauschuv 2 srnek 1 Valicna 2 sprawedliwosti 1 Tshilidzi 1 trolejbusov 1 Stríleli 1 tolou 18 tabulového 3 tojon 1 stoljece 1 Vergilovi 2 torpilleur 26 týdenník 6 Verpilličre 3 tendencností 1 Spoletina 52 Uvarov 3 Štírovníky 2 Talsperrenbetrieb 2 Typic 5 sulfanové 1 s renesancním 1 Strímelic 1 Verián 1 Stankar 1 Veteránky 5 Steigerwalda 2 Utešených 1 Trulli—Kovalainen 157 veselý 1 tödlicher 4 Subotice 4 Tappeh 1 souzníval 3 Spectateur 1 stargadských 1 Tiriacem 2 subjaderné 3 tripoli 20 tanin 2 subreddity 3 velšsko 1 Vailancourt 2 Utíkejme 8 Svetanápravce 1 Subklinická 2 Suffrena 5 Turanoceratops 7 velkoplošným 2 uspaná 13 Taito 17 trojlist 2 Transiturus 3 švihají 45 stažených 2 Tnorala 1 valchovne 12 Verovické 1 Szmrecsányiové 6 Vaderland 1 uruguajská 2 superfosfátu 1 Vaupes 2 Šuvara 1 Strandu 1 veleúspešnými 1 suvoi 2 Trípísmená 13 úkrojek 45 teplotními 1260 trojice 1 termoizolacními 3 synchrotronové 1 Strešneva 4 Spiessem 1 upracováni 1 ústredích 2 trímala 13 Svilajnac 4 Tammám 1 sršána 17 úkladu 1 Tyru 1 Trannish 1 thisma 1 Tornabuoniho 2 transmitanci 1 suktán 1 Valdemarssona 1 sympatoblastomem 1 S úsvitem 20 sprinteru 2 Tchorík 19 Tašilhünpo 3 trianglem 1 ulce 3 tetrafluorido 1 Tomonoriho 1 souznacne 20 UBC 1 Sürucüsü 10 Unikl 1 stereoregulárního 14 TFSI 1 ustavuji 5 Terminologia 1 Úplnky 1 Swabow 1 sp횅 19 telegraficky 2 vampir 18 Verneta 2 Tertullou 7 tilápie 1 túnel 4 Stredokluk 1 tuonnuzin 1 Trinitárov 1 Tadeem 2 Sredzki 50 Tutanchamon 1 Veerským 16 Tattva 4 venuj 1 vetchého 1 ústínští 7 Tamiš 1 Ubaldem 16 Tyndarea 3 Superfetace 1 Sulaimánovi 137 upíra 2 tofalarština 2 uet 1 s potenciálem 1 Thrasybúla 2 Teaches 15 tunemi 1 tóma 1 Spieltexte 16 Stillaguamish 1 ukonczenia 21 stredozápadu 2 Tepperovo 1 suknového 1 TIPPNEROVÁ 1 Trotwoodové 1 Urnerloch 1 Umskupáci 5 Ubehlo 1 Ulšic 1 štípák 6 Sverenské 1 theflaneur 1 Sukopová 2 Tenkovec 9 syntaxonu 1 Tentet 99 Sukot 2 Szank 6 velkorozmerových 2 ukazovacím 7 Tobina 1 Tokranow 1 uzdickového 2 sterk 1 Tešova 1 SOVRKH 1 svetložlute 5 Tachymetrická 1 stredoplatónskou 2 Straf 1 s Kalvínem 1 TPU 1 tremi 1 stiskáním 1 Tongerena 1 Stalhein 1 undecilión 2 Stögersbach 1 speditérskými 4 stoupnul 1 Trumblem 1 Stirnerové 3 suif 1 Taoudenni 10 Théseuv 28 sprievodca 1 Turkmenia 1 Trdlitát 1 Tyrii 1 ttokkuk 618 urcují 16 veselejší 1 Sperlingovu 3 uživ 3 Svislou 4 Steev 1 sporocystami 1 uelov 16 Thränhardt 2 Thielemu 1 Strikera 1 Spletta 2 uspejete 41 utajovaných 1 uzpusobilo 6 spacáku 1 trojprevodníku 1 Topalovov 1 Tiemblo 1 Style— 14 Swietokrzyski 3 vef 4 Steatoda 80 symbolismus 12 tichooceánském 1 temnostních 5 taxanu 2 stereotaktických 44 Táboru 1 Staatsrechtes 1 Steve Rash 2 Strongovi 1 týhodni 1 Trochcinskij 1 Tinarie 1 Udrce 4 Tušina 4 Toinen 8 trávozelená 105 umeli 2 Turanský 1 Trissie 663 systematicky 2 Susanoo 1 úpadí 24 srubové 33 SVET 5 ujcena 1 tekiye 1 Tiveriopolis 1 trojhvezd 1 Toperczera 1 valchám 16 Souradnicový 3 Stinná 4 Topece 1 veebruaril 1 Spiculae 1 Tavasol 9 syrštinu 1 Subkarpaty 1 Tunneyhoa 1 torbou 59 sušený 1 Sozialistengesetzes 1 ??tankové 32 VAVRÍNEK 1 športovca 30 Spojky 87 Údlice 5 tiszapolgárská 1 Tepsurkaev 1 Vankarem 1 Staffordovi 2 Trínožka 5 tchuej 152 Tetín 1 Torremolinská 1 thiokyanatanového 1 Šubnikov 1 subalpínským 1 Swäto 1 titanaty 1 souvisliosti 1 těhuáng 12 Theodosiuv 1 Taliferem 1 Tlakomer 1 Švenkovi 2 Thelven 1 Steinmannii 54 temnota 1 triethylester 3 Stríbrne 33 Ústecké 1 Varenskou 1 Tungabhadrá 1 Tüšet 1 starozytnej 1 Theodolinde 1 Stafika 1 Úrazovému 1 Takuem 1 Sterbu 6 Umelcem 1 Tomaselliovou 2 ústredná 4 transakcními 14 Tancrčde 18 Špiler 1 Tionga 95 Túrin 16 Unterwegs 2 tantrics 1 Spirové 1 Souzové 18 srážkovým 1 štechovických 1 Thymoitos 1 Švamberkovou 1 tasovskému 3 uherskohradištských 77 Teilhard 1 spínajících 1 Sperlem 1 spinningovými 3 verres 1 s Cínou 1 STDOUT 32 stopovkou 17 Topolovka 1 Suro 1 vatinkánská 1 Stimulované 1 Tvanárchu 1 Thaumatopteris 6 Thurier 37 Talmon 1 Šujster 2 subnodulosus 4 Vadžnes 2 tows 1 Trutovského 10744 typ 1 surjekci 3 VARIABLE 1 stokilometrového 2 veganky 1 Tretogor 1 Sweelinckových 1 ubližujeme 1 Spajsi 1 vedlejšák 2 Vasilca 1 Swatmarama 2 svižnému 9 ÚSTÍ 3 sploštelým 16 torpédová 1 Temínovi 1 Valvetronix 2 Vaduzem 2 umístitelná 1 Thoo 1 štikozubcovitých 1 transpoderu 1 Tavag 1 Stratheden 1 Treplevovo 1 Sozialliberalen 2 Trenal 1 strumektomie 1 ustavováním 2 Vepríkovem 9 telení 3 ublížilo 1 Spezzou 5 strukturovane 1 TMAVÁ 2 spicky 4 Tcu 1 twopiece 3090 státního 2 Štarovice 11 špalícky 19 Thomasu 2 ڞasnák 7 Újezdského 4 Sugestibilita 43 Udržitelnost 1 Theofilovou 1 Thierberg 1 Succé 10 tygrice 3 tarczowy 3 Tabb 1 ultro 13 Tommasa 2 Topografickém 2 Swiftuv 1 Tejle 6 tríkolovou 2 Swinkovi 1 unexpected 1 Spín 2 svatokrádeži 1 Stránský 1 Tadelech 1 Suurbeckovou 3 Transporation 1 Srstnaté 15 Tijani 18 stmelení 1 uskrípnutí 2 Tomicus 1 Succoth 1 ŠTETINA 11 Vajnorské 4 Thémines 146 Strih 4 Tarrasche 6 Tacitovy 1 trísmenný 2 Sutherlandovy 1 stredostavovského 14 uhne 1 Speuclairean 384 Staletí 4 Vazká 3 sutoviskem 16 Terengganu 1 Vavryse 1 tropení 6 Uvede 3 taveným 1 Staroboleslavskou 59 staromestského 2 Verismus 47 úctuje 1 úchytku 1 Vassilim 1 Storke 1 trojovické 1 spamerské 67 Švédského 3 Steinerovou 1 Szalánci 28 typované 13 subdukcních 6 Valentkov 494 spolupracovník 1 Suboticem 1 Štembergová 21 turbovrtulového 131 Štadión 4 uplavou 4 stába 11 Túl 1 Swiecko 467 úplnou 1 Tragigroteske 14 tenoristu 1 tájvedelmi 3 Tortes 23 Truksa 2 Sungje 8 Tusa 1 Turnajsacung 1 trojsingel 13 uzamykacími 7 tortoise 2 tichooceánských 4 varadínský 3 turbe 1 synthezátorovým 1 štíp 1 Steinhäuslu 1 Vetrnojeníkovsku 1 štandy 1 tabletovým 1 Tanibouca 1 Universtität 6 Tenochtitlanu 17 špicu 1 VBU 25 ujednáno 5 umm 1 stredosussexkého 15 Ucunomija 3 strojopisná 170 udeloval 1 Stralau 1 sporicu 1 Starcasteru 6 Ujímá 1 SSIC 4 Tovarishch 73 týdenních 1 Vartemberkova 1 TotalFilm 3 Uvážlivým 1 Urbaniho 59 Stával 1 Tengwaru 6 sulle 1 spacek 2 trimér 2 tongo 3 tyr 4 stíná 1 Taronga v 1 u hejtmana 1 Trillat 305 svetlá 1 Technicka 105 torpédoborcem 1 valtinovké 1 šuei 12 Usnul 1 Ulipi 1 Urđa 1 Torsma 1 Venity 1 Turkmenem 4 sprattus 2 Valmorová 334 Ufa 2 Tido 3 utopia 1 Štrompachovou 1 Tatarovce 10 Varma 2 Starova 1 starostovým 1 STUCHLÍK 2 uchvacovací 104 spadajících 11 Štetínské 1 Tvaružkách 3 Troškunai 3 Vaneckem 3 turbokompresorovými 42 Spilka 1 studentów 77 Tonym 1 Tlesknete 1 sviních 1 stehlik 15 Strassera 52 vecných 1 Sujetas 1 Thompsonovým 1 Thelocarpon 1 spotrebovatelné 4 Vašíckova 4 tamašku 1 Torilda 4 spoluzakladatelky 1 Svatéto 2 Švédovy 1 Vasselli 6 valentýnský 1 Stunned 1 tajomnom 16 uschnou 3 Spielmannsfluch 9 Tvurcu 10 TeamSpeak 1 Tarotem 1 Tarmem 3 Talibu 1 Vectivusovo 2 Tolmaceva 5 trídic 1 Svižným 1 Tosele 2765 typické 44 uspokojivý 2 Takéž 2 Taliedo 1 STANEK 3 Thujopsis 11 spikleneckým 1 Tatiánce 155 upomíná 5 strhala 1 varientní 2 Tinning 1 Šterbohol 26 spotrebovaného 1 supercohort 1 Tutky 4 tartanová 1 tajnustkárskými 160 stacila 3677 ukoncil 10 utrídil 42 ultimáta 1 sverepý 1 Trinius 1 Thuidiaceae 1 Travancore 1 velkoklasý 1 Tokuo 1 Thaddeusi 1 Sutedonemeckou 1 Svajunas 1 Tanecníce 1 Suboficial 1 ultrabežec 1 Traiguén 3 vestavovat 1 Šukenu 1 Takahašimu 3 strážmistrovi 1 sumativní 7 TTY 1 trísekundových 6 štetickovec 2 sžívá 12 varius 1 umožnovaly 1 timmen 96 Tvrze 1 Tiencinská 1 Transliterací 7 Takemitsu 1 Tachého 2 u Ceské 2 Torugartský 1 Udce 16 Tolbacik 2 ti? 25 tríkolové 2 Teinainano 4 verlegt 1 Trenovovi 1 Trojskokani 1 Utešenje 1 Surýni 13 Soustov 6 Vedce 1 Veonsho 1 Tŕijí 1 Torgaj 4 Tettenwang 1 trojznaký 48 spolecenstvími 104 technikám 1 Vaspataka 1 Univerzalitou 2 Tumarkina 1 Szczygielski 1 stavbyvedoucími 2 Štanclovi 1 ulomeným 3 Uhyst 1 šterkopíscité 2 Tehotenské 1 Varlaama 1 Táp 1 Tailwind 3 Tucciho 2 Talbotia 5089 srdce 1 ventriculis 5 uverilo 1 thilib 2 Stocleta 1 USSDwight 1 Šústové 7 stereochemie 1 urychlovaným 4 Tetons 1 stadhouders 1 versantibus 1 trepanována 675 trestný 3 Trpytivých 1 Sundhaussen 1 Trautgespielten 1 tucnicemi 2 Subida 1 UEFU 14 transuranu 3 Svrženému 2 Stežejka 1 usílující 3 Valbelle 1 tweakovat 12 Strojírna 1 surrucura 5 Stornoway 1 Tremošnickém 74 Tapestry 2 Thaijsko 3 Spitzem 13 tanca 4 synaptický 1 Transjordan 1 Tossatto 2 Tomomoriho 1 Titima 3 termobarické 1 troparem 1 Tuháru 2 telaru 1 VeFeRák 1 Tanout 1 štítaru 3 várkou 3 Tarra 1 Testcomu 139 Uvedl 1 Tojamský 1 vesnicezahradka 1 Ultramar 1 tramways 3 termomagnetický 2 TETHAL 3 Superkritické 82 Stríbre 1 Ustohalová 75 tet 1 Tarbiensis 1 Superflu 1 velkoruskou 22 Syrie 1 Tscherlaken 1 Spratling 1 stupidite 1 sublimované 1 Triptiser 1 Spaete 160 stíhán 7 Teamgeist 1 Tsepagme 1 tyrozinkinázou 1 VADAS 1 StarBus 1 sviecka 1 Verchnyj 1 Vansteenberghe 1 šurikenem 1 Sulemana 1 sufragánnu 6 TTTM 1 Sperlovo 5 Trebbie 1 Suggestion 1 sulfhydrylový 1 Tarreho 3 tisknutelnou 1 transpress 1 Trenchiniensi 1 stemospironin 1 Velthrandosovi 1 ubajdská 3 Tugenden 13 trojná 17 udusit 5 vdechem 2 Trevesovu 1 španelskýskladatel 68 Spolkovou 5 Taraclia 4 ušity 2 Varelou 3 Trilbardou 5 Tillenberg 1 utrápit 80 uplatnen 14 sprátelená 1 tekodontu 1 Vándorlegény 1 stíha 1 Thyatirách 1 Tekavost 2 Tantalovy 20 udávali 2 Sswamberka 2 trojclence 54 utopili 17 Strass 4 Urumština 1 tríapulletém 2 vclenily 2 Tidsregning 206 trávníku 1 štítku… 17 trojlalocnou 1 tilos 20 Týnu 20 trojclenné 2 superiorátu 1 Tatáno 1 synostóz 6 strychy 54 tranzitního 22 studovne 1 Verhülsdonkem 9 vážkách 1 ustrnuvší 2 Strejckové 1 Trewartha 1 Vajfert 2 Trefený 6 stacionarity 1 Štikou 2 tríválcem 5 Strimpl 7 stearin 1 Vécu 40 soutežím 1 VARTE 4 sulfátová 2 tvárili 30 Trouin 1 VAŠINA 2 Stierch 115 Tychy 1 Staškovicová 2 utraceni 2 trojsložkové 1 Tamrašská 3 Újbánya 1 tabornikov 1 Svietiaca 1 svetfotobank 1 TENGU 34 svítiplynu 2 TJS 3 THOMSON 1 Stiški 1 Tutusaus 1 Svazuje 1 Tysiacza 1 stiavnica 1 Valencin 10 trikolórou 3 Tvorením 1 urediosporami 5 Timbaut 2 spoluráci 20 Thranduil 2 Tajá 6 urologického 83 Véska 1 Uraí 1 užívanák 2 Trepetatá 11 Šoupálek 12 tuberositas 1 Streptocaulon 1 Stadswaag 11 Teutsche 68 Toivonen 5 sulfatidem 1 svetšteji 1 SUFAG 3 sumer 3 Tities 6 tríštivotrhavé 1 Strílím 13 territory 9 tokozelka 55 tisíckrát 2 Trimethylamin 2 Svítkem 1 tulaci 1 Szépesófalu 16 Strašilka 2 Vaunac 9 stvoritelu 10 SPARQL 4 spamerum 2 Steamatik 13 triterpenoidní 1 Squarcialupim 1 VAPORI 43 Užitecný 1 Sowerbaea 31 specifikovaný 5 Tchur 1 spádovišt 1 tuberifer 1 Velkostatkem 1 StoryMill 6 strýcuv 687 spolecném 3 Vaderove 1 Steckbriefe 3 Taisuke 1 upozonila 1 TABULKY 1 velkodistribuci 1 Stephbecca 1 ufesa 2 trilineárních 1 Versificatoria 19 Szal 2 Špiclování 1 Trigana 2 suberosus 1 Stevina 1 Tesal 1 Takauapa 1 Studienblätter 3 spirituálne 2 Tagaeri 101 Svátosti 1 Stevenston 1 tlumic… 2 Valempouličres 3 thiosírany 1 SPAs 1 Theatralischen 1 Trittschuh 1 Suddžono 2 tetunštinou 1 stycících 1 uniformovaným 1 vcholovém 1 Subkontinent 7 strízlíkovcovití 14 spásáním 78 tancuje 2 sverenek 1 svars 1 souteže Czechoslovak 9 Svetoznámá 3 Togny 1 úhozech 116 tibetsky 13 Švédky 1 Themroc 3 špirlicovitých 4 symplektické 5 Straca 1 Trojtrídní 2 subakutního 1 sousouší 12 Ulpius 16 Urzad 1 velice podobný 2 Strassmannovi 3 tvarovaní 1 totalier 1 spannt 5 Spurbus 37 uralských 3 Velšsky 1 Therap 1 svanuri 1 Tomsas 26 úhrnné 5 Tripurasundarí 1 Stavaricovu 2 spekly 2 Stonesfield 4 Stylites 3 tolerantnost 1 Swinburn 1 Sutilizonidae 1 Springmont 296 Toledo 1 Vetiškou 1 tmelené 75 sudetské 1 uctivosti 1 s bohem 2 udrcský 3 Topinard 2 subrecentních 3 Stodulkám 31 USL 1 tropum 1 urgical 35 Thirteen 1 Vandoni 8 Sturdza 1 Tamru 1 ssette 2 Thunayan 1 Termancia 1 Svencho 1 Squiera 1 VAISGRAD 1 Tavolarského 1 sycovského 1 technológie 1 vértices 51 uplynula 5 šplouchání 14 Tighina 14 tenement 2 Stupnici 1 Varvalis 2 Timi?ului 7 Vasaros 1 Vagharšak 5 Tierwelt 1 udelovala 1 Toufuku 7 Unionisté 4 Starsplash 1 Unterleupoldsberg 1 TVVM 1 starostu… 1 Spaziergänger 1 Tlúkov 6 uchovávaným 1 UNDEF 1 Vesmírana 8 týlovém 8 Stritch 1 Uzrávají 6 Svahn 9 ustanovenými 3 tepelským 1 Swithunovi 159 ucebních 179 Úspešne 2 Sowiniec 1 strupovka 1 Thorny 13 Templetonova 1 Tianmiao 1 vázáné 5 trojcinné 2 Timpuriu 1 Szinuhe 6 veslarská 9 Tannerová 1 submonarchy 2 STRNADOVÁ 1 Tündi 7 Tewahedo 2 ventilovém 1 Tajmí 55 uchylovali 1 Stupkovo 1 teijsmannii 1 Vedildena 1 ústeckoorlických 1 Tatsumiová 1 TPMC 1 vehlasného 1 Súrská 14 Šumakov 1 telefonnyj 1 špelunce 3 spojenkyní 1 Stisknete 34 strašlivá 2 užaslou 1 Tuvje 1 Suberanthus 1 Vatková 1 ukatatele 30 Tíha 182 vážného 1 stotisícu 2 topidly 2 Stylizací 1 Táhgereiem 1 Telals 1 stylopharyngeus 1 TATRACOR 1 stazce 7 tartanové 4 Veronal 1 Usazená 1 Sprengbagger 3 s Ježíškem 3 stokorunu 5 Sumiko 2 veronese 2 SpaceDaily 4 Šteigl 1 TREZNER 2 varníku 2 Stanislavovo 1 Thommachan 1 Touréa 1 Svatonic 119 strojírna 1 Theognósta 1 tévelygokén 1 Štychácek 6 Torcé 1 spolubojovníku… 1430 umožnilo 1 Vánu 1 Tombusvirus 5 vápnostrežné 1 squidco 1 unitaristické 1 Transvestité 20 Váchy 1 Vaskové 4 Tiinem 28 Uspenskij 1 spinario 1 TRASH 8 Velasio 1 Trebarjevo 2 Uffheim 2 Tibicen 1 Spustilo 1 Veerského 2 Szpiglasowy 29 Vedeckotechnický 1 stalinskix 1 U— 1 Venetických 1 Tylžské 4 tlouštíci 1 ubežati 1 Swiatek 4 Suunto 1 tomisticky 2 Ušetrená 1 Turpinová 1 Temoriam 5 Úhelníky 25 Taveri 5 Ujgurských 1 Treibstoffwerke 3 Stokrát 1 Spanuoli 1 Townerovou 4 Ukrajine 1 tmutarakan 1 Staroverecká 2 tész 3 svážné 32 Uzbekové 17 utesneny 1 speciáním 1 Topolova 1 Spesivcev 51 spocetná 1 tajnickou 1 templerský 1 Sownis 64 Uváden 4 Utkali 252 space 3 superbia 2 Tybald 1 tradicionalisti 1 Toulem 1 Vechetová 1 Varagis 1 tdc 1 Starba 14 Tisový 1 Suvivuo 1 tajšiu 1 SPOKES 5 týnské 6 typologická 4 upeceného 11 ÚISK 2 Treacle 4 Ulungur 1 Szklin 8 Turchi 8 tripolskou 43 turectí 155 Urcitou 5 SPJ 1 Švanenthoru 19 Trésor 1 uvolnitelného 1 Toppeltin 1 titušek 3 Untersberg 9 tolerovaných 2 srcani 1 Stoneass 3 termitané 1 tvättstugan 1 Synandrospadix 1 Transzendentale 1 uhlazenými 1 sseverozápadním 1 Ssternberg 11 Štetínský 9 Uk 2 teckovacího 1 Valderramy 1 Stanimirovic 1 threosová 18 tankóbon 1 uskutocnit 8 Tomcány 1 Uburayi 1 Troussé 1 težarovy 1 ustrkován 18 Trollové 1 Toralfa 2 Tvoeto 4 Tourneo 3 Teologií 1 Tondach 1 Tlingitská 1 Theorems 1 STREAK 1 upínkami 1 uplytnutí 1 Úrdhva 1 stíra 1 Trannin 1 SYA 2 urobil 6 Stanforda 1 Springerendspiele 1 Tüdev 2 Utopická 10 tenistkám 119 Tiraspol 1 Stonski 1 talianskych 1 Tchitchagoff 1 trasumanar 3 Spreading 1 tyrannosauroida 46 Tatooine 2 ulezou 472 Universität 1 Superfix 3 Tufting 1 Tordy 1 TROJLÍSTEK 179 stržen 4 Strelníky 1 staropersko 1 Stubenberky 5 Stoilow 2 Tretiak 2 suspendace 1 štokavce 1 sVreXIt 1 trucovite 1 Tiling 5 Sumerian 1 svetlobrichý 1 Sysole 13 TBI 1 Tokaimurské 2 Toaca 1 Taluskylä 3 Trabice 5 Tokanište 1 Stockaryd 1 Tordellas 1 Tannenbergsthal 5 tube 2 Strummerville 1 truelithuania 1 s negativními 1 steinheimský 3 sýrinx 12 Trin 1 Urának 1 Staatsgründer 2 Toml 3 Srovnatelný 1 stránkovaného 3 Suchanova 2 Súradnice 1 Uillem 12 Stravu 1 trícárkované 138 uhlicitým 13 tilandsie 1 Timaukel 1 upscalované 1 subnanosecond 5 Tweety 3 trojsprežní 1 tufiticko 4 Talleres 1 tetrapyrroly 1 Tectosagu 1 Timbral 1 Stargradu 1 theaninovými 1 Španelovým 5 Verĺs 1 Thrint 1 Synnevaagová 24 Triska 1 Traceuri 1 Sundrop 1 UJN 1 Svislým 2 uklidnená 20 Uprímne 31 TROPENMUSEUM 4 Velfl 222 velkolisté 2 Umeki 1 vecer… 162 trubicky 1 stereováha 1 SportsTime 1 uznávanost 1 Tscherttegasse 3 traumatizován 1 Újlakiho 1 Suczasnist 1 verdenská 3 tapiseriích 1 s presunem 1 személyes 3 suchoblanité 229 upušteno 1 Stavropoloplské 11 Thormaehlen 8 Šva 1 turitwei 1 ugíja 1 stapfiana 1 spikelet 2 Sügisball 1 Takuši 1 Tušcáková 9 úbocími 1 Vassoir 2 spolucestovatele 1 Standishova 1 Undaground 35 Steffan 1 Vamberecká 344 uplatnovat 1 Stückeru 1 Tyssefossen 2 Vaché 1 Stratení 2 spermiogenních 1 taxátoru 1 surbaharové 33 úradovna 1 Úvahu 1 topítko 1 Tatynia 1 Topchishvili 3 telomu 9 Truchno 1 Valojedky 1 Urdemalas 1 Taraškevice 2 Telesiem 1 spolehnou 2 Souperovy 1 Tarpe 5 Trappittová 1 SPZky 5 uspávacích 133 telegram 5 Starobenátecká 1 Sprengi 2 Teglio 2 Ungulina 1 Underslunky 3154 Spolecne 24 Syner 3 Travica 3 Szered 1 vestavbách 1 varibialitou 8 Tarrafal 2 Útvinu 2 Unbibium 1 strkaly 1 spamerským 1 Subotniku 1 Swierczeková 1 trybunalski 3 vážskych 23 Špillara 6 utuhne 3 Terrakion 196 stredovekém 2 Šukalo 21 Varaždínu 1 Starohrabenka 8 systolické 1 s datovými 8 Traditio 19 veslarském 1 šupinoplodé 1 Vejmoly 5 trívstupové 1 uvolnujíc 1 Tödtmann 1 Trancendentálie 5 terorizovaly 1 Suzumije 1 uhorskej 1 subchronické 1 Stampferových 1 trojhrotých 1 Vejnberg 4 Stvoridel 1 Trümper 1 Szarvasi 1 tupozraký 5 Svatoplukovou 1 Stithem 2 splachovány 1 Tófalu 1 stahováními 1 Švédek 1 Tetuju 1 velkorážním 1 StreetCred 1 tronar 1 vajsko 3 upiter 3 stredoamerickou 3 vatru 1 Vápencovité 1 Termobarometrie 1 svicení 22 Thésée 1 Verkehrsmuseum 1 Upnutý 61 spadajícího 1 SuperNagroda 3 Trpnouzské 1 StavidloDetail 2 Valandro 3 Valtrudy 1 Unmastered 1 spusobem 5 Triumfetti 2 Sperone 1 staurikosaurus 1 Trallwng 1 Univerzitnímu 2 trapnostem 18 Supermanovi 1 textacní 11 Übelacker 1 Stylistik 1 Tigergazer 2 unárne 12 Umírnení 3 urbinského 1 Suovâkuoškâ 1 Tilmanovy 1 Stránskými 1 thioacetaly 16 spoutali 17 tríska 2 vcelojedem 1 StudioBuilding 6 údernými 1 Tyranosaurí 4 Sumittá 3 standalone 3 swingující 1 Tirsense 1 Valghata 1 Ultradum 13 stresory 1 speciální 1 Vences 3 Umako 3 vejr 25 Tachybaptus 1 szmatami 12 Splnená 1 trématem 3 Turlichanov 1 UAK 4 ubýval 1 TMKB 5 stipendistum 1 Trepany 3 starojaponská 1 Tombi 2 teokratickým 6 Tracee 1 Štovíckovi 4 Tamilskými 1 TDIDT 1 Teofylinát 1 Šurákovou 3 Taišógun 4 tisovcovitá 1 Thomassonová 2 trylkovitý 1 Topolánkovo 4 Tritannus 1 traiteurs 3 trampingem 1 Tageschronik 1 Ubaleno 4 utlacovalo 9 uzivatel 4 tzotzilština 3 Tsavong 1 thráckokimerské 3 S temito 7 subspecií 1 Terushichi 7 specierum 1 Údržbár 7 sunset 1 stuttgartskými 5 tarsu 2 srozumením 452 stáhla 1 Sparkplug 19 Trhavý 3 uhlídám 2 Szurman 1 tri…ale 1 Vergasova 1 unáhlená 1 stanleyi 5 trísté 1 Tchaman 20 tarotu 3 styloglossus 6 tuberkulosou 1 Swiatowa 4 Taymouth 1 stelná 45 Vávrová 1 Uyedineniya 1 úalcu 2 tredisko 5 velkohlavé 1 Stevenova 13 Trebická 13 Štíhlá 1 Subbots 1 UmgebungLaPazBata 1 Spacal 3 Trauermusik 2 Stînga 170 strmých 1 Spekulantum 2 superstrunové 9 Stefanovic 26 strujci 1 Sutphin 1 Sváží 1 Tymochin 4 Toeplitz 1 uchatkou 3 Univerzitách 1 Tauvo 3 Tilki 2 SPŠPT 1 Towles 1 vazokonstriktoru 1 Teobaldo 1 TAUTZ 1 Umetnostna 8 úcarí 1 toinen 17 svírajícími 6 SRA 2 SportsDesk 1 Swiboda 6 sverenském 2 Valcárcel 20 svíckové 1 staroukrajinštinou 1 Troutových 2 tefila 3 Vállus 2 Soupisem 5 Tomanowa 1 Statthalterei 1 Vaudoyera 1 SPLT 1107 stena 1 Štítkovité 2 Sprchovací 2 Tarchaneiota 1 VAARANDI 1 triodetický 306 uvolnené 2 upgradovány 1 sp?? 2 Spiritualismem 1 vĺrer 5 spoluknížat 1 twarzy 1 Vaisocherová 1 Thuoma 5 SÜBA 11 Ukrajinku 2 Swietena 3 syenitové 1 sphaericum 1 sublegion 3 únosném 1 Unterscheidende 56 tercií 1 Vehilsem 5 velkoruské 1 Tabulní 1 spoluprácu 1 úvádí 6 Venclovská 1 uschovávaný 7 timeslotu 11 Svitávkou 21 umírnenosti 1 ušlehán 1 Suisho 1 Správcák 1 ucité 1 Veitmilum 1 Šukla 39 Václavovice 1 Steris 2 Vegetu 1 strílejte 2 Vazivová 1 štítnými 1 útil 1 télégraphie 1 Urkút 3 Textrix 1 superfino 1 umrjot 1 utulnosti 1 Tepelnému 16 Soustelle 2 urgan 2 Trudovo 4 Vermeerem 1 stabat 1 Szedikert 1 tšangla 10 umrelo 2 testGetUser 1 Thermofilaceae 184 spojovaly 6 Vermeil 1 varhánkovitého 14 Úctování 5 srotili 1 Šprudláka 9 TRX 103 trinácté 3 tucnými 1 Stašu 1 Thessalonické 1 trenovala 5 splodil 4 Švanhal 1 Strummerove 424 úhly 1 strelcov 1 Souteživý 2 Vekoslav 3 Topfest 31 TEM 1 SPARCovskými 100 tekutý 2 Trajnin 2 Steyera 25 vergriffen 1 Utsinda 4 Táboráku 1 SUMMIS 1 Vallemaio 1 Sviridenková 1 spodiem 12 Trinh 2 trevorit 1 spolúcinkovalo 14 Svorad 3 starbuckizace 1 ultrareakcionár 8 svarenou 2 Tessmannia 5 Šowy 5 stávání 1 sulfitu 1 Syrištová 97 Steinbach 3 unaveno 10 Steglitz 1 Upadala 1 Štencovy 1 Varmiensis 1 tacui 3 Unifiction 1 Tánsén 57 Tijuana 3 turkmensko 14 strojke 6 temporalibus 1 Tresku 1 tabaskovou 1 Statesborou 1 Udesi 1 týnické 4 synagógách 1 strongmana 2 Velutinoidea 1 Travnatého 93 Thiago 4 unitárními 5 ukmedia 1 ugandsé 4 Sullivanova 1 Typhlocoela 1 Tomasello 7 Tare 1 subsonic 2 Traminec 16 Terru 1 thákurovské 2 Suverenite 1 trihydroxyketony 1 Vedle kartuziánu 2 Taillant 5 Urameshi 1 Sukoradskou 1 Sukošanu 1 uzlíkovitá 1 Tolluntur 2 Tierneyová 7 TXL 4 Tangriev 3 Štípacka 2 spávalo 1210 Švédští 1 Verfassungspolitische 3 tricetjedna 3 Thaumatin 2 Šúnemance 2 trojánum 3 venoval 4 terminella 6 tegument 7 telná 2 Šukovic 7 Stydké 4 strdimila 132 svícka 23 ucebním 2 trihydrogenarsenicnou 1 Štarvicary 1 Terarrium 1 Tabarja 19 švábským 1 Ucite 1 Ušakiai 2 Sůqian 3 tulipe 9 úradovnu 1 ucenlivých 1 srdcervác 1 Strumaria 6 spáti 2 Vazouna 1 Tibetanistika 1 Stubo 6 Tired 14 talmudické 1 VAlMg 9 Tomeckova 2 swingery 1 Stádlí 22 sporadický 1 Strobele 1 vesperas 1 ulzii 3 verlangen 7 Talma 4 Troskovy 1 unrar 2 Udajpurské 20 souperilo 36 splynulo 1 Terreki 1 Suriagegaharu 1 stické 2 velkoskladem 1 terapsidu 1 švigrfotr 3 Transformovaný 7 Turnikety 1 Urvané 1 tragó 1 Trottman 1 tira 1 venétština 8 Urbánkovi 16 Thery 3 Sulzenau 1 Tecleveland 1 Stenomeria 1 Tocar 1 Thayabogen 1 Tichacek 1 Swakopmundem 1 Stambekova 61 Štybar 2 Stinea 1 Urgenta 7 Sváru 171 spolužák 16 Spolehlivý 2 Sullanmaa 3 Velaux 1 Treyens 1 Stupně 1 stváril 1 Uhkapelimerkki 2 sušenkách 5 Veleobri 1 Sureńos 1 Steenfoll 10 sublimovat 3 úvalového 1 Tousside 1 útocnicemi 13 Valerianella 1 trocknen 1 Triethanolamin 2 termofólii 1 Suslo 2 ubitého 1 Velzla 1 STUDENTSKÝ 4 uprímnejší 1 Starosvet 9 uveni 1 Szczerbin 136 Tha 1 Velebitem 1 Sprškou 12 spalinách 15 Trebbia 1 Štastnym 1 stredoturonský 98 Sourozenci 2 vejcorodými 3 temeto 2 Staroga 1 Soziales 1 spievat 1 toureva 1 Spiriferida 1 Szelesta 10 Štedrencovec 1 Vanillaz 67 Tania 2 svištovské 1 srrr 1 stachrskému 2 Steinbourg 2 Spectaculo 1 Uskomatonta 3 Tessel 5 stratifikovaného 10 srdcovitý 1 souterrains 4 Trichomonadea 1 Štefancíkové 1 staroperskou 1 ukvelo 1 statosféry 1 spávám 3 Tengger 2 toskánština 5 Vabalninkas 1 TFRAW 1 spoluutvárejí 2 synkopickou 1 Srugim 1 taargo 25 STAT 1 utesnováním 1 Trzebon 4 travinobylinné 8 verano 1 Topocuvirus 1 vareste 1 Tihodaďne 8 Spolecenským 1 UDELAJÍ 2 Stuchelovou 9 Titulárním 1 TabulaRogeriana 5 veršov 1 Sundquista 1 Svärdstecken 13 takticko 1 Tatty 1 veci a bezpecnostní 14 surovinových 1 Sychrovký 1 Tastavin 4 Tajuplné 3 stavejícího 3 Stylistics 3 Tuáregu 3 Summerlee 1 Verjovkina 2 Šulaková 1 správá 296 Válek 1 ŠVEJK 1 Taminovi 3 Uklízeci 1 Varatanian 1 Tedženské 296 Talmudu 11 Ugolino 10 Vetrnou 1 toustu 3 Ulbrichtuv 1 Tessanek 1 ugrozoi 4 spoo 409 Vána 2 Šoupálkovití 2 Szczawinska 2 Szücsová 5 surname 7 thajskými 11 tinem 1 Supernaturalsuperserious 1 tavem 2 tycovitou 110 Sunrise 1 southsea 1 Stumpery 1 vervaardigen 1 Trejbalovy 1 Typenlehre 1 Velaskem 1 tramvia 1 Tovstonogov 1 Vasalunds 1 spewarjo 212 spisovatelkou 1 Swinglea 1 sylvánové 1 velekmenem 8 Tvorit 1 Stonoženka 1 Staara 1 Thaddaeus 1 Vaughnovou 2 Vejdove 11 TABSO 1 šumíš 2 s Marcem 1 steroskopicky 7 špitálníci 1 Ternér 2 Urbáre 1 uvezneni 1 Tarelianská 2 Ullyettem 1 Trlicíkem 6 triquetra 2 Stradomiu 18 Vazgena 4 unitárum 5 sturacovité 1 Špitková 3 ÚLOVEC 7 totemových 4 topnice 4 Staszewski 4 utužením 5 varím 1 Uposlechly 1 Thermovibrio 3 Spassk 1 Vetrovky 1 storem 1 Tiphares 2 stvolínské 1 Tarasovice 6 Uko 15 umelohmotné 1 Uhádnutelnost 33 Stepanov 1 Termaber 3 Valensa 16 Udržují 2 stébelnatých 2 Uhle 355 stravování 34 Vatican 2 švamberský 4 Sulajmána 46 Subkultury 402 Varhany 1 ultramarina 3 Sporocysta 1 subcaerulescens 90 špitální 2 Syllit 46 Twister 1 Steinberghaus 3 Stéphanií 1 Tetraliny 247 sylvatica 2 Stulena 2 sporocytu 1 Uherec 3 Valleju 1 TkTreeCtrl 1 Turgotuv 1 Tichonickij 1 triskelés 1 Štáblovická 1 uznavanymi 1 vcelenskou 16 uru 7 trojspolku 1 Tetrahydrokanabinol 2 telogenu 84 Velkými 29 Teplitz 5 Velhas 2 Špeky 1 Trasoritkou 1 urbální 2 vazáky 1 trasáky 79 Tipo 3 tzeltalština 3 s daty 1 Tetaw 1 Tscheinerspitze 2 Spizocorys 1 valdepilosum 2 ttf 12 Théberge 1 Varily 1 univerbizaci 2 Uctivé 12 Towler 1 Univerzytet 4 üe 1 Toolserver 1 Tiefschlaf 2 Sprachenkonflikte 4 Talaše 1 synagog 1 spermatofylaxem 10 uzdravili 1 Suomenlahden 1 svetskog 1 Teckami 23 Sudkuv 14 Telefonica 35 údelných 1 újedište 1 Sterdyn 3 Svatošovou 1 Tetracoccus 1 Telesných 1 Speares 38 Stredopravice 3 spolecnos 1 Transmontano 1 Verhandlungscongresse 8 Tigraj 2 sskole 2 svítivého 1 Sumasu 1 syrovejších 1 Syies 2 tovaru 1 splanchniku 1 Sparbacherhütte 3 Susato 7 ujezdu 1 Turonum 16 Stephenu 1 trodorlotita 8 urbanistickému 1 Vârset 1 tunkeru 1 Véghu 13 Upsaroku 2 Trioletovou 2 ttibb 1 submontání 1 Trapaidze 1 turovi 1 Töttös 1 Splitských 1 Vermehre 556 ting 3 sverepé 1 Šríja 1 tagette 1 Tarinov 2 trojclenným 2 ušmudlanou 3 úrazovým 2 Thabitova 1 udelátky 4 Süddeutschen 1 Tvorkovského 1 s nekým 35 štavelové 1 Squarez 3 Tethyde 3 svatokrádeží 1 Urdsik 28 Tomova 3 Urbiš 6 Tsintaosaurus 1 tawlu 1 Trylogia 1 Tiklite 2 Swinomišu 747 týdeníku 10 Stepanek 2 s Turky 2 Vagonu 1 trinitárních 5 surjekce 1 Tlustém 3 usines 2 Teros 1 tracheálním 2 Turcius 61 ventilaci 1 Veleobci 1 Thullieze 3 sugo 1 úradnímu 3 UNITOU 20 usb 4 Ströhla 2 teplofikaci 19 Svetadíl 3 Verdana 2 taranováním 1 tätige 1 Szentmártoni 1 Tašiakari 1 Trídenních 18 Strathearnu 2 s pokracující 8 Tvoja 1 TreeTable 1 stotiscícový 2 Tommyland 1 Vaddamaa 31 svetit 1 trinástistovka 1 Stadtbrand 31 Valerije 7 Teduv 2 transorální 1 Stuova 3 Spatruje 1 Stáry 272 úvodních 1 Trezorové 9 styriaca 1 vazírským 4 Toke 864 útvaru 3 stejnejch 2 Tsarouchis 1 uskutecnovaného 3 teosofové 1 Trechuelem 1 Syrdarském 1 Toponymická 3 Tumladenu 1 typhographus 1 Velju 1 Theophanou 2 Twylou 6 Spícího 20 šrapnely 13 stanovována 3 úbocním 2 strnadci 2 Stožeckým 54 Stibora 1 Svolán 42 Submachine 29 staveného 2 Spittelera 2 Vassileva 3 Tystion 2 Unart 2 subirov 2 Verlorenwasser 1 taveninové 2 topnicemi 2 Tózawa 26 Vasko 1 tasmádjadžnátsarvahuta 1 tužinkou 1 ulomili 5 spinelem 2 uschovávány 11 tucnení 1 usmirovalo 1 Twannbach 1 textcomp 8 Stádlci 61 sousedícího 17 Studánko 1 tažnu 1 Uppenkamp 1 taekwondysta 3 spodové 48 Tošenovský 1 subcekcí 1 tweetoval 5 Tayac 2 športové 1 Vandenbergovou 1 togiki 2 theropoda 1 Turchia 191 urbanistický 3 Swanwick 2971 Tuto 16 Theophrastuv 1 venýrem 1 trombotického 1 Stufenfestdrama 2 Sykkylven 1 Thorsberger 3 Tukuringra 3 Vestlandet 2 sumak 1 váznamnými 1 souslednými 2 veleti 5 Stolbov 1 Thanose 1 Venovaly 1 Tshitanini 1 sousejících 20 torze 35 trou 1 Vasmer 1 SPSPR 1 Turance 4 splavnými 3 Urijské 1 Turzko 3 spletenou 2 tonarium 1 streamovan 1 Vertua 46 trestanci 8 stece 1 Stagionu 1 témp 2 Teleskopické 9 Tarum 2 Tancování 1 Torfmoospolster 13 Tesná 2 spoluvezenkyní 1 Statecek 23 srustající 1 Variatio 1 Starblast 2 Supertram 4 topolanská 10 uzamykací 1 Verzálková 1 vchlípily 40 Valličre 2 Tagmaty 1 Thiep 1 Studnicními 1 Väljaküla 2 Testamentu 5 Telmanove 2 stádecka 6 Svištouni 1 Translohru 1 Vágnerovu 4 Suus 2 statisticna 1 válkyPro 1 Spalinger 2 Studenicného 1 sundarim 1 Uraze 3 Souperili 2 termitích 4 Tremoso 3 trípolohový 12 universal 1 undegroundové 5 Tyrosinkinázový 5 subsonické 1 StreetBall 4 Útokum 1 surnaj 7 tomistickou 32 velikonocním 39 súdánská 1 StEGu 1 vanvlietii 1 Tetraplodních 1 Ušo 1 subsimilis 6 Stambach 43 Ujguri 3 Trsteného 4 stržená 3 Terinou 17 sužovaný 3 Superformance 17 testovaní 1 špekových 1 Tagliavia 2 Vazacka 1 U soudních 5 stopoval 1 Tortuze 1 Ukkusiksalik 10 turne 4 strcila 1 stravované 1 Station a 3 Tognettiová 5 Uzliny 2 Trajanem 2 Tilinteon 5 Transient 1 Tiesnavského 1 trigyna 3 trénovalo 1 stehováka 1 thoracata 1 ústrojné 4 trampování 26 Sukovo 8 Tatio 2 Taganrožské 4 Tuchel 5 Trotinka 1 tamblováním 1 tlamouna 1 stanovováno 2 strojmistr 1 submersi 1 Tencianskej 1 Todoggler 1 Verslag 1 Stretter 1 Stopparo 1 velkooobchodní 1 uchohybných 3 Usazovací 1 Teotihuacanu 1 trompeta 138 spam 4 tríbitová 1 Turinaz 1 Tycinkovité 3 Trenérum 1 Sviního 4 ustavoval 7 stromkové 2 Urquinaona 75 vadilo 11 Switched 1 Thunderthighs 1 ujištovací 1 Torkewitz 2 Tulpenkanzel 7 Staroegyptská 1 variageta 2 Venussiho 1 Spoléhalo 6 tangutica 145 Težce 2 specifictejšími 4 Srazy 1 ukržižován 3 TÜVASAS 449 Springfield 3 superhvezdu 7 Vesljana 6 sporivý 2 trístavovou 1 svežující 2 Trilian 1 Tanasugarnou 194 Týdeník 1 stadardy 1 Steyermarkochloa 91 strelecká 1 Vack 2 Švýcarove 1 tanieri 1 testacelovití 7 Triacylglyceroly 1 templotám 1 souslovného 12 terpenu 2 verwendeten 2 Steuermanna 1 ÚSTY 4 štítkovou 1 Textilkennzeichnungsgesetz 36 tyrolská 2 Süovi 2 Togašiho 5 svolavatel 2 Syrovátkách 1 Suanhildy 40 Texel 1 vbocené 3 verko 1 válnom 5 strhal 1 Varínská 2 tetov 15 USTA 8 Studen?esc 1 stjernene 1 sucropedia 3 Vermikulit 2 Studt 2 Vernazobre 1 splašit 3 Szmaglewska 40 Steklý 1 úžasnejší 4 Trumpler 2 Soupex 2 Usatov 5 Tendaguripterus 1 Szklabina 1 vejcovce 1 vaqueru 1 Tardibelle 10 sýkorky 1 utáboreným 1 veszítsd 1 Underline 2 tešnovské 13 spirálove 3 Svolá 5 Suctoria 1 Togjulte 5 turaku 24 Tungdil 377 spojovala 1 sprchávají 2 Tršinská 1 velených 1 Útekovky 1 Švamberskému 1 Strženého 1 Trzebnicy 3 urezává 4 urbinská 1 svinutce 1 tríbrnej 1 stanovujících 1 Taševská 2 Thidricus 1 stareg 1 sulver 3 TORAX 1 Storfors 2 strašlivejší 1 Tertullianovým 1 swerených 1 summerhouse 1 Trelford 1 Statuae 1 vaikal 1 stríškový 1 Velkomoffovi 16 utilitarismus 2 Summerslam 1 tonizujících 2 Tapeinia 1 Superfans 7 Sunjata 2 ututlány 4 Stadena 1067 spolecných 1 Vesjolovka 12 Tobler 1 Totmiania 2 Uniformovaní 4 váhaly 3 Trinástrocní 1 vähentää 3 Útkové 2 Stebel 1 Valinco 1 Ullrichsthal 2302 tehdejšího 18 umlcel 2 UMM 1 Urschlechter 1075 úcastníci 1 Vesivirus 1 Statuofilie 1 Turbării 1 Tipovoi 1 Trautsohn 54 uzdravuje 4 Váchánu 2 Vergetot 1 Verbandsverwalter 1 uchylující 1 tselingas 2 Steinabrunn 1 Soutterem 1 Vertikalismus 1 Tarasicodissu 7 Thalherr 2 velkonohá 1 stiskutí 4 Verum 3 Srichaphanovi 555 uzavreno 1 Sutu 1 uba 1 Svk 2 Strung 1 üb 6 Tallud 2 Suquamish 1 valtellina 5 trama 1 Stylocline 1 Souwaroff 1 Trhana 1 Stoletja 1 transversála 1 stavkirche 1 tathagáty 1 Tristiemi 1 Tornikidu 147 syntézou 3 Vaudemont 1 Suarčsova 6 UDAR 2 Ucík 1 thonetky 1 Tielmann 6 stylistkou 1 Vaitiekus 1 Themistogena 90 Studiové 1 suě 5 superhrdinech 3 sžití 1 Vellupilájem 1 Thurovia 3 spolupredsedkyni 2 Šustaly 10 världen 70 Svetem 4 subvencovány 1 Swieciany 3 Stabsfeldwebel 1 urostl 1 tilanteiden 35 tremor 2 templis 1 stisknút 1 strupcickému 1 udílost 2 Üman 1 spolecenskokritických 1 verodnost 2 Trippers 5 sousedský 1 tuntasia 1 Varjojen 1 Vareny 2 ternura 1 uoc 1 spoluzakladatelam 1 s mými 1 Vannellidae 1 Tulunových 2 tyrhénská 8 UQ 68 vázaným 37 Varaždín 27 vcelín 1 souostroví Jižní 1 Tacapae 1 Tajruk 5 Tholos 12 Treboniana 5 umeleckoremeslná 1 Ubiraja 4 Trifolion 74 trojnásobek 1 Teplickou 1 ústupní 3 Stredoveku 17 štetinky 5 tonžské 1 Trevélez 2 Topánika 1 Tehelnou 1 transbariéry 31 Til 1 Tychonovy 1 upomínán 5 uzáverum 2 trimethylcyklopropan 1 Thespiovy 1 stranenejsou 1 Trostjanycja 9 Tvarožník 1 Ustanovily 1 trišura 3 Troebst 5 svitkových 8 vasektomie 2 Sukaraja 2 trafostanicí 3 Toronte 1 Therapy 1 uhlírského 1 Staraoke 1 ultrŕ 1 Szczeklik 1 transcore 1 Unterseele 1 Stodolovej 1 trivální 3 stíhanému 2 uljana 1 Triumfo 1 Srnu 6 strežícího 2 staplový 1 treffe 157 vácky 13 velkovévodské 2 sucholce 6 turkiz 1 triploida 1 Tockstein 1 tamesnensis 1 Tiborc 1 tertiare 2 Stredoví 2 vestavením 1 UherskyBrodUjezdecChurch 1 svetlotesné 1 tricetitisícovém 2 spoléháním 33 Ufy 54 testament 1 Vesania 12 veríte 1 unddoppelten 1 vedúcim 1 útocníkuv 1 Telcska 2 tueursenserie 2 strelivina 1 Tubqal 19 Thewlis 1 Trainload 3 Svažec 1 Vassenaru 1 sportovnetechnická 1 trupovýé 1 Trimethylfosfin 1 tenuiparietalis 10 vallée 2 Úspešnosti 84 strmým 28 stella 293 tržnice 43 symbolickém 8 tradovaného 8 Veisiejis 13 teismus 1 Ukweta 8 svobodni 2 srostlolupenná 1 UNINOVA 8 Štetovice 13 SRMS 1 Tcedch 34 Tad 1 Tarimský 1 swatemu 1 Stepokurové 1 Vepranskaje 12 Tiahuanaco 1 Suhm 1 tongs 1 supekrosových 5 supremo 59 suverénního 1 STERBENDEN 1 speceni 27 Temes 1 trnobrich 7 tísnili 2 Vasmutovou 1 Teschke 1 Theuerwang 1 Svitkova 16 svíckách 14 Uostas 3 Stanom 1 überbewertet 1 Tacitron 1 Superheld 2 typifikováno 2 Tyrrel 1 superfenomén 1 Tubruq 11 upouštelo 1 Svrchnice 1 u?sv 2 Véronne 1 Taškentci 9 Uniknout 1 vedžimajt 1 Švedska 1 SubtractiveColorMixing 2 Truffaldina 1 suburbanní 4 uml 4 ukrajinci 8 stvuru 3 spolumoderuje 3 Tchangem 1 Varicourt 32 Thorfinn 1 Strouhaluv 3 teNeues 65 sušeného 1 Susannit 2 Štrkovské 10 vagóne 2 Therizinosauria 670 trénoval 7 Tovarna 1 Törn 1 tinc 26 Tchán 10 tlampac 74 stredových 2 Theben 1 Striguilu 33 uhynula 1 TOUK 4 Veržej 1 Tallat 5 Splnením 1 syret 163 Southamptonu 1 ÚZEMNÍ 2 Switchfootage 2 švýcarskem 1 Tattingers 18 sysifos 1 Stauberater 2 subarktickým 2 Strodea 1 Spotlite 1 Ukazujeme 1 Teeský 19 Uncharted 6 tyranovití 1 Tsykhouski 13 svéráz 2 Valserres 1 Summertonová 2 Sprocket 227 technikami 1 Trebitschem 2 Stockum 6 Tonkawu 9 tolerantních 1 trojnovela 170 svírají 27 Stalinovo 1 Sportovina 1 srsté 29 vegani 1 Uprkove 1 Uhtredem 1 Teflonová 48 TAI 4 Triki 4 Talabot 14 úzkokolejka 2 UVUHK 1 štodzionnaj 338 Textilní 3 Sumrakova 110 strašidla 5 Superbránu 88 ucedníku 60 Styles 7 Trauner 6 Újezdecku 3 Tidsskrift 1 valmez 3 valníkových 5 Tyranitar 6 telegrafistu 18 svalovému 1 Triulzo 2 Suhlovi 22 továrnám 2 UJRT 1 Uscianek 1 Trimodalita 1 Súhrada 152 varšavské 1 Tillus 1 strádacího 1 Terínka 1 Trebnicích 3 Suleika 1 useconomy 2 válcištem 1 stávkokazum 1 Umrana 224 veslar 1 trojsvazková 1 tmavezelených 1 štofy 2 sténají 4 Tehuantepecké 8 Stredoslovenského 1 Stichotvorenia 4 štrasburském 1 touristguide 1 Surfování 1 uvolnitelnými 1 Tinaminae 2 spinová 9 Trebovic 1 Synoden 3 unetická 7 Thaxton 1 Stegne 1 Throns 7 Tillaea 1 Stríbrenka 15 Suzdal 3 termokamerou 2 Toulice 4 Strepsiptera 1 UZA 1 spodik 1 Spendthrift 3 Tasho 1 ulusofona 1 Sukka 1 štráfový 4 sudému 1 Uhricemi 2 sporýšu 3 Tichávka 1 Temnikova 6 Tintinuv 1 sourodáku 9 sumatranus 1 Strupovka 1 stojanov 1 Tigernachových 1 sourcový 2 tapisériemi 1 Šulíkove 2 Süsel 20 Stimuluje 1 Stiebock 1 Specieller 3 Telemannove 2 velekrásných 1 Ujata 338 venováno 1 TexMex 1 Taungdwingyi 11 úmrtním 1 Velkotlamovití 2 verbalizuje 266 thriller 3 tanzanijské 15 Tichotová 1 Szkodrze 11 Traianuv 1 Velbloudník 1 trimuje 3 Taissy 4 Stínavsko 1 VAPIS 2 tsunamoto 1 Suaslanmari 1 ThreeBallot 98 verohodné 121 valbovou 1 spanju 1 Umývacka 10 Vdovy 1 Templemana 400 systematické 32 telovýchovnou 1 Valliyoorkavu 9 unixová 16 špicemi 1 vartalap 5 Starmon 285 Ukrajinou 3 strihat 3 Stolyarov 3 Špindíry 1 tq 1 Tvrdému 2 verfolgten 73 Trollius 711 užší 2 Teranová 12 Václavíka 10 STEN 2 tajemnici 1 Tervete 1 tegmentální 1 Trlag 5 Starkfieldu 2 STAFF 1 Untertanenliebe 1 Tomariho 1 Venimus 1 Stalupenai 2 Útocilo 2 Valeriani 3 tesnícího 2 vandrech 38 Tesnohlídek 17 Špackovi 1 ullam 1 TAMy 1 Trebohosta 1 velkovyvolávaci 4 Veka 1 Telmissa 1 Turnerheim 17 Svinný 5 throwie 162 verejnými 1 vetévkovitý 9 Tvarových 1 veronensis 2 SYNKOPY 3 tetraterpen 1 Sovsport 9 Unwerth 2775 spocívá 4129 Svatý 4 Tesarovou 6 Vertaizon 1 Tremošnický 1 šplíchal 1 Turkistan 4 Spocívalo 1 Turóc 447 štafety 1 Štemberku 1 Uelsmanna 6 spotrebovávající 6 tmavohnedým 1 Steinapiesting 1 tupejšího 1 Strahovsky 1 uremickým 1 Tatto 23 tíhovém 1 Stredoevropan 1 Thankerton 6 strílíte 1 turistkám 1 Spratci 1 Sulfidická 1 Šúmacu 3 Srpsko 1 submisivitou 7 Veselík 7 valdštejnském 2 vati 2 Taďeb 1 Toranagy 75 Umajjovcu 1 Spasticini 1 tochigi 15 trpelivé 91 Stepan 1 Sulzfeld 1 ?šty 1 termochemických 4 Theodemira 1 Tarangovi 1 Tuticorinu 1 telekonzultace 1 ušnicový 1 Surduc 1 spagnuoli 170 tradicemi 1 Steenwijkerlandu 1 Troggau 2 ventumilo 3 Urushadze 6 Toren 1 upozadnena 1 Techlov 1 Tekavý 5 Umprum 1 tnuctipskou 3 TiIII 2 Úvalské 139 tuzemských 6 Uvod 2 Udwin 1 utické 2 Sulpicio 4 storaxu 1082 tvoreny 1 terintš 1 Túránská 5 teflonovou 1 Špalovsky 1 tüje 1 trojanský 1 Téli 1 Sveticic 3 Verneuerte 1 venenatus 15 Stabilizátor 11 Veseckou 4 Speaks 624 trestním 1 Széppatak 1 Utesnená 1 theartwolf 3 Teaslem 1 thanatóza 1 Spojenkou 1 univerzalisté 1 useku 16 tvrzových 4 Vetterem 5 Sportlife 1 Tapiria 1 transaldoláza 18 Ukrižovaným 1 Šrotové 12 Stržský 1 Strazyska 1 VERSAmodulu 1 stužkovcu 10 Stockholmem 1 uchycováno 3 Stalagmit 8 sporádaná 12 Venem 1 s novozákonními 1 stinkovo 1 Vailainiai 2 tandards 19 Špurek 1 utvárat 2 Technohead 1 Sureijázu 1 stredohorie 1 tamilnáduském 1 Tammispea 1 telesnot 1 Unášel 107 tropickým 2 symmetricus 2 Taeng 5 tafór 3 thaipingensis 2 Toscanimu 1 STRANGA 2 Tirdadem 1 Tsézhiin 9 Talar 1 supraelitní 1 Superkoly 1 tematiky 76 texturu 1 Valešových 6 stamiliony 1 thom 1 Verisignem 46 uvalila 1 trideiling 8 verismus 1 Superblock 4 Venécia 2 Sulika 2 Ublianska 7 titanosaur 5 Szedlacek 71 velikonocních 1 uchovávejte 3 Terakado 1 Termopyl 1 Stenwedel 2 vážkovému 3 urgellský 2 Tatarském 5 Valerová 3 Tetanický 1 svatopavelské 4 terminologickým 1 textappely 1 tritio 1 Vackárova 5 triniu 1 STANAZU 1 Tokukóbu 1 spoluspojené 1 valentýnku 1 SQF 1 Trebeshina 1 Timi?oary 1 Szatmárcseke 2 utopistického 5 Tošiaki 3 telnatý 1 Sperka 1 Vanaja 12 trojicemi 2 Vanniovými 1 spojitejší 2 vaggheggiar 1 Špilov 23 Velden 11 Subacius 2 Stollinger 1 Vengaya 4 templem 1 uutgravd 1 superseded 2 verohodnejších 1 surfaves 2 Szentistvánkút 1 veritelu 1 Stredovskému 9 triunfo 5 trochejským 1 Stethorini 1 spinningují 2 suure 3 Toply 1 spojenina 1 ugola 1 szátmarský 2 Uvázání 1 terarka 1 Stroze 15 UNCTAD 13 štípaná 1 superobry 3 stravenka 1 Topografové 3 Sytná 2 Tomášikove 1 umyty 3 stillborn 3 striptýzovém 1 spamera 1 uńja 1 stopadesátém 2 turbínovému 2 špalkem 1 Talven 1 svrchneproterozoické 2 spisovnejší 3 syntezátorum 6 treku 2 Strikerovi 1 Vertices 24 strávenou 3 vaišnava 9 Vecne 5 sprajti 1 veselie 3 Sumbawanga 10 velkomezirícský 3 trapassato 1 undWirken 24 tríkolka 1 Toskánskoemiliánských 1 Valmiery 1 Tarocco 3 Taivaan 14 Toscani 9 Teroru 2 trnoploutví 2 teplomil 1 Vámadévu 1 Strond 2 toscano 1 Specifitou 15 veroucnou 2 Sútradhara 1 Torminaria 109 váz 1 vejirek 29 temporální 19 tiskarství 1 trafu 1 Vanasse 1 Ubrezs 6 Stredodunajská 4 splavovalo 9 unica 2 Stefan Edberg 5 Stredojizerskou 106 tvoje 1 Troeltschem 45 specifikují 1 stéja 1 Unidata 5 trampota 2 Štepánovicím 1 takuto 2 Steingenhöfer 3 starosvatka 4 tencící 177 uvedomili 1 …stríbro 1 tetraploidu 1 stredomexické 1 Urbachova 1 TIW 28 Unforgiven 1 timarioty 1 Stfiftskirche 15 Upomínky 1 stars 2 Templetonem 12 vakuolu 124 suchem 1 Steinhartu 1 STEBBINS 1 Tafid 1 uschlo 124 spustitelný 1 Sugao 1 vábily 1 Úhoštem 1 Vernému 1 Tauntonia 1 velehadským 2 trialistické 1 TRATA 1 subekotypech 27 ů 1 Uludag 1 váleti 1 temprano 1 Timarchus 7 sudicek 1 stormecku 4 Sudomír 6 spolujízdy 1 Streptosiphon 1 tvarovkové 7 Vetrníkovi 2 synkopový 26 trináctku 11 tergestinus 1 Velizy 1 Vanicka 1 Tegninger 3 spoušteci 2 Tresses 312 Steny 3 utkaní 2 Strachwiow 1 Uletela 1 tanahnja 2 veleváženého 1 Tuomou 1 VAPI 39 Vasilijevic 1 úvažování 1 trattenemiento 3 Strandabyggđ 11 stoikové 7 talismanem 4 stvorilo 13 Tafta 2 Venance 12 uzavírajících 8 Triptychon 42 udávané 1 strednne 8 Vedeckovýzkumná 1 Thundersley 4 Upstarts 272 vápencových 16 úsvite 2 Switawa 1 Uchvácena 1 Úzor 9 Streetcar 11 Turské 1 Transnistrie 1 ukradením 1 Vácslavovi 3 trených 14 Trenéra 1 Szepty 105 takzvaným 1 Talša 1 Uslugowe 4 Supertaure 504 TPS 6 Szén 5 úzkohlavé 24 vesenka 1 Valdarus 2 velomobil 1 Spoužil 1 Spolupredkládala 1 uvykáním 1 Trollmark 14 teleportacní 1 Thério 1 Vabacci 18461 strední 1 Steinhauserových 1 suburb 81 turbodmychadla 1 Talžunas 4 vdovcu 1 Tuniyev 1 spomenica 2 Trikoupis 1 uskakovat 1 Suensona 1 Trakor 41 topografických 1 Tailuge 5 vády 1 Štibnyk 17 Takeover 2 trsovitým 16 Tiptree 7 stydký 1 Tropolonát 182 Susanna 3 tárogata 1 umieraja 68 Toga 2 tokonoma 1 veltlínského 1 Stenczel 1 synzetátor 6 ssä 1 stosedmadvacítek 1 trojdobou 1 s konvencním 137 Vedeckofantastické 1 speciélne 1 Trungpou 12 tesání 56 stvolu 3 vanadicitý 24 uskladnena 1 Toublanc 1 varietŕ 1 Sycheem 3 staronúbijského 572 spolehlive 21 Turovití 4 Tuvalské 2 Vansina 2 uretru 5 Stopkovýtrusné 171 uznáním 3 Tradicionalistický 2 trudno 83 Spoje 3 Twiztid 1 synonymu 1 tarasque 2 urozeností 2 trigo 2 suchopárným 1 Srebranich 2 Valeilles 1 Ujarma 4 spolcených 2 Tennysonova 1 spláchly 1 submediteránní 18 športový 2 s podílem 1 taiwanština 1 Tlachová 1 štrašeni 11 t? 9 Varvažove 55 stropních 1 trimethylbicyklo 3 Theaterverein 2 Übertragung 4 šplouchá 1 Timové 3 Struhar 14 usmírila 5 velkorysému 1 Steinigera a Jana 2 Sundridge 1 Stabulnieks 2 Tuschák 2 usetreno 36 Turoldu 8 vejcožrout 7 Veprín 1 TÁBORY 3 Suchánkovou 1 Szarleji 1 Terminaliopsis 1 Stachovicem 1 synchrónna 1 Taphrinaceae 18 táborit 2 Thomsenových 1 Vasafua 88 statistikách 5 Verice 1 Tangiliové 1 Spasa 1 Stephansorden 2 Toporivá 1 svatynkou 3 svlékající 2 Véa 3 Štóského 1 Svarogovu 22 srostlou 5 svych 1 stél… 1 Svvithred 1 Vanderveken 1 telocvicná 22 stavebnici 3 šteky 1 stejnodruhovými 1 stratfordský 1 syntakitcký 1 tríklanný 1 SVECICUS 2 Szigetszntmiklós 18 syrovátky 1 Vdovickár 1 Sunne 2 Surtainville 18 veleknezi 1 Thurisindem 1 Unterharmersbach 2 Torsion 2 Vejvar 1 theluda 3 utvrzovat 32 stájový 1 Sovereignu 2 Vescles 1 Tetillidae 1 stechiometrii 1 spoglia 6 Ultrasauros 1 Velesinky 1 Thessaly 1 Tokyogiants 4 termogramu 5 Teorica 10 Telcí 1 sovetizováno 1 Tourtinová 2 Tucínský 10 utváreno 16 usušených 1 Troupel 3 stesnaných 2 Trumpetka 1 Tsyrnochov 1 Turbolinux 1 Tomicki 2 Tobiasovi 273 station 4 Transporte 4 Torniu 1 Taggenbrunn 1 Tenkinské 1 špicník 5 Tonari 1 Verbandsturntag 1 Telenn 1 uklonenému 1 ssoftwre 1 successio 1 svraštením 3 Stankovu 10 Starešina 1 Transpolární 1 sundem 22 úctum 1 Stue 28 usnadnovalo 16 Tadžima 9 svodem 1 Tecchler 10 ucivu 6 Ukazovák 2 Tripolitanii 1 täujja 35 Týr 3 Ustašovcu 2 Studites 1 Ustariho 1 Tüütsmäe 9 stolarství 3 subsets 1 treivst 1 Toomsem 4 varecek 394 úhrn 1 tropeny 439 Torre 3 sýkorcíkovití 1 Špicákova 1 stabily 1 Trevírska 2 Sprattová 1 uwedená 165 tezí 1 termosublimacních 1 Strohbachová 1 Sparenberg 11 Terpstra 1 superoxidem 3 Unbelievers 3 Tomosaburó 3 Suinin 2 tykkum 1 Usaia 1 steamové 1 torkretu 1 Theodissa 2 Spalatinove 2 Vernaya 2 torice 2 tragi 1 úzpusobeny 1 úzkotrupý 1 svetelskou 2 Vasaasenová 2 Stutterheim 702 svedkem 109 užívaného 1 Újed 20 taženým 461 varuje 1 tavivy 1 uldího 3 Trevírského 1 titanomagnetity 49 upadají 1 thelatinlibrary 3 Tagged 10 Travné 26 Sturmbannführera 443 Starosta 1 starozákoné 3 Stabie 2 úložištím 1 Stodvaadvacátým 1 stávajcích 2 superhmotných 1 tetragraptus 16 Vatetice 1 tejovitých 9 Truffaz 4 Thioub 1 Tiznit 6 Urychluje 3 SpringFace 4 Torzym 1 užene 1 spolutrpiteli 1 Tu?ita 1 tisroka 7 spm 1 spilitech 1 Taveggia 1 Ustupte 2 Tragische 96 Valného 2 Sousedíkem 1 Venad 3 Starom 12 Uralského 1 Tailleventova 1 Turbit 1 sterilization 243 udržován 1 spoofuje 1 tokátách 1 troizénský 1 supervelmocích 17 Tiesnavy 2 strojarskou 2 Užventys 1 Štulíka 1 stratégies 2 Tengyi 1 Stittung 1 subthermophila 24 trutnovského 2 Spoluvezni 3 taženi 4 Tichoty 10 srpkovité 57 statecností 1 Truffet 1 televize 3 squatting 1 Tlomackiego 6 Tibetan 1 Tsogtbayar 3 Stahovaci 1 Tehuetzquitizin 2 Vesniných 1 Suganumovi 1 Tomates 18 tchuo 15 Trpný 1 uznáváném 1 Türkrében 1 teckových 1 s hvezdickou 1 Trebská 4 Venu 95 stanovisek 7 Sverákovy 4 Tužší 3 Štóský 1 Tamakasuga 1 uhlava 2 velkosídlište 2 Tavelli 12 superbrány 1 spovistyly 1 spoutával 2 stredoslovenské 1 suchadolina 1 tfal 22 stavidel 1 úpictí 3 Tetrev 2 umeleckých 1 Usplash 10 svobodomyslných 1 Spirálku 29 ubližuje 1 sudeckým 1 Sunneghu 3 Sovínek 1 Vaneové 1 Stolnímu 1 Tiniem 28 SPADy 1 Sprachabschneider 1 vees 1 s výklady 2 stagnorum 2 Tulancingo 1 umistily 7 šumových 1 Surrounding 1 Staríci 4 Sušilove 1 Ukera 1 stanovských 1 tripurabhairava 3 Stázina 6 šteteckem 1 Staroindictí 1 Tomeckem 14 teenagerský 2 stahováku 6 ubohost 922 Town 1 Valterovu 1 tyglíky 1 thien 2 Timpanaro 2 Storckiella 4 Termizo 3 Tržícku 80 tuhosti 9 vavrínu 1 Stöwera 23 splneným 233 Stránka 1 Stulginskému 1 Susanto 1 Splitterschutzzelle 2 Versillat 65 tramvajích 1 Tichová 4 theologa 9 STOBAR 1 tubula 1 Tvřrfelli 1 Taseltof 12 Tropic 1 trampum 4 sulfidové 5 Takea 18 sylabotónický 1017 Terry 5920 úradu 3 vete 2 TVolshchuk 7 Trello 1 Tolya 1 Syringomyelie 1 Taurem 2 šumavka 10 Stiklestadu 1 Tlanepantle 1 Syosset 1 Végortovány 2 Teterev 1 Supergiant 5 ubytovaným 2 Trousdalea 2 Timewarp 1 SVmost 1 TRANZITORNÍ 1 Tóthové 1 Umuryabo 14 velkorážní 2 tirelis 1 vestálce 1 Sylowovi 1 Tzum 1 Valtrubice 128 Tromsř 1 staatskirchenrechtlichen 1 Stolcke 1 syndere 1 Tauonové 1 Templová 2 Sundhoffen 1 Tavný 1 Stölln 3 Vanis 1 Totorvieciai 1 Theiningsen 5 tvrdýši 1 svanského 5 Tovaryši 2 styx 1 TECHNICI 9 upácil 1 ubumwe 5 spojenkyne 2 Spurzheim 1 untergegangenen 58 tichu 2 Uroplatus 2 Travisa 1 vandélií 1 s okupacní 1 varex 270 Velvyslanci 1 usmevave 15 Sovetice 4 submisiva 3 Svedocanstva 1 subadultním 6 Translajtánie 30 triviálních 1 TELESAT 1 SSPD 3 Typicy 2 testimonio 1 tmavocervenohnedé 1 Tropengewitter 2 stejnonožec 1 Stebenkou 33 Vaniak 154 vážila 41 svahových 1 Vasquezovou 1 Strik 1 Venaticosuchus 1 s Multatulim 1 Szalonu 1 Tresero 5 trasák 4 synchronizacními 1 Timbilil 1 Syrakuse 51 Stredoškolská 1 Sovinon 1 Surinamu 2 Váhou 1 Valichanuly 1 S rostoucí 1 verwöhnten 2 turbolaseru 3 Thíra 186 talír 2 Ustavila 2 Strangessona 4 strano 6 Southwick 2 Tookera 7 Turkménu 20 Symplocaceae 282 Turistické 105 Stab 1 Uljun 2 ubíjela 10 stínka 1 Udhëtoj 1 trisulfidy 2 svazáci 1 urceny 1 vedeckofantastický 1 USp 2 tvorstvem 1 sumidos 2 Supilo 4 Vancašem 1 Umuarama 8 spropitného 15 spolužijící 14 transition 1 Tolteca 2 Sueových 1 Vatovaea 1 Tužimský 2 Stuerzingerová 2 Szylerzowice 1 Tromlitzové 1238 úprav 1 s predmetem 2 Sussuarana 1 Teocharis 1 Supersonická 1 trenérstvím 1 Tertil 103 svarovací 1 toajen 1 uvarím 1 tetrahexakontan 1 s opozicí 6 Underdunk 1 u nich 2 Svorová 7 Svobodnému 1 Suzukimu 6 Turtwig 1 ße 2 trítýdeník 1 trípinové 2 Supia 2 typizujícího 2 Svalouše 7 Sušenky 2 Thaws 105 surrealismus 1 Vasumitra 2 sympatizantech 6 Suchanek 1 Ústeckúm 1 Tamasfiho 1 Stoocník 10 Únosnost 1 tupláku 1 Unruochinkové 2 thermo 1 teosofickou 1 Sutoka 10 Touretteova 2 Torgler 5 spalovacímu 3 Tappen 1 TVshow 1 uklizena 4 vahel 1 Svolána 20 tlape 1 vedomostními 1 ühesääsaaz 1 Szentiványi 1 vendas 1 trasírku 16 Strážske 2 Travertíny 12 spievam 1 triactyricátou 1 Superdomácnost 2 Strenc 2 Turoszowa 19 Trojicní 1 Teotihuacánská 2 Urbanner 1 Verhofstadta 40 Turá 1 Värkovou 1 statolitem 1 USATC 1 tryskácový 7 trípruhý 3 Venizélos 1 úkapum 1 Tâm 1 szybka 2 Stadskanaal 4 Supershow 1 sylogistice 47 Unterluggauer 1 sverepu 1 Suiseki 1 Tadžiku 2 Šylko 1 Svítkovská 2 Tienu 4 Teddiursa 4 telegrafisty 3 Šurou 1 Teigemu 1 Tsuranuke 1 Ufimskou 3 Verbovský 5 Tybor 1 Špelka 1 Tuindorp 1 stalkeri 1 sportovné 8 strouhanku 1 Užpelai 4 Svarovat 2 Tembu 9 uzdravený 6 uverejnenou 2 Tepperovy 1 Turócbalázsfalva 1 supermuže 2162 ú 2 turbodmychadle 1 Szíjj 1 Squrr 2 Steinerove 14 stadióny 254 Teplou 1 s klasicistním 1 Stávᚠ3 Timmym 2 ujdu 10 Torová 1 underwriteri 8 varšavskou 1 tríhroté 1 staroštokavské 22 Torp 28 ústeckém 2 Stasa 1 uchystal 1 s oprávnením 8 stáváte 1 Tartarii 1 Tetivou 1 trináctikilometrovém 4 steeple 70 utíkali 1 Tandleruv 1 Vadnutím 19 Veracruzu 1 uplavávat 23 tlakomer 13 Syrovic 1 thaj 1 Validate 1 transpozicích 1 telomerám 1 stránkovacímu 24 Suchovršský 1 Stoldo 1 Telchiny 2 Vald 31 Ursprung 2 ucebnicovou 1 Šumen 5 Technolog 1 s výhodou 7 uzemí 195 Topolánek 13 Tâi 2 Strategische 2 transdukcních 3 sultánech 1 Valtrex 1 UNAEC 3 Spácovi 4 Veltro 20 Valerianaceae 37 Spadla 1 typovaném 15 szm 3 Summerfest 5 Šurán 22 Starku 5 traditores 1 uuk 2 staffid 65 Vajnory 24 Thymelaeaceae 1 Tugg 3 Stepmania 1 trevše 1 Ulissa 2 stemmi 386 Storm 3 trnoží 1 Týneckému 1 Strižice 4 velrybka 1 Synthon 2 stráven 5 ucitelkám 14 ulusu 51 strategiích 1 s profesionály 1 trojútkovou 6 Stomatologická 3 Tenebre 1 Sovetio 1 Tadakuniho 2 vertikutace 16 SYSADOA 376 Tell 4 tupit 89 teriéra 9 Sternberk 66 unifikované 1 Valentýnovu 1 štukaterským 1 Strašeckého 6 streamer 1 Tritrichomonadidae 4 Tämä 2 tetramethrin 1 Teiova 1 spontánímu 2 Tsátoumas 1 Urcuyovi 2 veterinárské 1 Tochúa 1 Triént 13 telemetrických 14 tesány 1 Strandbad 1 úsporek 1 starokimerské 1 Sternwheel 1 Toolsmith 18 Stürgkha 1 valentýnských 2 trionfato 6 symbolizovaná 22 umeními 3 Suverenom 1 Tripterospermum 1 talosianské 1 špeclí 1 Taubenek 3 Templetonová 4 tajemny 1 Stricknerem 1 s nežidovským 76 Uhlicitan 1 Tildem 12 Turgut 1 Tepantitle 1 Ukrývací 1 Temüderovu 2 Stríleckého 1 Trávnicku 1 Spodumen 1 TZWYYkdbY 8 tate 1 tipováno 1 spojima 5 svetlohrbetý 31 Spikaly 1 UnConventional 1 Sumjafu 1 Sutomis 1 tattvou 1 Szeghegy 3 Vajolonpass 3 Toniatti 1 strelovitá 3 Trichoplax 1 Suburbicariis 1 tenzometrech 1 Tücke 1 Valuty 3 Stén 10 úrednícek 1 tolrestat 1 Unalasce 3 Tumca 1 Spongastericus 6 stormtrooperi 3 Submicron 2 spolecenskovedná 5 uctivému 3 stepování 7 sovineckého 1 Tevin 1 Tupolew 6 Špionátor 1 tajbrejk 1 Terranského 1 stuz 1 Staleymu 1 Topolánskova 3 Usik 1 teures 1 Tránkovic 7 tetraphylla 104 Velicenstvo 1 Stahlherm 6 verejne 2 vasinek 2 Terrus 2 Soyuq 1 Suchdolskými 120 transformuje 1 uapierot 1 Venteského 1 Valící 42 ústric 1 Szaniawski 11 uav 2 Trombe 55 varietách 3 trudovogo 37 Urceno 1 Tour Haining 1 trivakcína 1 Väärikusest 6 Strojárne 1 Tói 1 Stebbinsoseris 1 turkestánským 20 udelaný 1 Svojšek 1 varkinské 1 Spaihts 1 Transmissus 3 starcum 2 suäna 1 Veikoso 76 Tamerlán 1 unparteischen 1 UigChessmen 1 spordihoone 2 Swansonem 24 vepri 7 Varickij 7 valkýrami 1 Torrentz 1 spoluprcovat 1 svítiv 21 transformacemi 133 telech 3 valcíkem 1 Stremayrovy 1 Typographiques 1 trockým 2 Suomalainenových 10 Šuškevic 1 STIMB 2 subchondrální 70 Straubing 1 Uhyne 19 THRAK 3 tinkturami 3 Thiebaud 12 sporttestery 1 ulitnatí 1 Trebováku 789 telefony 38 utopické 1 Verlainovu 1 starenje 7 vápencovitým 1 Vercef 4 STRÁNSKÝ 6 Stunning 11 Ulicemi 2 symbolového 13 Tatlin 32 Spadea 1 Stappove 1 Tinyatoxin 1 Tussilen 1 verchušky 30 svrženy 3 vendicante 1 úzkoprofilových 3 Tydlidát 4 Trzepizur 1 Supertankery 1 vänskapsbanden 5 Vauvre 4 Stelziga 12 Turkmenistánem 9 Téže 1 Tešanji 1 Svinutí 1 Velitelstvi 1 tőtta 1 vacuo 2 Sudetonemci 2 ufinancovala 1 tituli 2 Verbannten 2 Svetnovu 2 Trastu 2097 spor 4 Strechovite 8 Sowell 1 Sükheegiin 2 Vanblarcum 3 thorakoskopie 2 Užlieknis 13 Štítovka 11 talírky 9 Válcování 1 Tormáskert 4 trojzubka 2 Svatoboricemi 18 Vcelar 1 Vasiliadisovou 91 souperovy 1490 související 1 Verbyla 1 Takacukasa 1 Travcický 3 Štyrským 1 vaihtai 2 Torovirus 1 trialkylhlinitých 121 Uppsala 273 Tikva 3 Šplhá 1 Szaladják 1 tympanometrem 1 TALVISODAN 1 Trichixos 1 transputers 1 Spodosols 5 Stavertonová 10 Trumfy 2 tanaitické 7 tonka 1 Szörnyek 1 Stežejky 2 Tüürova 1 Talanovi 9 université 15 Túbí 309 syntetické 1 Teopolina 1 ucesali 1 transduktoru 2 Valsaria 13 stoupenkyní 1 Svetlušce 3 táflováním 1 Trémona 5 Tedeschiová 9 uverejnilo 2 Szabadhídvég 569 über 3 tryptofanem 100 stáji 97 superpoháru 1 szczn 1 Umrel 8 vázanku 61 tribunou 2 Spongipellis 5 Véry 45 uctíval 10 Vejcitý 1 systémemech 1 thestage 21 špalda 2 Tivatem 1 Tatrmani 3 VASP 1190 velitelství 83 Štancl 88 stredového 2 tešanských 1 vampýrské 1 ušpinené 1 terdecima 1 Švenka 1 sünské 2 stránce beautifultimes 1 Syama 2 Swarowski 3 TFW 1 Tarkatzous 3 Sviranje 1 Stepanmakarov 188 vešlo 1 Tuckerton 1 Swapování 2 Tombalku 1 Timofejem 1 tercer 1 therávádových 5 Vavrinecký 1 SSSI 1 USFL 1 Taldoranu 2 Uberem 1 Terebinthos 1 švindly 4 Theogonii 1 Uršulinská 21 Tejkl 10 unisonu 1 Tojame 1 Sugarless 3 tribunálum 41 Spathiphyllum 2 stenografický 1 Trombotizace 2 Svartedauen 27 superpocítacu 2 Tuty 2 Vazná 3 Udakaová 89 TAG 33 turnerské 2 Therumu 1 Tešanská 2 strítežským 1 svedernícké 1 ubykace 40 Vavrincem 1 Srholcovi 1 velkomembránový 6 traversem 1 Taenioglaux 1 Venecianova 1 spajany 1 Šumavanský 1 Titraci 1 Szterhasem 3 Transe 2 Szentdomonkos 109 Subotica 1 Usen 16 spavé 10 vareny 261 Toskánský 3 swoim 1 Tocníku 5 testovacímu 12 Štrbský 1 Suchopárová 2 Towe 1 Šporkiana 3 Uvalení 4 Tenglerová 1 tugendsame 14 Vcelari 1 Tracas 1 Toltécký 1 srpskich 4 utichaly 10 valníkovou 3 sultánský 2 tasuke 4 trzy 1 stratified 1 strašákovi 1 ßt 1 souz 1 ULH 1 verícího 15 titány 177 tekoucích 30 udržitelná 18 uschování 1 Sukuriai 15 strohosti 9 utkány 1 Treskilling 19 Trézéguet 2 Vérteskethely 2 Vernius 2 šroubovitém 1 Superfantastico 1 Velkomoravských 1 Stadtfeldfest 1 vení 36531 sveta 7 Tugboat 5 Sozajev 2 Sukoradské 3 túž 2 vandalskému 1 TitanKrios 1 spisoch 1 tisícenásobne 3 uzbeckému 14 Tödi 2 Vasiljevického 25 Strážném 1 Tsholotsho 1 Štála 2 trojmorí 1 Vespoli 69 Ústup 1 trinium 1 staropolským 2 Theaterschiff 3 terenie 44 Szávay 1 UUNET 2 Trimetrie 1 subnitens 1 spravedlnost… 11 Udaj 1 tachtaj 2 Sudario 2 štetno 1 teleftaia 16 Vetra 1 Suzumuši 1 Štyria 607 source 1 spartánského 16 steward 79 verzím 2 s?ta 1 Stampalia 11 Trixie 1 Triballu 1 Spasybi 1 Svidnicka 102 speciály 1 Thematische 41 stopyfakta 8 ventrálním 1 Straževa 2 Srubový 1 toplekar 3 s hlavními 2 Tanchelma 6 Velázquezova 3 ungarisches 1 stadiónových 1 Starukhin 1 Spoerk 1 svrchnokarbonského 1 Thorson 3 streetwear 1 starobardinština 1 Uhrovic 8 Superettan 25 Vápenky 9 Strategií 59 Ukrajinskou 1 spoli 4 TCRa 1 Verfehlung 6 taranovat 1 Verfolgte 2 utopía 6 Vanilovník 3 tufitických 1 Sündisznó 1 Tištení 1 Spoluzasvecení 1 Velé 209 strech 1 totalizujících 1 spikulární 1 Ušic 1 Spirkinova 261 stimuluje 1 trojúhelnikové 2 Venušané 2 Strueth 1 Trimesta 1 Touristenorten 1 verfeindete 5 Ústavodárný 101 Svatováclavský 14 stélce 8 Špálovský 3 Triak 1 Spermien 56 Sperry 7 stenování 287 tex 7 stydlivosti 1 syngenní 10 Taiyo 3 Toutatisovi 2 Valangesovou 11 Spaces 10 Štejnberg 8 uhodit 1 Verteporfin 1 Trompetrova 3 úznání 1 Valdaufinky 1 tesákovou 2 Uragánu 1 Váchalovo 1 vendera 1 Údrcských 1 symetrizacním 1 TANTNER 1 Stronciojoaquinit 4 Tetrakarbonyl 13 tourisme 1 Surinamci 4 tropismus 3 svatojirskou 1 tschech 2 Tripet 1 textovali 1 Triakinae 1 Tybergovým 5 Šurovský 1 Vanquisher 9 Unica 2 Staubrand 1 transmisivita 3 utahoval 1 úžívánu 1 sulfuryl 2 Tőniste 1 Stormarage 1 Tuzoltó 1 TOMÁŠKOVÁ 11 Spravedlivých 33 úzkolisté 1 Sršne 1 toleratnejší 4 Tatarsky 176 spalovacího 58 Svetozár 1 Sulpiz 37 toskánském 21 tecnu 44 Stroupežnického 342 uvedením 114 streleckých 1 Turangalîla 1 Strachonových 5 úryvcích 3 Strandzha 1 telnatejšími 1 umagském 2 teranu 28 Umrel 1 transmisních 4 trojfederaci 2 Suetinovo 4 uvea 1 synostózu 91 Trvá 1 Umývám 2 testium 1 thoracoabdominalis 1 trojstupnového 1 Vásárhelyiem 1 urianchajští 2 Vessa 1 Stronegg 17 Trasimenského 12 váháním 2 Valtrovicích 2 s permanentními 1 Varonil 1 totonackými 12 technictejší 5 svolaly 1 Strodl 2 spoleh 13 sputnik 3 Tomáškovy 18 Sporofyt 2 Trichromatické 2 Transarc 43 tichém 1 therap 3 Turritopsis 3 vedecká 718 sovetskou 1 varicellová 4 Tsiavouová 1 Urbáškem 1 Sozialer 3 Tlouštíka 1 Univakuolární 4 Vejen 1 Vernalu 2 Svobodovým 1 Tuchscherem 1 Tazna 17 Špitálky 2 Upanišadám 1 trimonecie 2 sukovice 1 s Marcusem 2 Vaite 1 stýh 1 Strogyj 8 Trebce 4 Tretími 1 tvrdoše 2 Tisma 1 Uitlanderi 2 švenkr 1 üstünde 1 Sumálina 9 Tavener 1 tykací 1 Vaiste 9 Úplatek 2 tresky 3 Strombolicchio 2 spíchnutých 21 Thaďs 2 Verschüttung 12 Úpravami 5 Untouchable 48 spalnicky 1 SRGB 1 vagonzaky 9 sprintem 2484 úkolem 1 Vantikovu 8 Úcastnit 1 velmožích 5 Uzelac 2 Tatku 5 Tetrahydrocannabinol 6 Steuart 10 tarator 5 úvahovou 5 spoušti 2 Torchefelon 1 Titsem 31 tinnunculus 6 univie 9 Turovský 8 Šujský 1 Švabin 1 stanicová 1 Tothrezim 1 tochondrie 64 syntaxí 1 Sugrívy 1 Tascela 1 s Ludwigem 1 Splashrear 1 threadId 1 Sturmerovi 550 trzích 143 spravováno 4 Stockhaus 2 Sunspot 1 Stankostrojitel 2 Šuici 1 Targos 1 trójana 1 SPADLO 1 Tutteovi 2 tonkawa 1 Steyrermühl 5 techstepu 3 Spana 4 Valey 1 Starckovi 72 uniknou 2 Vehlgast 1 Speltenbach 8 urbanus 1 u okraje 8 s jejich 1 ThemeID 21 Tocna 1 Terakawovou 1 transfuse 1 Svetlik 1 strojniho 1 vendéeských 3 ukrainska 2 Tertii 1 Váleková 1 strá 1 SykOsicK 19 útocnost 48 sraženinu 3 Stillstand 3 Tagliaviniho 19 sverená 2 Tacuto 5 veraikon 8 Tantehorse 1 Unterperfuss 1 Stargensonová 10 valtické 1 Traunfall 1 Töchterschule 19 unášena 1 Trídicka 2 Šuškavcevic 1 Uosukainenové 1 Thulsu 3 Ursmar 1 tisa 1 Srponem 7 Starliner 2 tehdä 3 Trubicové 20 upozorneni 6 Vaudricourt 1 Stiebritz 2 Taminem 1 tovacovských 2 Torrovou 11 spravy 1 ucarováni 7 umocnením 1 trojhvezdném 1 Tylette 9 telegrafických 1 Sprinterka 1 thrasheru 2 Ukradeni 2 unionované 19 suššího 1 stoplusjednicka 143 SZDSZ 1 TACR 3 Spudis 1 upozorniti 1 ucän 1 Twaronem 18 soustredene 1 Šuller 2 Štechova 16 uspíšilo 1 Sphaeroeca 1 strawbfan 2 supice 1 strartovala 1 veraecrucis 2 Sveama 30 Symbolistictí 5 Syse 53 Tvoje 1 Unfalluntersuchungsstelle 3 Stictocardia 9 souradnicová 7 Tamzin 3 Švejdovi 1 Szaflary 2 telovým 2 Talyše 2 Tyro 2 Tucholski 1 Storožev 2 synonymen 2 Surian 1 Velkobasový 1 Unterrain 1014 svatba 1 Strujkyní 18 syrskému 1 Togli 1 Talman 1 studiouri 14 synchronizovaným 1 trecímu 10 Talasu 4 utopismus 1 stratiformis ušárny 4 Tripodi 1 spusk 3 uzbecko 3 Stonerová 2 stripovacích 1 Vetrusech 1 Temšského 1 Stronacha 2 Truchan 12 Uzené 3 Tarapaca 3 Tihamah 2 Súci 21 Totus 5 Synagogen 1 spongolity 1 SyltExpress 2 upresnován 2 Theobaldus 1 toponomastické 1 tužticky 1 Tonuzlu 1 Strangfordu 1 Sutore 7 telenovelách 1 Tríhodinový 3 Tiszta 3 Tukuda 31 specialitu 1 stealthem 1 titánkou 2 Stangeho 1648 srážek 1 Tirumulara 1 Sver 32 Tongatapu 1 Težište jeho 4 tryskovými 4 utopistických 13 tisíciletím 18 Spach 1 vergleichend 1 VelkéRover 1 u nesvobodných 8 tuple 1 stvolnatý 1 Vchovská 1 spádovaná 1 Tigranjanova 8 Stevard 3 Teera 1 vakanci 2 uvozována 1 Tsouderos 1 Sudirmanovi 4 Vangrip 1 stopaktý 12 Uživatelem 512 trojlodní 1 Stravovacie 1 Sprandi 2 terribiles 6 Surmovkovití 1 vestálkou 220 spjaté 2 Teclem 4 Ujkovicích 2 Toilettentisch 7 Tunner 1 Stukalskij 2 Torriem 2 Stilhed 62 VEU 32 študákovy 1 veröffentlichte 8 trhanec 19 ustalovac 13 Trvají 2 thalamickými 1 Temlem 9 tegumentární 4 strougal 1 vakoveverkovitými 1 Uldina 11 Vespasianovi 1 tvrci 1 SYPTÁK 4 Tabacco 1 vedledomce 1 verlebten 2 telemarský 1 trikovým 38 stromoradím 1 Ulyssia 1 vencovém 316 Valentine 1 unsh 3 s príchodem 1 tume 2 SWA 1 übersinnliche 7 subtatranské 4 Sportivnyj 1 studenaloucka 2 Verini 1 tuony 1 Sukkot 13 Tsukisamu 1 Stinskému 5 Sulejmána 3 tetrameru 1 Trenzem 1 strhány 1 strecigon 1 uceneckého 1 Strakon 1 stoosmactyricátý 1 Šovinistické 4 Uponor 1 SSDR 1 v?dríve 1 Suecofem 3 spathacea 1 Ujlakovcu 4 svrchnojurský 52 spolujezdec 6 Sunair 1 stravaganza 1 Stuchlém 1 Southcamp 1 Testlink 15 truchlit 1 Thayaufer 20 stredotónovém 7 Stillfrieda 5 spy 1 traumatizovanému 7 tetanie 6 svetcových 2 tmavocervenohnedá 1 tessellatus 1 ukáznují 1 Tecolote 4 uniemi 2 Struthionidae 1 turgorové 2 Unterpolaun 59 Thatcherové 1 trombembolii 18 svereném 1 šturecká 3 speleoalpinismus 1 spazmum 4 thébskému 1 Stockwela 1 Trailové 1 Theisensteine 1 Tortosou 9 usmernen 1 triklosan 2 trojplátecný 32 terminálech 3 Syzyfowe 1 triašedesátiletého 13 Tureckého 1 Toleva 19 valeur 5 uhlazení 91 uctívat 1 Tormasovuv 31 Soustreduje 1 Toraidžin 5 Tuca 1 Starosedlecký 2 Vejlby 21 stálostí 1 Steibacha 41 Tré 4 Vendi 7 venez 1 Terebellidae 2 Torgaev 2 Strahn 1 Venustatrochus 3 ukrížovaného 1 taneczna 126 velšského 5 tantre 13 Stainer 1 Takac 1 veleradu 1 Susitny 1 Verdrengh 1 Sponzorování 1 Telecapodistria 3 Thórovu 1 StrelouPodloží 1 TRŽNICE 1 Ustrute 40 Stĺhlberg 27 Uvedme 1 Tholeitové 1 Thjálfi 1 Strandmann 1 Strapazier 1 Taevaskoda 1 Vahlodea 13 Spieß 1 telan 1 sportservice 3547 svobody 3 trojúhelnícku 7 Taifas 1 Venusaurových 2 Tomsula 5 stredohrudi 1 telocvicny 6 Ugrofinistika 10 stisky 3 Turbiv 2 Staschek 8 triskaidekerakt 1 Tešme 68 trnitá 1 Tingyin 11 Tranströmer 3 tricetitisícový 3 tepperi 3 Vencesl 1 tázanému 1 Tryczan 9 SuSE 16 Stück 4 svištom 1 Stevensovo 1 tributárním 2 texturovacích 2 Trichomonadidae 1 s vydavatelstvím 35 štukový 22 svacina 315 Uživatel 10 Teklý 1 ůbhlan 2 Struct 1 t?ma 2 tankistou 1 Upéndra 2 spárovacku 1 Taroty 3 superrychlých 1 Switchgear 40 svrchnoturonských 5 Stejskaluv 1 tupovostí 2 šroubum 1 tichje 1 Strykerova 1 stavitelove 2 Timravine 3 taxikárovi 6 Starburgu 1 s jezuitským 1 šour 1 teyy 9 tollánské 1 tažírna 1 Tujetsch 5 souvercum 2 Telę 4 stillgelegt 1 tonganské 1 Stomporowskiová 1 ulicnickou 20 svezení 4 Uskutecnené 2 swiaty 7 Sútry 1 s šírkove 1 subokulární 4 Úhrady 2 Ulfssona 1 syžetove 3 vdr 1 titulkovaný 196 tónem 11 spinového 2 Topicem 29 Tomislava 1 subjacea 10 Umístili 2 ultimáty 1 tornieri 41 Svetoslav 1 Unigramový 2 Tellurium 2 Troubat 2 Tropheé 3 uUtvar 2 thereminy 1 Trojický 1 stremchovému 26 vdecností 1 thymidylát 4 težkopádnejší 1 Stratena 2 Takayanagi 1 uvité 6 spilit 1 Thúkydidových 1 Starohradský 1 študý 1 Tapline 3 ústeckému 1 užívije 2 Tekumseha 1 srác 70 suverenita 6 strangulaci 111 uverejnoval 2 Taimni 1 Thurzuv 1 trichlormethylnatý 1 Tobeji 16 Vedejs 1 Štrban 8 stibnit 1 Tumananova 1 Stodolsky 1 Tétrade 1 trimuf 36 turice 15 Velcovský 1 svobodnyj 3 úvalovitá 2 Szkieletor 2 uvazovací 1 veljestä 8 Vedeckotechnické 52 symbiózy 2 Utilitarianism 1 vel 1 strašívají 1 spoluveritelské 3 staronorsky 99 souprave 1 ukýt 8 Uhrínevsí 1 SPOKAR 1 Sprangerova 1 Stodole 3 stram 172 valu 3 Vaughanem 5 splétaným 6 Tabilo 1 Trzesstij 1 thari 11 Steinlen 1 telemarketingových 1 Suziina 1 šózu 57 Sychrova 4 Valdengo 1 Ujul 18858 T 1 sväzov 13 ventilového 55 sýc 7 ucházejících 1 Szaibelyit 26 Strabóna 1 Stockleyová 2 spojleru 2 Šuplíky 2 úspešn 1 svíckovém 1 szörnyu 1 Užvižiai 12 Treplev 1 Tibetskije 27 transsexuální 2 šrotovací 2 Vaudrimesnil 1 teroá 1 Spamoza 1 unifikování 1 teenagerú 1 Urlop 34 Torana 1 Tooker 1 Tyroxin 15 Spitteler 9 Stien 1 Tanasan 1 uchazecský 2 Vanwell 3 uje 2 TURISTA 1 Stoppardove 2 Strathkelvin 1 spieghi 1 Tobrmannová 1 Talowskiego 51 spoléhala 1 thiokyanidem 1 Trousilovi 13 svobodomyslnou 1 tempelhoferfreiheit 2 upoutáním 2 Splintera 6 tenkozobec 2 Ústeckými 1 Thietmari 2 subterra 2 Starland 101 Unreal 2 stárková 1 Vallancem 3 Svityc 2 trojbandu 1 Twisties 1 svedernik 1 Tannenberského 4 Stýskal 18 Spaliny 3 úpady 6 Úvoze 1 šprtka… 1 Stubhann 1 SvetlíkOrchestr 1 Übersetzbare 1 Trailway 1 trian 2 Trémaouézan 2 tepregionu 1 Taudou 2 Torstensonovi 2 transplantation 431 stezek 2 Strasserovými 10 Tvorivost 1 Svatojakubska 4 Trsnaté 1 Stradina 8 Teenageri 5 Tresa 1 Vanatu 1 upadáním 1 tlamicka 62 tupým 83 úplných 1 spondejském 1 traderu 1 spódium 1 Útesem 1 tmelenými 4 suicidium 1 syromalabarskou 1 Štovicková 20 superiorem 1 Vernyhorova 1 superfinišovací 3 Svatonovicemi 1122 sporty 2 Useknutí 1 Šreinovou 1 Tamangy 1 Vértiz 1 tlacenicích 1 strarofrancouzského 2 Tudmanove 30 Tepny 1 ubojoval 9 Uhrích 2 Vének 1 Staubblatt 24 urychlovány 1 Stredomorští 8 subgutturosa 2 Sulovske 79 teckované 2 trubickovite 1 Svetecký 2 spinocerebellaris 2 Tuchina 1 Spinksuv 1 vatska 1 valerianovský 1 transfusio 1 ŠPALKOVÁ 513 Velitel 1 Spatzing 17 uloupili 1 Tameri 1 Stanlym 10 Tralles 30 Stúpa 71 Terezka 1 Tabernakulum 1 Telaví 1 Thomazo 1 Sudhirendar 2 ved? 1 TARVOS 487 tajná 1 Vakare 1 tullen 1 s asi 1 ventrilia 3 trestneprávne 1 tibetskych 14 touchpad 1 turtleBack 1 Tesném 3 sourds 5 Uke 3 Unterlagen 7 Spiší 1 tjeckisk 1 Václavovská 1 s podkrovím 12 vázanosti 1 Tilocalar 11 tajomstvá 1 Sternhellovi 3 stratotypy 8 ulevila 1 Stutzová 4 Staromestských 3 Towsonu 3 Varixy 1 strojcu 1 Tschörnock 1 Verträgen 33 Tomei 1 Šurala 7 velkolepejší 1 vénami 1 Svojšínem 4 Stanimír 2 specifikovaní 1 sphagnikolní 1 swoich 2 Susimail 1 upravovatelný 3 traim 1 Süova 5 usídleného 2 ulovo 5 superspeciální 10 Truskavets 969 úcetnictví 1 squashista 22 usmernovacu 1 Taplin 4 Valdštejna 1 Šulíková 1 urcerné 2 Sussmanovy 2 uebelmannianus 1 turronu 6 Stanul 1 Thiemu 1 Tagaloome 1 Temüderovy 1 staroušci 1 Stojime 1 Urnerboden 1802 téže 10 ukryly 1 vampýrku 1 tengeren 1 Touaregem 5 tiaratum 5 Squat 2 starobeloruština 3 triumfujícím 2 Thibouville 2 telekomu 1 Unzi 2 throated 7 trpkost 1 Urysohn 1 TpegML 44 tenoristé 1 vchytit 2 tegmentu 2 synodálií 1 Stefanovskim 1 Temescher 7 Štastnejší 1 Tuhému 1 strírná 43 Tvrzište 145 Úplný 51 Ulsan 48 vesnicek 3 Stasiukem 1 Tribhuvanaditji 3 UDKU 24 Švorcová 2 stolittyakh 1 vakokrtovití 7 Steplinga 3 trýznitelé 2 sulfatid 1 Steventon 1 Sudby 17 svalí 4 stupnicové 1 Thüringerwald 3 Stéfanie 1 Vegetations 12 Stabiae 2 vedru 1 triporátní 9 turistka 1 uctitelka 1 Úchylné 3 Ulyate 74 town 5 Stanislawovi 3 Übersetzer 1 Tautscherové 1 Unciálu 3 Tatarkiewicz 5 týždna 5 verhaal 1 varhanista 1 Vacija 3 vernost 2 Tersztyanszky 2 Turchányi 1091 spolky 3 tetrahydrofolátu 97 Studánky 3 Tranquillityit 4 stránkují 1 Vasastan 2 Urgesa 1 Verhaltensforschung 1 Svarádž 23 uzurpací 3 tisícikilometrovou 1 sulfanilimid 2 Strnadi 1 TiZrNb 1 Uldza 6 urbi 3 Suova 2 Terebovljském 1 Trapezunské 689 Stroj 1 Sporttestry 1 ursului 1 suius 3 Stajduhar 8 vasopresinu 7 Statní 4 telefonují 1 Timmse 18 tycových 1 urnová 2 temperací 1 suberbum 3 Tennie 1 Sražená 1 Verdalu 1 stredoúhlé 68 Teufel 1 thompsonii 1 Veljet 1 Tenemit 4 Takelហ1 Uršanábimu 1 Taceno 1 Urvan 5 tmavofialové 210 trvalých 1 Velvyslancova 1 Stadelsches 1 tithymali 1 Vampiro 1 Toudamové 1 TRÁVA 2 Strapina 1 Svahilsko 1 tretinky 1 stereokamery 3 Suada 1 texturované 1 uvykl 9 Struan 20 Tyhle 2 Stebnik 17 tríhlasý 1 tejada 1 Tetyaev 1 Tamaríni 9 Sverdlova 2 Theismus 1 Suomujoki 21 spáchaná 1 Ujgurskými 1 spolubývajúci 2 Valsolda 1 Uchiyamy 1 Stredoelamské 25 taženými 3 tylu 14 Speaker 1 valentova 2 Ventimigliou 1 Vajolon 2 splitteru 7 teleportem 2 Turkobijec 1 Stínavu 1 Spazmovi 40 štírovník 1 Twiterru 15 terrier 1 tetrakyanonikelnatany 2 strídacka 2 s Václavem 1 trebenský 1 Tuojiang 15 trávicími 1 Unien 1 Trmantice 2 sterilizovaných 2 Spojku 3 Splashdown 1 supporty 3 Ussheruv 1 Suiand 1 únavných 201 úplným 4 trumpetka 1 Vabojlnik 7 Vergiss 76 sverence 1 Taghlim 1 tmavemodrýmy 7 Speedcar 3 Tauresium 1 svedkov 1 Sucata 1 tólv 1 Syndesmosis 3 Tellefsen 1 valencijštiny 1 suscepimus 1 tsp 5 Tonkové 1 tienne 5 uvadající 1 troparil 1 Tyia 1 Taikici 2 Turkovu 1 udivujícího 1 Špacírštajn 1 Spooksvillu 160 Štaidl 3 Toltech 186 tecka 4 tarbagan 9 staroholandský 1 Vertčs 1 Sucková 3 Surfaris 80 Vesnická 1 Svudný 1 s výrobci 1 Stochovskému 1 Southworthský 3 usually 1 Štiborovi 6 vázanému 1 Uenohary 76 Velemyšleves 1 valjevským 1 Tornalya 4 Tidningen 173 svatorecení 1 uchýlím 1 starokorejského 1 Sprousem 1 Stoevaová 2 Strananská 1 townsendi 1 Uolauki 1 startky 1 Välba 1 stykováním 1 Thelocalyx 1 vespasiano 2 Traxlerových 3 Tessebachu 1 upozornovadlo 6 telecímu 1 Trichomycina 2 Trébry 3 Soutter 1 Šuve 9 tlouštík 8 Špicberku 2 Vanonus 1 Telekvíz 1 stravovaný 1 Vedecé 1 startéri 4 Unavailable 1 stegosaurovitých 1 Swayambhunath 36 úmrtností 2 Svištová 7 tesáním 2 updatovaného 7 Tempelhofu 1 Sušilovec 1 Tadaoem 1 Vairja 1 Thumimu 3 Tenge 1 Trachenbergu 3 Tegalus 1 stríbronosném 1 strížovské 3 Tailchaser 1 texta 1 umenšily 1645 udelat 1 stellifera 3 stramberk 906 Úvod 1 sulfonylu 1 s dosavadní 1 Sveceni 1 Svoradovcanu 3 Tenzid 1 Swendsenem 1 Toltéckou 1 tesknením 1 Valení 1 sportovknyne 18 Veteran 3 Stankom 8 ubývala 1 sychravejší 1 Tentaciones 3 timeline 2 Tameer 40 Strukturu 1 sovineckých 1 štylizacnom 2 txz 1 Tušnica 12 Strassenbahn 3 Takaudžimu 3 Th?c 1 tríkopulové 66 únavou 7 tmavnout 2 Univac 1 Ústicí 1 Testudinella 1 Verdurinová 1 vasokonstrikcních 1 Strukturovanému 60 ústredne 4 uchopte 7 Tlaku 28 Velicky 4 Valjancina 1 Strzyz 1 Tarbatem 9 Tamare 1 ŠTYNDLOVÁ 26 Svinova 1 tetrahydrufuran 6 Špinavých 1 Stranske 1 s nevýrazným 8 thyminu 35 Tatlot 1 s budoucími 1 Stredoevropskému 2 Velitsovi 7 Troubsku 1 stíbrný 1 Udmortovová 1 Valazé 2 stycnících 1 štumperem 80 takzvane 4 termosety 2 tamarilo 1 tisiciletí 1 Trzyciez 284 statí 2 údesných 8 trog 28 Tocné 1 svetovoma 1 tironskou 1 Townshipu 1 Turczel 1 Srednjopodravska 40 Todt 5 teplákové 104 Vetrní 7 Tarrenz 555 stáje 2 Štefanák 1 twarc 1 tetraedrickém 1 Troxella 3 Torborg 2 souzenými 1 šrafuru 1 Vanyarc 12 Trnavským 1 trioxanu 1 Strossovu 1 Vestmannských 1 Tržné 23 Takeuchi 1 Varistaipale 1 termokras 1 Šrinagar 2 trihydrogenborité 6 vals 1 Tonaso 1 Šterneberk 13 strihové 2 Thörnblada 1 Valne 1 Steganographie 1 s prameny 1 Tyrellovi 2 Superbáze 2 Verchnaja 1 Tredos 1 truchtopis 1 StGenisdesFontaines 5 Speleomantes 6 Taxaceae 36 svárec 1 Twekobe 3 sunshine 1 Ucebních 39 templáre 28 strhávání 1993 spojena 5 ucednických 1 Turneaureit 3 superlativní 206 Specifikace 9 Studenecký 4 Tabelace 1 uncinnatus 4 Supplinburgové 2 Torglera 152 staviteli 1 Vení 5 Tsalal 2 statikovi 1 TOŽK 6 Stra?eni 1 thuriferarius 616 Unix 1 Vazzolera 2 Turgajské 4 Togrul 1 Vanským 1 Syete 1 urbárský 1 TRHS 1 szólj 25 Ulrichová 1 sverenskyfond 1 spojila… 14 Tejmur 1 vdechového 1 teljes 2 svammerdami 86 ukryty 1 Stenochalena 5 svalnatými 3 Trikotýn 1 trojvazným 1 Thaisy 8 Stinská 1 Steamband 2 Staskiewicz 1 tuberkulóznímu 10 uteri 1 Thottumkara 1 Tenzorovou 6 Takehara 1 TeamORIGIN 1 starovýchodoseverských 1 Vekiške 10 Sueur 2 Swaiko 1 Vávrovka 1 stolecku 1 sviati 1 Útesové 1 Úpických 123 Sucharda 1 útorištem 8 Šteflová 1 speedballs 1 Stereophones 10 Valova 5 tisknuto 4 Vendelínem 123 Svitav 1 Stagnation 1 toxokaroidním 1 Trovatelli 1 Tuharovi 1 spatreným 2 symbolictejší 1 spurtéri 1 Swizzling 4 Varlám 1 Vadžetou 687 verejností 4 Telcském 1 s Fondu 5 svéhlavého 1 ugmented 1 Spectak 1 Trichocline 1 urogenitálních 4 Tavcara 12 štvát 1 Tremaynových 30 uvedomením 1 Triethylaluminium 1 Tupinambech 2 trecentorum 8 struh 159 Spocívá 2 Vencko 1 stosedmactyricátý 2 Spoluviník 2 taktovce 5 tukana 2 Stahler 1 Spadernových 2 Torokina 1 Twighlight 3 tonsura 2 Traunreut 1 Vartozo 13 Tvoršovice 1 Treigys 2 stranaFile 1 Stensenovi 1 verwarde 10 swainsonii 1 Tuenttt 582 svety 15 tencích 2 Trimucrodon 15 trimest 1 spongiaeforme 66 stremhlavých 3 stle 1 Troublesome 1 tristaclenný 1502 tem 2 utesnenou 1 umbelloides 8 urbanizovaného 1 Steinunger 1 Tembagapura 1 vertické 1 Urbin 1 Travenovy 5 Vadhana 1 trinitárskému 2 VCF 1 Sperrinu 3 Toncek 1 Tarybine 4 Tinilau 1 srpovnicce 9 Taphrina 2 Trilussa 1 spoecenský 9 tichooceánský 1 s príspevky 1 tsukame 1 Svetloletech 5 ucitel 22 vchodový 1 Varix 19 strážící 1 Tomocika 1 Stohový 3 splacená 1 šúdrum 2 Telmofágie 2 ustavujícímu 1 Ubytováno 1 Szczerbaka 1 tenguv 1 Usaczow 5 trampolín 1 usczesliwiona 2 Teyjat 1 Strinišce 1 teplovodivým 1 ujdi 1 Vanclová 2 Vendinelle 1 Venizeluv 2 vamána 291 Tate 3 spoluprodukuje 4 Trichoptera 3 spätmittelalterlichen 1 Vejmelková 3 SPÁCILOVÁ 2 Vancelle 1 stolnom 2 sychrovským 1 Vachulky 18 Stieber 1 Ursua 2 Tabbertovi 2 Turdžeman 54 uchován 3 Tyranky 2 Túžby 48 štastni 745 Stojí 1 s odlišnými 2 Turranius 11 Torresova 78 stredomorí 2 ujednává 1 Venky 2365 stanic 1 Tomaška 87 Thalia 2 Starsmithem 95 stadionech 1 Trashorras 1 Stroe 19 Velkoprevorského 1 uderns 1 Tarqunia 1 urovnávány 1 Telipinušových 2 vesicle 2 thuje 15 trisekce 6 Talírové 1 úctujícím 10 strechovitého 1 Übershwemmungen 1 tripuerum 9 validovat 1 stihavka 23 uhnout 48 Telefunken 3 Totožné 2 Trívrstvá 1 subprefekturou 38 stríšky 33 Thiosíran 1 truckeru 3 TRAVAIL 10 umocnené 21 Strnada 1 Urfe 3 Umístete 3 speculí 1 Syens 1 Turkensteen 3 Tedovu 7 urcovaný 2 tupolistá 18 strednedobém 1 surfaktantum 8 Svépravicích 1 umožnována 7 Tabora 1 spiller 2 terofytu 11 takeláže 54 upuštení 1 Trapkovou 1 tractu 1 Šplhavý 1 termofyzikou 1 thyth 3 trojobal 7 tehotenská 1 Staintona 1 ternopilském 1 Steavovi 9 Stíhán 7 Ustaritz 3 Timed 1 Vaitongo 1 Trimany 1179 ukoncen 1 trojpatrové 75 Vanyar 1 umplu?i 23 Svitu 3 stiban 6 tolštejnského 1 Verschillen 17 spektroskopicky 61 tongyong 1 ternetz 10 vazelíny 1 tekovskou 1 Teodard 7 stezkám 1 Tarita 7 tisice 1 Urumqi 1 universalovskými 1 spomienkovú 2 Stevenynová 7 Švekšna 1 stužkovací 5 Trímesícní 2 Trojicníku 2 Sphyradium 1 Thibeauxe 9 Véron 3 Stassfurt 1 Tyranosauroid 120 sverila 1 Tiszának 1 temoignage 1 Stavitelová 2 Tudeils 8 Thoros 5 stékal 1 Varjassyová 1 švihákem 3 Súdánských 2 Tarasem 2 Suveréna 1 taxikárky 1 stráním 2 Tlustoklasec 1 SPaT 3 Tith 3 Trieda 11 tombe 1 ultranacionalistum 1 Sprichwörtern 252 spojencum 1 Sprachbaues 9 Tužinský 2 stríbrozinkový 2 Tranströmera 39 Srbec 5 troubadour 23 studen 2 utraquisté 62 strojne 1 Stoherky 2 stellung 4 TexFAT 1 Uploaderi 1 Treplan 3 Szapáry 3 Uvádela 2 Terrane 106 Vecernícky 636 sportovci 3 Transcultural 1 stotisíciny 3 Triboelektrický 1 Tarqeqovi 1 Staatschulen 1 Tajmyrsko 1 Tossin 5 thiokyanatany 9 Studentky 9 Thuri 3 Theodosiánských 16 Veleštírovití 32 uveznila 1 stredonizozemský 3 Tröstrem 1 tájmem 8 tobogánu 1 Toshihanda 1 Vesieetjunk 1 Thijsseho 2 suć 1 tsingtauense 64 staroceská 1 Sunamganj 16 Urválek 3 svatopetrský 4 Terpak 3 Vaccarini 1 svatojanskou 1 Tsambali 25 Thunovská 5 Thurzu 93 stežni 15 valným 1 toxikomané 1 Stroock 36 srážlivost 1 tichne 1 startovacímu 7 stomatitida 1 Syennicza 1 štítinská 2 stopetky 20 Tomíkovice 5 Varilo 2 Stolinská 1 stopetkrát 7 Tluchorovi 1 spolecností NEOPLAN 3 Trapellaceae 6 Uhric 1 tinospora 2 uzpusobovaly 1 swappery 4 transducin 1 Steenbroeck 3 úhorem 2 spoluzaložením 1 Ustupeová 7 triviálními 7 standartách 1 Splaškové 60 splynuli 3 ŠTURC 1 swapper 146 Spolecným 37 Squamata 19 Spolehlive 1 Spaargebirge 4 Veii 1 Tarnuvky 3 Topiaryho 2 Stokerovi 10 Spevak 10 stlacují 1 Tőutsi 6 statisticka 1 Steviosid 2 spoluinicioval 1 taurinergní 2 Stegnospermaceae 1 Stenkilove 159 synkarpní 1 trojnánásobným 1 tripode 3 stimulantem 1 s peknou 1 Ubiligisclo 3 Thorfinnovi 29 Suhrovice 16 Václavovo 5 Verhaegh 2 sponkovacek 2 struktហ1 Stoltzuv 5 Vecerky 1 trasmutace 1 Stasina 6 Sukhothai 68 Varvažov 1 Vavrušou 7 tarbícci 3 Tuczno 1 trolloval 97 Temným 2 Strungk 1 Verchovyna 3 Verzilova 2 Surfarky 1 Uskupením 2 staroríšských 9 tepelskému 12 Throwing 6 Surinamští 8 Tirole 5 Stanovník 1 štamparski 2 Taxopodida 2 Stipagrostis 1 Szigetvárem 9 Velkoknežna 1 trpet neonatálním 39 Špak 5 Südwestafrika 1 stationDo 1 Superskalár 2 Underová 3 Ulmské 22 UKIP 1 trutha 17 Stopinová 11 Sukorad 4 Verliebte 6 tepenný 316 špatnému 2 Susser 8 Tropaeum 1 s vyhnutým 1 Ungaliophis 12 Špindlerovým 4 Sušic 6 sypkovina 1 vázacímu 1 subhorizont 1 Tonmand 25 Treskonice 1 Spolulezci 22 TeV 8 Torunn 1 Ucidou 1 vemluví 2 subcapitatum 1 státí 2 útocnici 2 Tomenthypnion 1 thokemmer 1 Trešczi 1 Strandovi 8 streženým 37 užších 8 Sremac 1 Tonín 1 Úboci 1 Tyrona 1 Teledünya 6 Theurg 1 submontana 2 Trémonzey 1 Tarki 1 Trebovárský 1 Ukradenými 2 turkish 3 Trongcharoenchaikul 34 suspenzi 176 Venera 88 Tanvaldu 1 Tennouke 7 Upload 1 STILA 1 StrizakDusk 2 tokusecu 1 ulimit 1 Stiniva 2 ubrana 8 umocneny 1 tiranskou 41 Tristram 3 Vargem 1 Tyrwhittova 8 Spolupracovníky 8 ukvapené 2 Tolkienová 2 SVHC 1 Verenamünsters 17 speciálem 1 Témala 3 Tuláctví 83 stredozemní 1 Svatosávského 239 tungu 1 Steenberge 1 Troubadix 5 Velímský 1 Tygrem 1 spoluzaklatelem 2 Teleradio 4 telekomunikacemi 311 šupinami 8 Thigmotropismus 1 tavlinginfo 1 tokyjské 1 Tieho 1 Traugottuv 2 tlacítkových 1 Toremifen 1 Tricastini 2 UUA 1 štítskou 1 Stejnak 1 Strážkach 1 stawiznam 1 Vahrám 1 trousili 2 Sydenhamuv 1 Sternech 14 Urgenc 1 Swinwart 1 Stempffer 1 Udda 1 valentýnskou 1 Vanzijlia 9 Veneti 4 starousedlými 6 Trhací 1 Šventybrascio 2 Ucítí 2 Štíbrová 1 Theemem 1 Tolendo 7 suchomázdritým 2 sroubená 18 Tranoscius 2 strieborná 1 Spájivé 2 TRAMix 1 Suizeie 1 Uznadzem 1 Témiscamingue 10 vadžrajánového 1 titanum 1 sumaria 2 subcomandante 5 stasis 1 thugy 2 s polarizacními 1 TACGGACGGG 2 Trockne 1 terraformovaný 1 syistä 2 štrkoviská 1 udavacka 1 Trebechovském 1 Stránští 1 Štatenberk 1 tricyklistické 1 Ungarischjakobsdorf 4 Tomašovský 103 tektonicky 3 Tandil 1 strháváni 11 Variantu 4 trívrstevná 1 upamatovati 1 Tešovický 2 Vchynští 1 velkoguslarského 59 úmyslného 1 Stadlerovo 79 uhlíková 20 spálená 1 Vaitl 2 Tromen 2 Vaíl 5 Tendances 27 velkovýrobe 1 Topielisko 1 tuliaisia 1 Spolehlivých 1 ústred 1 uralisté 2 Šplhavé 353 Tremšínem 1 Užknopis 2 Verchamp 35 Totožnost 34 svatyních 2 sterilizována 7 usnadnené 1 s živou 2 STRAN 7 Starnawski 14 vandalských 3 Stantonovi 1 Süpplingenburgu 1 spazier 53 Štiavnice 5 tlupami 2 troufalou 1 Synodontidae 1 Turlík 1 Urbervilles 1 traetta 2 Špendlíkárka 1 s heraldickými 1 Teneniel 1 Udry 1 vernemen 1 Tchongjongu 60 Strážovských 445 Vesmír 4 Spitzkopf 1 Uzurpátora 1 tribolelektrické 2 Traxshun 1 Taveniera 5 Stýkala 1 Telecovo 6 spektrofotometry 7 Spoved 9 Vermes 22 Tumbo 6 Toh 1 Sylvestrovým 5 unicus 1 Tyburnské 1 spoluvlastnené 16 totipotentní 1 Velekrálovna 54 Stránecká 1 Supertzar 3 Taegu 1 Sulaqa 2 vazospasmu 1 s takovou 7 Thumbelina 1 Spolujezdcem 4 Šuranský 2 Tahsin 1 Thurotzium 2 svazujícího 1 stredosibirské 38 trampu 3 tabebují 1 uplatnovaných 1 SPolecne 1 Tovaryšsta 2 Valmaru 18 striktních 5 Thiamová 1 tenders 1 vénovali 1 supervarietas 4 úlové 8 teenagerských 1 Vaadinovské 1 ugaritská 4 Uyar 1 spolubojovnicí 6 uzrela 14 Steenburgen 1 Transaralská 2 tyrkysova 1 Valm 1 teriérIrský 2 Taliesetra 1 Valtellinské 187 srdcité 1 Syntrophomonadaceae 1 Vernerové 2 Undermann 324 svítí 8 Staffordshiru 1 transbalkánské 1 technickoporadenskou 13 Triuridales 1 Strohost 5 štekající 1 trinkende 1 Upshalla 1 tromso 2 veltruského 2 tricetikilometrový 6 sverováno 1 uterine 1 uzamykatelného 1 Tarabut 1 Sowinského 1 TRVÁ 1 Vestales 1 synovinu 2 tuknutí 3 Spätlese 1 Syuichi 1 trofejními 8 Trei 2 úvratovou 2 Tusculanae 2 uvolnovaní 1 Tolminského 1 strílíme 1 Sternentau 14 Vahlovice 1 Uagaduguensis 1 Tyflologie 2 šudó 33 Thursday 1 s ovládacími 300 uvedomení 1 umfangreichem 3 Unitop 1 Varjaty 6 Šupinovité 974 takovým 1 Steklacova 4 stigmatizovaného 4 Urxovy 1 urgellského 2 šrotace 3 uhelny 1 Uschovat 2 Vadhany 3 Teleuti 1 Vetrané 1 Tithoria 4 Uprchnout 2 Státecek 41 Týnici 1 štípatelná 2 tríuhlíkatých 2 Vallerange 1 tenuicula 1 tlacenými 2 Vaikunthu 199 stežuje 15 throw 1 Urucca 9 Springera 6 temenního 2 Svinodasi 6 Thomasové 298 UNIX 2 Tisel 562 vc 1 tádžickými 1 Tošinodžó 3 splavení 1 Tojin 1 Theodosianon 21 vegetabilní 4 suflér 19 surface 1 Taillanter 1 tohunga 1 Štepianský 1 Traiul 1 Štrossova 1 Ubehla 1 Trotzköpfe 1 Travela 59 tlamu 1 Tuńon 1 Stepnak 6 turbogenerátoru 49 usoudí 1 útaboril 1 Tutanchamonových 1 suxamethonium 1 Trichechidae 2 Švábenicova 104 square 80 Strážovské 6 Soupere 2 Teplíka 10 techniques 166 stylizované 3 Trojalbum 14 Veselky 1 Venkmanu 1 Tetty 2 svírajíc 1 structor 4 Ukawa 1 Vavrdou 29 spoléhalo 2 Studenikin 3 strešovickou 1 Teiglinu 18 Tokajská 1 Tynecka 14 Supercharged 15 Travelling 2 spáchati 2 uzdravovací 1 Vašíkovi 1 uonka 3 Struttura 4 Stabsbootsmann 119 úžinou 2 Städtebahn 1 Uamba 4 s výstavbou 1 stínovaných 5 Svešnikovova 2 Umstadt 39 surfing 2 ties 4 Urbanizmus 1 tajgový 23 trílistým 8 Superligu 5 Thingolove 2 Torçay 2 trofejové 5 uplatnitelnosti 1 UWF 6 Verechov 1 Štambuchy 5 Vaury 6 útržcích 1 TALAGRAND 6 Underclass 44 tmavomodré 3 Trabura 10 Vennes 49 Starovicky 739 vdaná 1 tucka 13 Sturmuv 19 ultrabazických 1 úcinu 1 Szprotawu 1 studeneckém 1 Thalo 2 Trachtová 36 Tagil 1 Ugun 2 Ueberreuterova 1 Szinyeri 1 Switter 1 Uloko 17 systematizace 4 swizzle 3 stoletja 1 Tatjevik 1 Upovu 94 trakci 4 Sturua 1 vaeiantium 59 Užitecná 1 toxaemica 1 sukénkem 23 Théry 3 stežujících 1 Ünepi 2 Sprok 2 Tčche 3 Trierweilerovou 11 Tranzistorový 10 svetlonoš 1 transplacentárním 4 TIMEA 3 Tríbodový 2 Valtriniho 4 Usiers 17 velkoformátovými 1 Svitovyj 12 tax 4 svedomia 1 Tökölská 76 uhynulých 1 Titéž 2 Urbancic 9 Swiety 36 ThinkPad 2 Straning 2 Tarkingtonem 1 trackpadum 2 trafoplechy 1 tríznakovou 3 sulzeri 3 umrtvující 1 Urážkami 1 szara 220 Tempo 1 úúbasová 1 s mrkví 1 Stubu 7 vecchi 1 Strischau 6 ŠVE 2 taekwondista 23 VDS 7 Valamas 1 szilmegská 1 stradacovou 135 stýkat 1 usporila 1 ucnk 1 Typisace 1 telefonistky 342 upravenou 1 Verset 14 tragen 116 Transporter 1649 vetru 15 Velletri 1 tongchuan 161 souvisela 333 Veci 1 Thibau 2 Steinkamp 1 Spiekermann 1 tetraamminplatnatý 521 Tvorba 91 suverénním 2 spasmum 10 splítky 1 Uhýbání 3 ujednaného 6 umeleckoprumyslový 2 tworca 1 Throstle 140 Szent 1 Uygun 1 suspensi 1 umistete 37 soustredné 2 Vartmberk 1 Vardolov 1 šrotovníku 2 Uncasuv 3 UnrealScript 1 Swierze 1 ungeborenes 1 Sýkorího 1 Triomma 1 Strzez 37 Torkki 1 venovaného 2 tsiis 1 Sprejeri 27 svatebcanu 2 Tvam 1 Tedzani 1 Toichobat 3 structuralisme 2 Tarterona 1 Tymonek 4 Subhash 1 spinadla 1 sulsel 1 Stopp 1 svlažována 3 Tams 2 Tessoualle 1 trojsedackovou 1 Sväzok 1 Ulcík 10 Titzl 4 Trebsínem 1 tesnenými 1 trakac 2 Theologicum 1 TINAN 3 tampury 1 Varnagel 10 turbínového 66 valašské 1 staroturecký 1 taekwondoplayers 1 Storocná 1 s planetovou 9 usporí 1 verfassungsgeschtliche 3 utrhly 2 švédskojazycných 4 Supermono 1 Urbanistyka 7 Velísek 1 telcská 1 supranacionality 8 Stražiska 1 Théophilovi 3 Spaceková 1 Tschoeppern 1 Thorfin 7 Tuckey 1 stumbler 1 Varšel 1 tyflopedii 11 Umbrové 1 velocimetry 1 Tigranocerta 10 užovkou 6 Spleen 3 Tsiklauriová 9 Unigraphics 1 synkopováním 4 Vaporizace 154 Sverre 2 Turpilianus 5 Úctyhodný 1 Upice 1 Turzovké 56 utržené 2 terazniejszosci 3 Upperton 2 Udolfo 1 Veškerentsva 649 úcinností 7 Tilliet 1 Staffelfeder 2 Tacinu 1 SrPb 2 Trombopoetin 5 Turmalíny 1 Swätý 3 Vélingara 1198 transfermarkt 34 vedomou 1 Theiy 7 Történeti 1 Svalnatec 3 Trerbíc 1 versioon 19 Tribunal 1 tei?d??ti 18 symbiotickými 1 spasování 1 velkoríže 1 valter 3 UIUC 3 Starotatarština 1 Thundorf 1 úredníkiem 1 Udela 26 tubulární 1 Stalingradských 6 Vdovin 1 transhimálajské 3 Susanuová 2 Turcanský 1 surintendance 11 Szász 1 Stálicová 1 Utrhl 3 Theilig 1 TeXové 1 stanicei 12 Tochtamiš 1 Taluhet 34 vázanými 1 Trentom 2 Subtelnyj 2 Staatsministers 1 Tretajakovskaja 1 Verbau 1 Vagnur 1 Trkfrkem 1 staroutrakvistický 15 taltalensis 39 Stam 8 Théodenem 13 Stickney 1 svycarska 5 srustáním 11 Správnej 18 Tuning 1 Suzukiovou 2 tau 26 spechají 1 vejhradního 21 upevnovali 2 Tojó 83 Taškentu 4 spodnejších 1 Uxbridgi 1 Sperrkogel 4 Turnagain 29 Strnady 89 urychlil 1 turcio 1 vellet 2 Teuto 2 vernostními 41 stoji 2 terme 1 Universatis 1 Velkoknížetem 13 Symbolic 11 strevy 11 Starokolínská 1 triptofanu 1 Sughereta 56 Tma 2 Terestrická 1 Trapstep 2 Utikal 1 stranovému 1 Varimathras 1 tyrfofilních 18 Teigová 1 talentlos 1 Tövisfalva 1 Stuba 1 Terpentýny 6 umenšila 1 Thilafushi 6 Underlord 1 stojedenáctidílný 3 umuní 1 verbenalin 2 Turynským 6 Vestagerová 1 Tekem 15 svérázne 1 udrízli 32 Studovna 1 Tristichaceae 1 svetniki 7 tvárící 1 s husity 1 terabajtové 1 tropicarium 1 Valchenstain 1 Torlactina 2 talkshows 1 Španovským 2 symediána 4347 údaju 1 Vaubécourt 1 stereopohlednice 1 szczycienski 10 Thieux 17 spuštenou 1 Tyrupalis 1 STmFUHTPKSE 1 Thrymgjöll 4 Therien 12 verzovací 1 subendotelového 1 Thomasomys 47 utržila 142 trestnímu 1 Talasem 1 tónov 42 Vaculíka 1 Tymošcenko 1 Važanová 19 umajjovské 3 Vasylevs 2 Tematínské 1 Steinpachu 1 Unicovského 490 stopa 1 tervueren 1 Suskem 4 Tsvetkov 3 Stacheldraht 3 Tahanovcu 5 Steinových 8 tripetala 1 tanozomu 112 umi 2 transdimenzionálním 1 Sundew 2 svíckový 13 Tára 1 Tlamacasco 1 trénuj 51 vetvicka 106 ústavoverný 1501 teles 1 trávnicek 3 Vaudémontské 54 strmého 237 ústech 4 Uruguayského 1 SSCCATAGAPP 3 Taíny 1 Svennberg 1 thüringisch 1 Stepski 1 tridu 8 ubytovatele 2 Urheberrecht 5 spatulata 1 Usigen 75 stodole 2 teutonským 2 Stelibským 1 Transmon 1 štír 1 spermi 2 VEPRIM 1 stavebnej 1 velimi 4 taháku 3 Svartidauđi 16 velicinových 33 TSA 8 usedal 1 termotropních 4 Tarbagatajského 1 Twasti 1 sulcidens 21 Sycamore 49 USCGC 2 toxikologický 1 Svržek 1 Syreety 1 veraltet 6 testujeme 6 Streptococcaceae 1 Stocková 1 Upevneni 1 Szervánszky 25 Steindl 564 úrovních 26 úleva 1 Tachat 12 Ulrichskirchen 1 TAREQ 43 upevní 1 sumun 1 Sphango 1 Vasiliku 2 Stofleth 2 tardifolia 1 Suuresadama 1 tmutarakánském 3 Veldumnianus 1 vápencum 1 uvržený 1 Tanifuji 20 Tecoma 20 Thérain 2 sylogistické 4 Svetlina 4 Taberna 78 úmernosti 2 Verlorener 1 Stirol 1 sužuvalo 3 stathouder 1 Steidle 1 Vacaria 1 Subleyras 1 trojlodi 12 Vardarská 1 Várkony 5 Tatjanou 1 TRENER 172 Venkovské 4 Vendenesse 1 Udelí 3 Tanafon 3 Submisivní 4 Veselovským 1 Tumarkinem 1 Summae 1 Táborí 1 vedete 7 tmavomodre 1 Stejnomerné 1 syrenovské 3 Tellaritu 13 subtribus 3 uniformovaná 2 tetrosy 33 TACACS 1 Sthánakavásinu 3 tePosition 1 toreutikem 12 Únosce 10 trunech 2 titulárnímu 6 Theberge 1 Thunplatzbrunnen 3 Truskawiec 4 Stekela 22 Stug 24 strukturálním 2 Sumár 4 TKADLCÍK 1 Tochtamišových 4 Vespertinum 2 usmirujícím 7 superpocítacem 1 tseh 1 Varende 1 Valeriu 2 Veilleur 3 Tandžó 1 úcetnitnictví 926 times 5 Thaba 1 Spelkova 1 údržbový 1 Vejdovu 20 suše 276 Toužimský 2 terikolní 3 Toreho 20 Ústavodárném 1 trencanský 7 Tichu 1 Sufra 4 TUCHOLSKY 1 TRACYHO 1 spigot 3 Teledeporte 3 Svetelná 1 Subutaj 2 Tempor 2 travaríkovití 1 Tschirmkau 4 Varzob 2 Todtentanz 1 Verlockendes 1 Tenei 2 Urbanity 2 Steinegg 4 vdechované 23 uplink 2 Usener 1 tocharského 1 Trewa 1 s natrolitem 2 splašek 1 Štoffer 1 ublížení 2 Úspešného 39 Tichomorské 6 Syrakuský 1 stounovských 4 trojsytného 1 Throsby 25 vdecní 1 verser 7 svetnicemi 4 souvztažná 11 Valianty 1 Úso 1 trojexpanzními 2 Unifikovaný 1 Unioniste 3 Trimontium 7 Temüdžina 1 tomŕquet 1 spinigera 1 triggerlytické 2 uhlírskojanovické 5 Sundština 119 toxin 1 Stopkoocí 2 Vellinge 1 Symonidis 1 Tulsídás 3 stromovití 3 Trunks 1 Tilburgové 1 Tubmanburg 1 Sturtovny 1 Tatroj 22 velodrom 57 Svete 1 supernatantu 1 Syntetika 1 Vernerovy 2 Tisalverové 13 SVM 4 Ugandi 46 Sungští 5 Stroutová 4 Velesoft 1 velkoklubech 1 Swingových 3 Trojanovic 98 Spirála 26 tlupu 1 Tonantzin 3 Vehmaa 1 Tchaslaw 2 štafetám 1 Svolané 2 Tomoo 2 Terremer 12 spokojeností 1 SUBtract 12 stupínku 1 Ungersbeka 1 Uau 1 Toraminae 1 Standpose 1 spolecenstvo 1 Veterniky 1 Strechovský 4 Tunguzský 2 svätojurských 12 struku 1 Utracen 4 Stanly 1 Tirschem 2 Vetevní 3 staroturecké 1 sp?ndi 2 Svatyne 4 Turkopoly 2 svetov 1 spolukombinací 8 Suzannah 3 tabulkovitý 1 Stredotlak 1 svojská 12 Trespassing 1 utajeni 242 strílí 1 sudozperenou 2 Stiebera 1 Svirelia 1 Szczodrów 2 succubi 120 sportum 1 Tissonová 1 spoluvedoucího 3 tetradekanol 2 Tornato 13 ust 1 Tamse 14 tihle 1 Übungsstunden 5 Štíplové 1 Staškovcemi 210 útesu 2 Squallovou 1 ssebou 1 unha 3 tüna 2 s duchovní 14 spojovacímu 1 synthetický 2 Svažitému 4 statistica 1 Suribacijama 2 USITT 23 Štedrenec 65 teenagery 2 Sybilou 1 Spomalovací 1 Teyba 4 Tristăem 1 suspenzorem 8 uchvácena 1 Toreticky 1 Upney 2 Tortuosa 1286 spojenectví 1 srpokrídlec 1 SpaceLoft 1 Swinomišskému 4 Tegejcu 1 Sundyr 4 Velencei 1 spoluprítomnost 13 Summoner 1 sprĺkets 1 Starosedelského 1 trimarany 1 subtenuipes 25 Štenclová 12 Tuhnice 1 Tapeti 1 tlumocili 39 Tambovské 1 Tolhuaca 1 Sprachforschung 1 s pašijemi 1 vápníková 1 Stevenstrauss 19 triforia 6 svazovány 1 traditorum 2 souplodím 5 uhnívání 37 útechou 1 Svjatopolkovu 1 Troskov 1 Uralov 11 Standardního 6 Tichvinský 1 TransAmeriky 1 vesseltracker 12 TFAT 12 Verkehrsgesellschaft 1 Umstritten 1 Tyrsibobel 1 Tomorymu 1 Unzeitiguv 76 svrchních 1 Tétaz 1 Szálnok 3 Thurles 1 ucene 1 triatlonisty 3 tolikéž 951 stredovekého 1 Súchovských 1 Tylolasius 1 Taipower 1 Tekli 1 Tengrin 1 Tlicho 17 úmyslných 88 Tian 1 tysešti 1 stoimy 1 unifikujeme 1723 velel 1 Tekste 2 Valentiniánovi 2 Šuddhódanu 3 svormova 4 Stanczyk 4 Triaenodon 3 vedutách 12 Uitgeverij 64 umistovat 1 Unterwoltersgrün 7 TKR 2 Susny 1 velkoprodej 1 Tykra 1 ultrabookum 51 Úzkorozchodné 10 Televisión 3 Tuplicja 1 Tsue 6 Strinberg 1 Stenežer 597 tabulek 22 Šyša 3 Tillmanns 1 TRU 1 uropatie 2 Tantaví 1 Tranava 9 toryu 101 Systémové 1 Szenario 2 verdiovského 1 Tabularizované 1 Ternavskij 1 vannjaiai 2 Turatiová 9 substantivem 1 s Petrem 1 tänne 19 squatteru 7 strechatky 8 trabant 6 travelátory 1 spojníky 21 Veste 3 Strachoticích 1 Varadou 1 űreté 1 uibs 6 Spojován 20 Übersicht 7 Stanišic 51 Vallon 2 ŠRÁMOVITÝ 1 Velšana 2 Trizóna 644 úredníka 1 Stradonický 12 trináctidílné 1 Tvaštrim 13 talet 8 starorímský 2 testaceoscabrum 1 Uvall 1 szíves 1 Tamanským 29 Úvaha 19 Ujezd 1 Sultepec 2 Vesting 9 udílela 1 Strömblada 1 Tadebciu 3 Valduggia 4 Vavrínový 2 Superhuman 1 Tiesj 16 Vacnatci 1 udelenení 1 tancíkové 2 striteznl 6 sžíravou 184 strojvedoucí 1 Stadtteil 3 texturní 1 teleradioterapie 3 thông 3 Últimos 1 štverorádkových 1 unguifera 1 vav 1 Trunev 3 Válogatott 65 tavenina 2 superkondenzátoru 2 TORE 2 USBC 8 Táiwan 1 Terst 1 Tepavcevic 6 Toti 1 staroslovenštiny 942 vesnicí 18 Sudík 4 tupiy 1 Švecovi 4 Valsonne 1 †Vasseuriidae 12 supercely 3 Tyranti 2 Stuare 144 tün 1 Tomovem 1 Talmbeka 1 Synácka 1 SpinetiX 2 tisknutý 4 Stoermer 6 Sucheniova 1 Themelis 1 SPKPL 8 úmyslum 1 transaldolázové 104 Vanecek 1 s eutektickým 3 Valgérard 523 stanovišt 3 Vcasný 4 Trápilo 181 vesnicce 1 Ugon 4 Tordesillasu 11 Traskavka 2 Spilsburyho 1 transpozibilní 1 starega 1 unordered 2 tvarující 14 svítil 1 Strossmayerovu 13 tázacích 32 templárský 1 Tipuloidea 5 temenním 6 Tenka 1 Stommu 1 TOMSA 13 variance 5 Uderí 1003 tyci 1 Spinara 6 Sylvestrem 1 surreálným 6 trehalóza 5 Techodely 2 Švendriukas 1 varnsdorfští 3727 uveden 9 strobiliformis 4 Varyáda 1 Stübbe 4 Valdor 1 Unterstriegau 1 STÁRÍ 1 Sprízneni… 1 ultralevicovými 2 trimednatý 1 stejnodélková 2 Trestal 2 Valmanya 1824 ucitelem 1 tanecník… 6 Srpnu 1 Terumotovo 2 Traitle 5 Trapinch 1 Taylors 1 stežnu 1 Verovou 1 taWIsaapiswaáNA 1 torakoskopická 69 Turnhout 7 sypaly 1 trojcetka 1 Swiderkówna 2 Taunusbahn 2 subplanifrons 1 Tikare 1 Tamblynovi 2 Tauriskové 2 Týrovických 1 Vedenejev 1 trenovými 1 Tutermaa 1 Talnachit 1 Usten 1 Trinitarian 1 Thuda 2 Ugljeviku 1 …vesnice 29 unum 1 Thráckými 1 uškodím 8 Vacanze 171 srážka 4 umbrosus 3 sulfhydrylu 1 Tristemonanthus 1 tritinium 1 tsamai 4 Swalot 4 trojzubé 1 Twinhooker 1 Storaceových 1 suspendovalo 236 trestních 4 Stopový 1 SRAW 5 Steinschulte 1 TAff 2 STBarnum 1 Triassocatinius 36 strážníky 3 talmudisty 28 Tactical 2 surovárna 2 Steckler 1 STPHA 1 Uvuga 20 tempomat 2 stegelmanniana 3 tubulárního 2 souplodími 1 tehnologijo 1 Sullyovcu 3 Stevensonuv 1 Superkonitent 1 Uško 1 Šúlem 2 sykonií 1 STIERLIN 1 Taporoporo 1 tajuplní 255 tao 2 twilight 1 Valparora 34 SOV 1 Spacemaker 7 ukládaného 1 spanelsky 1 s Kryštofem 1 tisova 192 ujmout 1 Srzeniawa 2 Únavová 1 Staroružová 2 Teátro 1 tonsillitis 17 usvedcený 1 Starkesovi 5 Souvisejícími 1 Trailla 1 Vendemiano 2 Trévien 3 Tompkinsová 1 teatrologové 1 Tauchsport 2 Squarcialupiho 1 Vcházelo 1 vetšíchmest 1 Transaminací 10 Tkaczuk 2 Urseanu 4 Traubach 1 svétlo 13 Tiszaújváros 1 VELCRO 1 Sousoším 14 spouštový 26 svorek 2 Strannixem 30 unifikovaného 8 Stephensonová 4 Spoleczne 2 Spheric 1 TRANSPORTKOMERC 1 Spinazzola 3 stredoperštine 1 Tantipa 1 testudinatum 6 Svete 1 Tajarim 3 Tauerem 1 vacenovice 2 s clovekem 1 velaty 10 Svatoboric 1 trojjazycníci 7 staroreckým 1 ucebice 12 špionážním 1 szíve 19 transl 2 Svinošic 2 TelT 1 strunovými 1 USIBOR 1 sztandar 9 stylistickými 2 strážnícku 1 Thorleiff 1 upáleným 1 Vaihingene 1 verohlasateluv 1 transverberace 258 užitecný 16 stredoškolák 1 Takamatsu 9 Thundercat 6 stereotypech 1 Veckelahe 1 verlorener 58 Velimi 1 tofflor 1 Valká 1 Steinheilovy 1 spoluzasvecených 1 Vanoverberghia 1 Stoelinga 1 Suchtelenia 3 Tamaryokucha 98 Trináct 8 spojového 1 svetovaru 17 univerzitnímu 2 trináctipodlažních 8 Sporická 1 UIf 4 Ukázaly 2 Ueberschär 1 Spiškého 18 vetvicku 1 Tryphomys 2 SprinxCRM 238 tenisová 5 Vadžgirys 1 Stockstill 2 Vernírovicích 1 Uškodit 176 úpadkem 1 vel 2 Teufen 2 trigonometry 2 uklizeckou 1 stipulae 1 Svánov 1 Štamberou 1 Tuwaiq 2 Termistory 2 Topolové 16 tetrevi 7 Tacibanaová 4 Urschullum 2 Sparr 1 utilitate 1 timáliemi 7 traktorového 36 Trenérka 10 Vettriano 1 Tinterow 1 ubikvitárními 1 Uglúka 9 Typologická 1 s frekvencním 1 Sproti 1 Tritinova 1 uvovených 1 stenozyga 3 Tacet 1 Uralischen 1 Úbislavicích 1 Tidenham 1 Tutua 1 Specularia 2 SuperKarts 1 ununterbrochene 4 tilts 1 sverepovec 5 Tagora 1 Trink 45 ukrižováním 1 Stibbons 3 Velehradském 2 ulmským 2 Stachovice 3 Tadamon 2 trisulcae 6 Stupky 2 tavasz 10 Temnými 1 termochemické 1 tasenou 2 suve 5 tempesta 2 standardou 50 trenérovi 4 Studénkovou 1 Tušinskij 2 stébelnatý 1 tangier 2 trojnožek 1 Trojdisk 23 Tarnow 46 Swidnica 4 Steinl 2 SUnit 1 Tantae 1 tabuovému 18 Theiss 1 Varoázy 1 Tomky 4 Vares 3 Thomasius 605 variante 1 traute 9 utužilo 2 Uhrínevsi 2 Telnického 2 ULCC 2 úcinnek 1 Tehan 9 tlumocila 1 Upevníme 2 sparvuje 1 Unterspreewald 1 StokerBram 4 Starkocského 1 tändas 1 srand 1 töröktol 13 Trucker 1 s hluboce 1 Ubytovávali 40 souslovím 99 tratová 2 uniatská 5 trabajo 1 Tauri 1 Thirringuv 1 studentekami 1 Startovka 1 vaaka 5 Tholy 1 tykadlum 1 svudnictví 1 Souvennir 57 špinavý 3 Thayngen 1 ŠŠŠ 1 Trisector 1 tagménu 2 strajkem 9 sušenku 1 ustního 94 stlaceným 2 Tepelene 2 tabulace 1 Svetelne 1 Totsove 1 štenicníky 2 toont 1 Teaterskole 1 Vadicovské 2 Ummendorf 3 Trevinca 3 Tonmi 2 susanna 2 svoleno 4 Tubbataha 1 úpadnice 1 Stevardiinae 1 véby 19 useknutí 7 strastiplná 1 turnerifolia 23 Swiat 2 trhne 1 Ugoršcine 1 UNWRA 2 Stopnice 7 trimováním 5 Totonakové 3 studentových 5 Vcelojed 1 utratíš 1 tragédii obnovilo 1 Vasilevskaja 1 strogenu 4 Truzenic 1 Teremným 3 Synetic 7 trsnate 31 tyristorovou 64 static 1 sukuma 1 Subramaniam 2 suchomázdritých 3 statistischen 1 Tanzcafé 2 Tacheté 2 tomatidin 24 Tuy?t 269 Štechovice 191 uklidnit 1 Tarfajský 3 Valdštýnsko 4 Turnkreis 2 transponoval 8 ubrouskem 2 turbinatus 1 Uzzanu 1 Taulipangu 2 Urmatt 10 Srázná 68 tinctoria 3 ulehal 88 Umeleckoprumyslového 1 Transylvánského 1 sugestibilitou 1 Štíhlých 1 Trójského 1 Tenuis 4 transponovány 1 uníformovaní 1 twenties 7 utajovány 6 talasémie 3 Theofrastovým 2044 sport 2 Sybir 1 Vestvolden 2 strupovité 7 TICO 3 Verkauf 1 Utraviolet 454 úkryt 4 Triquet 1 Strachnova 25 Stoney 9 vcasných 10 Tufan 44 Starobylé 1 vercoi 1 umbrinus 1 Temiz 11 Troyersteinu 1 s protestantskými 1 Strongylata 9 spalujících 1 texturovali 76 Srbum 5 Verarbeitung 3 Veisovým 1 starohrabetem 3 stékajícími 22 trolly 9 Stropcic 2 Tolisso 2 synoptik 3 Türkçesi 2 Veciti 2 Urdeni 1 Täubchen 2 Tydlitýt 4 transformoven 8 Thekla 53 spartské 1 Vanderkloof 7 spríseženství 92 Triangle 2 Tortuguero 2 Trebius 1 Trysting 1 úchvatnejší 2 uhlonosnými 2 Uchopte 2 usnadni 49 svolávání 2 teritorie 6 stínovaná 2 toaletními 1 theklae 20 undergroundovou 1 stríhanolisté 1 Thelobergia 1 taikonaut 1 Trichodiadema 39 Tratová 1 symphyandra 2 Tremezzo 7 svrchnojurského 1 TeleManagement 3 umenšené 1 Tabashi 1 tamug 99 teoretika 1 Tribrachys 1 tvárících 1 ústavnou 3 Turcan 5 Ukryl 1 vanadévatové 1 Tunklu 12 Šusty 1 Versicolores 10 Südmährens 7 vaskulitidy 2 tvárejí 1 Taurie 1 Vacarduv 2 supponit 1 Stresový 1 sukursim 1 Trebanickou 1 storiografo 2 supermana 1 Swieszynskie 1 Tiškevicum 1 Unterkieferabschnitts 10 tricuspidata 2 stoupacek 2 Tašovicích 5 Turcios 3 Vasiljevský 1 Väluste 3 uzurpátoru 2 †Telmatosaurus 4 Švýcarova 1 UKRAJINU 4 stemming 8 Tavná 7 svato 7 Tachár 1 Vajglove 3 uvalilo 1 Sqillace 10 Strodeová 1 sportbiz 1 Telesni 10 tandemového 1 transcendování 20 Tomlin 6 Úzkokolejka 3 Standartenoberjunker 1 Šurbikov 1 tinagu 1 urvu 1 Svršovice 4 topklubu 12 Stambolov 6 sponem 1 Vendolcký 2106 údolím 1 Suryala 8 ujednocen 1 svárliví 1 SURR 1 Torreuv 1 Tinticit 6 taricka 1 Uhlírové 1 Veeder 1 Tríúrovnový 29 thuringiensis 4 strouhankou 3 Sprchová 1 SymbOS 1 upek?a 3 UHKC 1 uhnitý 15 traktátech 9 surinamensis 1 stomp 1 Typizacní 1 souznení 85 spisovatelum 1 trojpásmových 1 tihové 1 veprinec 11 spišským 19 Švýcarském 83 Tarquini 1 s druhy 1 tlumoky 1 tygiel 8 Spousty 1 spekulativen 1 Strasserovou 1 Srovname 5 Vacenovská 1 Überseezentrum 10 Valaiského 3 Thawra 1 ufnukaným 1 spisowného 13 terorizovat 2 theologického 2 Tsitasem 14 Totoro 1 Tivoličre 3 Thatcherem 3 veselicko 32 úrode 2 Uvolnilo 1 SYMONS 1 transformator 11 týžden 1 Untereggen 454 spoluzakladatelem 1 syntaxtickou 9 Technischen 10 Stavebními 1 šoupat 23 Staroslovenské 1 Strena 11 Veselo 7 Typhoony 1 Ustunová 1 Tolypello 2 úchvatne 1 ToolTalk 15 Stanzel 2 stoperem 5 unda 1 substandardní 1 Treyovi 1 tuttojuve 13 Stredofranská 1 Taisho 2 Šubíre 8 Technistone 1 Tavitac 2 Šrejberem 1 vendeéský 1 suvadivské 1 trásti 1 trochejskou 15 Temperance 82 vcleneno 1 Taiwanského 1 spínajícími 213 synchronní 23 Taraji 5 sraženého 3 Svatorecil 1 Stavským 1 Travenské 3 tari 5 Uralmaš 1 velkostavby 1 upracená 10 tyká 1 Trujic 3 vetšinou 2 Stopper 1 Trevorcorbin 1 uvadena 1 tchekkjon 396 tehotná 2 Šupenberskou 1 vádium 1 Timisoáre 1 suzerenita 3 Strunný 2 Spangdahlem 1 Syrano 1 Turceni 2 tig 4 Tyndareovi 3 Uvogina 42 velkoprevora 3 uskladnená 5 Tayyipa 2 taškáru 1 Throndtjem 1 Teixobactin 1 Touha… 1 süls 1 Trundholmský 10 Theuerkauf 1 Vertybiškio 2 Sudetským 2 Tobback 1 szája 1 Teheránští 3 TChr 4 Thřgersen 1 Stamové 15 trkace 4 specifikátor 2 Upozornit 10 Vallelunga 1 tacomském 2 svárící 2 Uhlák 2 Tornském 1 uznávacího 6 Tedong 5 utopence 1 svhrnuly 3 Theotocopuli 2 Tomacevo 1 Tbilisi… 49 Ukázal 2 THEODOSIUS 1 trehalózou 10 Vavrys 1 StSophiaChurch 2 Thajwan 2 Torpt 1 sufistického 1 tautonomie 2 svítivka 1 stigmatizovaným 3 státovkám 2 táborníky 2 Theca 27 Temeno 1 šoupátkách 1 tofisopamu 1 velsicol 1 tigrinsky 1 SVETR 1 Uzpusobit 1 Sueove 49 šupinkami 2 toxigenní 1 Undewater 2 uzpusobovat 1 vertat 1 strašlivého díla 1 Veligostické 8 Tennanta 4 tuhové 2 Synkovi 1 trixischuba 20 stratégy 2 verliess 130 strílející 2 Tavildara 3 Valescourt 2 Städelschule 19 velkochovech 1 vazospazmy 1 Stichtit 4 Subha 1 typickost 1 Swoycowycz 3 Teiou 3 Tisis 1 sulejowskich 2 splynulé 1 Šrajner 1 Studiovi 1 tikke 1 Svéhlavost 1 tormente 1 Sponzorované 1 Staatsvewaltung 4 tetrarchy 1 Tanch 2 Spenserem 1 Valvifera 1 Stauffenbergova 1 Unterzwischenbrunn 1 sunflowerchildren 1 STERBA 1 szestabor 1 Vaia 1 Turrner 2 Thairé 1 Surukwat 6 Temüder 1 Stevenová 17 Újma 4 stádum 1 Sulkowský 1 staromodní 109 trajekty 1 Varíne 2 Uzavrenou 9 Tomanec 1 urízly 7 Tiefe 18 trojzubcem 1 Šterbácka 1 Steinbeckovi 3 unikátu 2 Texarkany 1 VeronaSZenoMaggScultureDx 1 Trillet 7 težebnímu 7 TUCEK 15 Starenky 14 Stettina 4 stavbicky 43 sraženin 1894 strediska 196 vada 58 Süss 20 Šušan 156 uchem 1 Strapinski 1 svetlonošem 1 územesprávní 4 Veceru 1 tchajwanští 1 syndikátních 1 stošest 1 untriseptium 1 Veldea 4 Strole 149 svrchovanosti 3 Valtakunnan 2 stejnej 1 špírka 3 tekavejších 1 turnianský 210 Tesarík 1 troúhelníky 1 terpy 1 Tatebajaši 2 truchlivou 1 utratíte 2 tjsvitavy 2 SRPC 1 Stavok 1 Srekjen 1 Tischlein 1 Teterji 1 városközpont 1 Tahmáspovu 1 striptéri 1 umorují 2 Tréprel 1 Trumpetkou 1 Thumimmem 1 starovereckou 1 Tetradymia 1 strapsy 1 Statthalterschaften 1 Taufman 5 Stiebar 1 tenuidens 5 Toasters 1 ustrel 5 Tubize 1 Štom 2 therapsid 1 Svinibrodské 1 ukladzie 3 utápelo 1 srdužení 2 Tieum 5 vaclava 1 Stankoch 2 štipkou 1 UPAT 4 Spinrad 4 Toub 1 trichocereusy 2 ucíte 2 staváku 2 Vecernicí 1 Spirorhynchus 1 tragy 1 Teuchstatt 1 Stadsteatern 2 Thalassia 1 Tsunamikiller 1 stupniceTAI 29 trojdílnou 1 Vanilija 1 steamboat 1 Stýskalo 1 stenné 1 ultimative 9 Stillová 2 trikrát 1 Straußdörfel 1 Thorvaldovu 2 Thulit 2 Toxotes 6 Torrigiana 5 spoutanou 1 Spišany 1 Sundahöfn 1 stjärnfall 1 Thurmeier 25 Tischbein 4 úsmevne 1 trichoma 2 tracingem 1 Úzala 1 Utopias 1 Switeka 5 Veijalainen 1 verejne 1 Tuppauer 3 Velkolomu 3 štovíková 2 Vensat 1 Velešínu 49 spreje 1 tríválcovými 85 tlapky 3 substitute 1 trioxid 1 uchycovaly 1 Takac 4 Untuk 180 svislých 1 uvolnenejšího 1 Verje 264 Španely 1 splavitelné 1 Tilbaras 1 Tsagaglal 16 Tyszki 1 vcelenské 5 Syrtsov 6 svarovány 13 Tortola 2 subekvatoriální 1 Stegosauroides 6404 TJ 4 Štencuv 2 surdických 1 tvárová 24 Suttonová 1 Spheeris 37 ustavujícího 2 urartským 7 tlumocnících 2258 úzce 1 Tomburns 1 Vaflové 3 tupíjské 1 Stavových 2 VÁROSSOVÁ 1 tvey 1 Trevas 35 Strílí 1 Telovýchova 5 srpkovitý 1 taty 1 tchajvanského 1 trifenylfosfátu 1 TEREŠCUK 1 tisícitunový 2 Teummana 1 spastickými 121 Te 1 tríprostorového 19 Turler 1 tvá… 1 strojo 1 s ceskoslovenským 19 svržených 1 STARTREK 2 Tillen 2 Tolko 2 tabernera 1 Thanatoxin 236 vetru 10 Spoléhal 4 storiedicalcio 1 Stammou 1 Valkas 1 useknuto 3 Talichove 1 Tamemoto 1 talli 1 Ullaste 1 Taheenu 1 umiri 1 Tvojo 1 Transitivní 1 Turauský 18 Unido 1 Unóa 1 s?tvorjo 1 Synusojda 1 Templeskou 2 Veilly 16 Stepník 15 Tyce 1 Syrabane 1 VERA 1 sufijského 1 spacifikoval 1 spoluinvestori 1 tutori 3 Thorgersonem 2 vetkanými 5 tokoferolu 1 Vafţrúđnira 3 Trencavelovi 3 Thajka 62 tuhém 10 Stewartovou 5 tercios 16 stroboskopu 1 ullus 1 štucna 2 Vagland 2 Stropkovské 1 Valtulina 3 Trishy 1 StatekNaNavsi 1 Stayneria 1 Tethra 12 Sykácek 5 Suurkivi 3 Sübeetej 1 Vejpreži 16 Spolecnice 1 s dvorem 2 TERC 1 svlažované 1 Torané 1 strukturujících 5 vanitas 8 studovaná 1 Tašbaši 1 Strzemieniowie 1 trídickách 1 ŠVESTKY 119 Vavroušek 2 úrodnému 3 Stereophonics 2 Verigin 1 Tüff 7 Vdecí 4 tradita 1 Trizone 3 šperkarských 1 Staczek 1 tare 1 Vartanus 7 starorímském 3 Úhošte 1 Udžicunovi 5 Trojhvezdí 2 Thčmes 1 Trazo 2 Vauthiermont 6 tolerovanou 2 vakfem 34 úhloprícne 1 splítkového 1 transtromer 2 torpédoval 1 Takimi 1 varm 2 theofylinem 1 Ulfung 172 trusem 4371 stupne 4 témy 1 Twitteru a 2 Stopnica 3 stromeckovité 1 telomerami 2 ultrakatolické 1 Sventozizny 2 verdugo 2 tardive 189 Strakonicích 290 Valais 1 Tumpel 1 SVOB 2 Straubemu 1 Stephanocaryum 1 trináctiset 4 telefonováním 12 umrtvování 1 Troskotovic 1 s tendencí 116 Strašnicích 7 Tewodros 1 Vanickým 1 Sylviu 1 SozialhistorischeMitteilungen 1 Uzne 2 tenž 6 Teressa 1 Staríc 8 usmrtilo 4 Tatianos 2 vábícím 2 Stanshalla 1 topical 1 Tchee 1 vandeli 4 Tóta 1 swatym 1 Terminos 1 Sukýnka 23 Starbrook 1 toureru 1 Uhynulý 1 Thayanithi 1 Valdeacederas 1 univerzite 11 troják 2 Valmalencu 2 Spalují 3 Stictoleptura 1 Vectivusovím 1 Tinnetto 4 vecírkum 2 Swanseaské 1 ÚSKI 1 Sucheniovu 36 sulfát 2 spekulativnejší 1 Surabíku 1 Tripolosu 294 Symphony 1 Urbanodendron 1 stravených 1 tutu 1 UNeMed 1 Stodólki 1 udolá 25 Ustanovil 1 truné 1 svilušce 3 Tulalipu 1 Veulden 1 stonásobným 1 Tipcars 3 uvarenými 1 vasantó 1 trentuna 3 strucích 1 Suévové 1 Ussak 3 ÚROVEN 8 Vasilko 1 valutum 7 Szczeliniec 1 tournelle 1 stringWithFormat 1 Teodino 26 Todes 1 Spectrus 1 Tsurtsumia 1 trichotomicky 1 Tjilaki 13 Velkoadmirál 1 Tominger 1 Stiellrfiedu 1 Tynybekovová 2 Tongmi 3 Taganka 1 Taldycupes 26 Uherskému 8 Štiavnicky 1 tsid 53 Udeluje 5 Stradonka 1 Utrena 1 TEKh 1 Tuttomondo 18 stoh 28 Šturec 9 Tomaschek 16 tatarskou 1 Uruburetama 1 Studentova 1 ucinkuje 1 Tomasevich 5 Veržbickij 1 Ugratára 1 thomaschurch 1 Vepsä 1 Urkundenbuches 211 územími 1 Sulajman 1 stoletíDemografický 3 Vasseura 1 Usvalka 2 taškárských 1 Tetraspidium 1 velkopestitelsky 1 stetometr 1 Syrotyn 3 tricetikilometrového 1 Uzbekistáne 13 ulpívá 5 štepností 1 Stopfenreuth 7 supervisor 1 súfíského 4 Süová 52 stupnující 1 Tycku 2 Spineshank 2 Trollhätte 5 Varila 1 synovii 3 továrníku 29 Teichman 18 spisovny 1 Verreauxovi 1 Trusovem 2 ÚJF 1 Variolite 21 Tacna 2 verzálkovou 2 Triumfálního 1 Vesaliuv 1 tuliban 349 Trebone 1 Stationfall 1 Tiencouských 6 unavenou 1 Vekselbergove 1 Spešove 9 Stinsona 1 Svvavrinec 61 Vážne 1 Tanski 12 udelány 10 Stapley 1 Toncka 1 Veseramona 8 Telemaco 33 tažní 1 Stepovak 28 uzavírána 3 Trotman 4 uznáte 17 trídové 1 thuen 1 symhytocynoglossin 3 Trna 1 Vakalepa 1 Tiswad 3 tetraedrická 2 Touille 1 Szelec 1 Tholianský 1 Tumanovovou 1 Toníckem 1 Stuosz 2 strídáte 1 Tíréovým 2 Trebichovicích 1 Stodolák 1 Valada 1 svarosloví 3 trampot 1 stébelnatými 102 stejnojmennému 1 Thalétovo 1 Tyrolensis 4 uzemí 2 špaletových 1 Úchvatní 1 Testovala 1 Tripundan 1 sskládala 355 tanecních 2 Strojilového 1 vaporo 1 Ulthar 1 Tridimeris 4624 UEFA 1 Vesu 1 Vanderwielen 1 Tinghrir 7 Taler 1 spoluvinna 29 Sporangia 4 Templeová 12 specializovanejší 238 tiskový 1 Tajchu 193 Tróji 3 Vári 1 Standarteführera 1 Válclava 1 Thoria 1 Stenogyne 1 Svetlovody 1 Utopit 1 tymi 1 Varlichy 31 Tamilští 4 údernejší 1 varikokéle 1 Teubrem 1 Sudeckuv 271 tibetské 4 Vanelli 1 telestreetové 14 Teologického 2 Tréninkovým 1 Tymoteusza 1 Tavastian 5 Tchajwankou 1 Vallibierna 1 superkondenzátoru 11 Ukázková 1 texturových 2 tryzubu 1 taas 6 Tondela 2 Urbánkových 13 Tuilerijských 2 Taconnay 3 tíhnutím 1 velleriflora 7 subterraneus 1 Supermalloy 1 udusají 585 Souostroví 1 spoluumožnují 67 ultrafialovým 2 SoundTracker 1 taoský 99 velicinami 1 Tuvalanum 1 STRED 8 strelnicích 20 stredoceskou 1 Stríbrite 1 ubezpeceno 1 Tatalas 7 toolchain 3 venerickou 1 taps 1 Toboyne 19 Svínoy 3 Syncline 1 svoem 3 Upoutaly 1 Ustrumca 1 Starocechy 37 srubem 1 Svecic 1 Tikalském 3 sprajtu 2 Spite 1 SYNÁCKOVÁ 2 tehotenskou 1 Steško 1 televízor 1 Tredall 1 s povídkou 1 tamaani 1 Tetce 5 Stilbocarpa 8 Tolis 1 vazduhoplovstva 183 tretihor 1 Valtikhonov 1 Thoneckem 1 s výctem 1 s Vazírskými 2 symbolistním 17 Strítecký 1 transdanubikum 214 tenistek 1 Tauchmannuv 12 Ulderico 622 Ubuntu 85 Stanková 1 Valsjöbyn 46 uvezneny 3 trasované 1 tesilovou 3 spermiogram 1 Vaccolino 1 Vavrenu 15 SVETLA 1 Texenas 101 uznávání 1 Vastine 1 Taubenstock 1 stéréoscopages 1 trinecko 3 ubehli 1 tekomárií 1 Vardhanáhu 1 Stagarts 1 trojprvkových 1 Trecionys 1 stránský 1 štetkovecek 3 Talthus 11 šprti 31 teplických 1 Totpédomet 3 termostabilních 2 Tsiiputus 1 vetšinu… 7 trepek 2 verify 1 trhavine 1 Verlan 1 Szela 4 uznáme 1 Tomarovka 1 Ustanovky 1 trojieho 1 s katolickými 1 Tiesenhausenum 8 s možností 4 Vaticanum 2 subtilnímu 2 Útulna 1 Tigilského 1 vakcinované 1 SPOJPROJEKT 2 Tajuplného 3 spinelidu 1 úzkohlavou 1 trabekul 1 Tschapperl 1 Tlachapoudovy 1 VERZVS 36 spoluzakladatelkou 4 Šrínagarem 665 subjektu 1 sternálního 1 stáncíh 5 Tanijama 1 Tarciryanovi 9 Umejí 5 sterven 2 Tihelkou 13 Tetínem 1 UWTV 2 troodoni 1 SumvaldBoziMuka 1 Trimph 2 Spicks 4 varios 810 urcitá 1 Torpédem 3 stockholmskou 1 trnuchovití 1 tendó 2 tetinka 2 upgradovali 14 Velišský 2 Swiezynski 24 Tarski 2 Tezukových 1 Topolcanoch 1 Torwache 49 uprchly 5 trojpuk 1 tredjedel 1 traversa 2 Tuchkin 10 Umsiedlung 3 symfonik 2 Vepský 5 Sundstromová 1 Tažovicemi 4 Stebník 2 Tahdotko 1 Umdlené 2 Útesu 898 uživatelé 2 Ves 1 Temperovaných 1 Strelenku 1 tiebrejk 1 Tylochromis 1 speku 5 vedomostí 1 Srbskodalmatskij 2 Tikovicemi 3 Švarcenberského 12 Substitute 15 ucelenost 1 tykadlovém 2 svlecením 3 tartarus 1 vesnickýmy 1 sredi 8 Túrán 1 Szilárdovu 2 VENOVAL 1 Tegetthoffovo 2 spárovaným 1 Velikánovic 149 Štíty 3 trínásobne 1 tartiniovského 2 Tudeh 1 Thierstudien 3 trp 3 Trebevic 13 Stopku 20 SVZ 1 Szopkóc 2 spinea 5 verzauberte 1 SPOJU 1 Uban 5 Unscripted 33 Streleckém 4 tuniskému 1 vetrna 2 Tríhranného 1 uzemení 2 SPINNING 2 Staviva 1 Umri 1 Starodejvickou 1 Tusha 1 Sylvacoleodes 6 Trogonoptera 1 UNIPRESS 85 trojnásobným 1 velkolovem 59 Veríme 1 Spitsynská 1 taivaan 32 tristis 1 Tálinskej 1 Tríznicko 5 Strážovskou 10 Spraš 3 steatózu 2 velkoprevorskypalac 2 varium 1 torery 33 státníky 4 Usenai 11 Tutta 33 truncatus 2 Studenské 2 spolureditele 18 TRIZ 1 srna 45 stojanu 1 transparentneji 4 Tozmemi 1 Stredofrancká 8 tónovací 1 subincarnatus 1 tevizní 4 Splávek 3 tetin 3 utg 2 strojvedouciho 4 úctovali 1 Strouhalu 1 Tiezziová 3 utlumováním 1 Splitskou 20 Stránkování 3 Umikaze 1 Tlakovodním 7 tajuplném 1 Supiu 1 SVACINÁR 1 spornohvezd 1 Svetloslav 9 SVKL 549 stonku 4 Transgrese 36 usvedcení 73 Vaterland 87 stocí 3 Triuris 1 Tomeckové 1 Stacionárním 1 starolatinskému 1 vereného 1 swingu 10 unimaculata 116 Srdecní 1 Tylihul 20 Soundtracks 1 Terebla 1 Tampouris 1 Stockmannovy 2 tarpon 1 Trnobrand 16 Styr 3 Urotrichus 10 valníkové 1 Tarczynski 1 valoroso 1 Twinion 5 Vescovato 2 uskutecnovanými 3 Spencirina 3 Vestrini 1 šumpále 1 trettan 1 Steuker 235 Ucení 1 Sútru 21 Tuvinská 1 Tyrrhénienne 6 Unnatural 1 svesticku 2 Stoffers 113 strategickým 53 Sumatru 1 Trilochan 1 Usmánábáda 464 uvedomil 1 Szuwalowa 1 strub 4 valencijskou 1 Tolypelletum 18 Ung 7 truhlících 1 tríakrový 4 Tygrík 426 sympatie 6 subverze 3 ušlapaná 2 subsectio 1 TOSem 4 Švagrov 1 Tamecka 1 Sparkmana 1 ucinnost 15 ústeckým 1 Triolefin 10 spotrebovávání 26 Tilschová 4 Swaret 136 trenéry 1 Staler 2 Srážející 43 Tuvinské 1 Vatou 7 Terpylycha 5 Trefa 2 Tamiris 1 Stefaniszeková 4 Syžet 1 Truelovea 1 TOLED 3 soustredujeme 5 Vetchým 2 valerát 1 Váženými 1 štvrtky 1 vaten 2 Usmiechu 3 utesnovaly 2 Vanecký 1 Správcum 15 Thunar 9 Tillym 2 Taddem 1 tulenárské 1 velký… 1 uplevel 2 valdštejnskými 18 Tkán 3 Stansel 2 Tippmanna 1 tratovou 1 Uraninite 1 ukrajinoznavstva 1 Svatomichalský 2 stellae 1 trétájuga 3 staroknínského 1 Tsebona 22 urychlenému 1 verijärv 2 udržovacími 9 vedeckotechnická 1 Velikoreckogo 1 uvzducholodí 2 trebovskému 5 spárovaná 1 Superfighters 2 Ungerboeckuv 20 Synesios 3 Svépomocí 7 úpel 1 Veltrubském 18 supraventrikulární 1 tristemonii 1 trabeculosum 3 Taschenrechner 2 Valaoritis 27 Spirits 1 trítunového 7 spongiosum 2 sphaeroides 1 Superláznicky 2 Tatrosky 1 Turcinovic 2 Tepuy 3 spárovací 1 transparentnejšímu 1 Unterdubowan 1 tellanové 1 typiku 1 Trachypachus 3 Treux 1 usvedcenou 7 sreview 2 štýrskohradecké 74 Töpfer 8 ukrácení 2 Stuard 238 vegetativní 1 umyt 1 Talky 1 strucnejšími 1 Vadakstes 2 Surupis 2 Varanim 46 superpocítac 1 trinityhouse 1 Thessau 1 Tearaght 1 Starrovými 3 vcházející 2 Toruk 1 Tovomitopsis 1 Stecklein 1 Vaterlandsverteidigung 4 Vallenilla 1 Triskolupy 5 Stegosauri 1 Symbiomyrma 2 Vánemu 26 Thórovo 2 toine 26 Steffenová 1 Tivosan 371 uherští 1 Timisoreana 4 Tokwonského 1 Thunlinem 1 stavebnou 2 Trístavová 4 Tabachnik 1 Sunblock 1 Spinem 107 stretnutím 1 Trezia 16 strohém 11 Taormina 65 studu 1 Understands 383 Süan 1 ucházající 2 Vasudévovi 1 Staroruský 1 strevovými 4 Syberii 8 Thermenregion 12 Štingl 1 venovaneho 17 Studley 1 Sudnik 1 Tayugu 21 Suleymana 1 tylerposeyinterview 1 staalmeesters 1 superstitionum 1 TopRetroTrans 1 upozorníl 21 veröffentlicht 18 Totálne 53 tkací 3 tegulae 1 ucetním 4 Vatnsfell 2 Taxisum 1 Squardon 2 Tärnaby 3 Tsalxhaan 2 Strossmayeruv 1 trzymaj 4 tvare 3 trylku 6 uchováním 1 Vardarjan 64 stadiích 3 Uam 8 Troch 82 usmrcen 1 Vecerce 1 terpinu 1 Topovlje 1 tázu 1 Surfová 12 torpédu 1 Sunae 2 spasatel 1 spoluzavazadly 1 svatohubertského 1 Spoluvytvárejí 1 Supercruise 2 szíved 1 Troyans 1 Strategickými 2 tlamovcové 1 Vejskal 1 TRISOL 3 spini 2 Torkildsen 1 Tonduzia 87 SPS 2 Svarstadt 1 Tetrasiphon 18 umucené 2 vchlípeniny 1 unhooked 2 vagyunk 1 uä 1 vejírník 4 terena 1 udelování Nobelovy 1 Sulilat 4 újezdum 1 s prumerem 1 stehujeme 4 Spiziapteryx 12 Velkoryse 1 Tyršovými 1 stromatolitem 1 Urkaryotes 1 spravovatelnost 1 šrámanéra 12 tríkilometrový 1 Tukinuv 2 Sulchan 79 Toseland 2 Tajemní 2 Špalíckem 1 trojlistovým 26 valdenských 4 Sumartin 962 Sovetské 1 Svatopeterského 1 sovobodných 1 twintig 20 uplatnovaných 322 thrillery 1 Transexuálním 4 Vergilii 16 Vanitas 1 ústupkovitý 2 triazinu 2 Transevropskou 7 teatrologie 1 Sympatizuji 76 tympanon 2 ustarané 3 Unterrichtes 1 Trífázové 7 Synott 1 trubkaU 2 Termonfeckin 1 Tigrane 3 Susenka 1 teresiánskou 1 Steinrötter 1 Tyburnská 7 Szysky 1 Surugamaro 7 Stacja 2 Tanucciho 3 ubohém 1 verstehst 2 strojárna 2 spolunominován 2 Sovinak 56 Tico 1 turbodmychadlovou 3 Toulovcových 10 Šúdži 17 Spessartu 3 TEXTY 3 Spinolovi 4 trigy 65 Tuka 5 upoutával 2 surprises 1 Verudele 1 terciárními 5 ušetríme 8 Tverca 1 speme 3 Tenuto 50 vešli 8 transmembránovým 13 Švýcarum 2 Ti?n 1 ugrische 1 Sovetské 1 Torvay 1 strážovská 1 tundi 1 Vesnicích 4 varicí 644 územních 1 tuky… 2 tomut 1 Thepsis 1 Úchvaty 3 syni 3 Súcanka 15 stigmat 1 Svahilský 4 submandibularis 15 tenorová 1 venustraphobia 1 Valenie 19 tísní 1 ulpívajícími 2 Stockhausenu 5 tramadol 1 Sugawa 54 trýzel 1 Ugena 1 Utzer 114 Stachys 1 Vajlišákem 142 Vandalu 1 subacidus 2 sparingpartnerem 6 usvedcené 1 Strebichovice 5 Štormem 2 Teferimu 1 Turbajská 2 Trnavských 1 Tschurljajew 12 urbárích 3 Subhadrángí 54 uvádeným 3 Telibi 1 svetlejšíma 3 štesti 1 Stensena 1 Turupitem 9 Szamósi 1 událostním 3 spianato 1 Stagnoglej 1 transsilvatic 12 unionistických 1 Stavarcík 1 ukously 2 teologickomírového 6 uctivost 4 trpení 1 štetickatý 4 uvolnovanými 1 Taaffeem 1 Tutconština 1 subcohors 3 Tessaigou 3 Veltruském 1 ÚPRUM 1 vejchksa 1 Svenu 1 Stubenbacher 15 Toldo 1 Teonoe 1 tvrdík 2 užívat… 2 Stockhammer 1 superagentka 9 tubista 1 stolarským 1 Velnupis 1 Veštíme 1 Tebaldiovou 5 Uddjaure 10 Stratigraficky 1 spicky 14 Sulaco 4 suroví 35 Tabebuia 1 stojanum 1 UTTG 1 verschollenes 2 Úsvity 10 Tutte 1 Takyr 2 Vaníckovi 2 Vanhové 2 SUBJEKTU 14 Verhältnisse 2 Unkovská 2 taktovaných 45 tov 24 uhlotisk 2 Vaumeilh 3 studénský 1 Stanleyové 1 symská 10 Stura 2 Vecnyj 11 spolukrál 1 Trombadinhas 1 Užaslým 1 Tortora 2 Vandermotte 5 Tavírna 4 Urumea 3 Vestvĺgřya 69 Švácha 4 svatek 1 Ubuiquitin 1 subpupa 8 Verneových 1 technokomplexu 1 uhlokresbami 1 tykadlovité 1 Thórove 39 Spodek 1 tradovanými 1 t?upa 1 Unar 1 Varbergs 1 Štindlová 1 vanderystii 4 Ušba 310 Umeleckoprumyslové 1 terroristy 2 VAVRINOVÁ 1 Tughtegin 1 undervisning 1 varkoci 1 tuberkulozou 1 TRAUTENBERGER 1 telefonistkou 10 velomobily 6 sustainable 2 verticillati 1 Targin 1 Teguldetském 1 stírátky 1 Tetthaw 1 Trittst 1 stuermer 1 Umenovedný 1 tisícistránkového 3 Tímúrovi 1 Troickou 8 surfuje 9 sukulentními 251 stoupat 1 utilitatibus 4 Úplnost 3 staurolitu 2 Transplant 3 UniVersa 6 úpí 1 Strecnianska 7 trapezoideum 1 Verikovského 1 svatojabuska 1 Stratopauza 1 tisíciliberní 1 Trunko 1 Stradonická 1 upnuli 1 sympósion 1 Staatsbesuch 1 stankovce 4 Unesení 2 tky 1 vánocce 1 Švankamjeruv 158 vácku 5 sprayováním 1 vetratelnosti 2 unigenitum 1 Venský 1 Tatri 1 uralter 26 Tereziánského 1 Tavdyu 5 Vetrnice 6 Tuguegarao 1 Umbanda 1 Tideway 1 Sourtcheva 1 StanFlex 6 s nimiž 1 UTEKAJTE 1 vanového 6 Trochilidae 1 turbokompoundním 3 Tahome 1 tosanovice 1 spolupredsedající 1 Suomenlinnu 16 SPARTA 14 Tulechova 1 Torreyochloa 2 Tschoschl 5 ultracisté 6 stojitou 1 superprotekci 40 Sušilova 9 urcitelný 1 TREC 1 uchystat 3 velkolomem 3 vanicková 3 Spinnetová 1 Sternbergenová 1 trueness 4 stallum 1 Touchtona 1 Verekne 6 trasjanka 2 Šumlatová 17 tesnými 1 Varonian 2 Sprachenkonvikts 2 tyrhenských 1 Szelincs 3 Vesecko 6 Tienen 136 úsmevem 14 Tallon 1 Štramák 1 Varsin 111 Valdés 3 unavenosti 1 Tamberías 1 Stally 1 truhménském 1 Velhelma 1 Teredinae 1 Versend 45 symposia 82 úcincích 1 …Ve 2 Valnigra 1 ulvospinelu 1 supresivne 1 Ulekleiv 1 suvalkských 4 usnášeníschopnosti 1 STROJOBAL 1 StarFabric 4 svévolná 1 untersten 1 Varsofjevském 3 Trhání 5 šuejem 4 teckovaným 2 tribádok 6 VDO 2 Tesálii 1 Uhrek 1 Trinecke 1 stolicnobelehradská 13 Švagrovský 9 Valloire 36 stredopleistocenních 1 Valdone 1 thraskii 10 Translate 1 suvérenne 1 Tuodâr 3 Szpuk 1 Tuttovi 1 VelikýAlexander 18 tabes 1 Suikun 1 Tiedry 3 Ungvari 1 Soysert 10 Swerts 6 Traduction 1 uhájiti 1 Tamkafalva 1 Úhercíková 2 utrena 266 stanov 1 Utecenec 1 Ussherových 2 Vápníkový 1 Trakostyán 12 truchlícího 1 Strynkiewicz 4 TEK 5 ukrutnostem 1 Srody 1 stašne 6 spácu 1 StChads 1 Trojáni 1 Sucka 130 terárium 251 Vetrný 1 Tonletom 1 Unkrichem 7 Stopování 1 ujíždela 1 Vandewyngaerden 5 tlustice 1 stínohru 15 Stuhr 2 Verbicide 7 Trioletová 3 unobtainium 1 sursassit 1 Swatton 1 svetocarou 1 töröksíp 1 Statui 3 Tianzhenosaurus 1 Staerna 3 Tancíme 2 Stankovou 1 Úctárna 1 Unckhrechtsbergu 1 ulozeny 15 Tannoudji 2 Teuffenbach 1 sueńan 4 Studentu 7 Úhorí 3 trojcípým 134 Svätý 1 stredomoravština 3 Thadée 7 trojdílnými 1 Ugurli 2 spráhlum 11 tian 4 Štvornohé 1 Trelevsky 1 Tsiolkas 2 splitters 1 Torturism 1 Urpferdchen 1 traslíru 97 Vegetacní 1 tabaterce 2 táccích 1 VERSUs 2 Šumbere 3 Turhal 10 vešteckých 1 uvedomnní 1 Thenardem 1 Umbreit 1 travestierte 1 speleotémy 1 thenottinghillcarnival 1 Tatooinský 5 Vedy 2 uĺ 7 stylizování 1 Toilettensitzmodul 1 ustrelenou 22 Tyrolích 1 Talašovou 1 svidnická 1 Systemická 1 tiskovách 1 Tittové 41 Transakcní 83 subjektivity 7 Tigranjana 3 Superkocka 2 unpluggedu 1 Stanhill 1 Spardorf 1 Tomhave 1 stotožnován 2 stereocenter 2 troge 8 Srostloprstí 1 stavebnicím 3 Sweta 7 Syre 5 STEC 1 Sparrieshoopu 27 Venezuelský 12 VALENTA 2 Strahovický 4 Szekrenyessy 11 spoluvytvárejí 1 spolupripravovány 1 Tendulkara 2 Tastemakers 38 ukotven 1 Surátu 1 Tesaríkovou 6 Tvorkovských 1 Trojákem 1 Tiesnavám 7 Szentlorinc 13 Torx 20 Stanfordovu 1 Urjadovyj 1 urbiniana 1 svazarmovských 1 vedecky 2 Südwind 1 ŠVBM 38 temperamentem 1 Thalycra 1 Svetlomilné 1 Teat 1 Stimulováním 1 Stradomi 10 Strecna 3 varus 45 Tocivý 3 Vänner 1 tesnych 1 SVORNE 1 Vavele 2 Unwanus 1 Uljanivka 2 tulasí 2 Springboks 1 svíticím 2 Uverili 19 Transavia 24 tahr 2 Tőnismäe 1 Švícko 2 VAO 3 Sweep 2 uznatelnými 1 Štouracem 1 úhelníkového 2 Teor 1 Spaky 17 travestie 1 Tourniere 5 Tešitelová 1 uvedomal 1 tavse 4 Streik 10 Tongues 9 uzamykatelnou 2 Stráneckému 7 Sunni 1 tridimenzionálne 1 szwaby 24 striptérka 1 Vassaly 1 Ussimäe 3 stredofrekvencní 4 s Juventusem 9 Triem 4 Šupol 1 teletníkem 2 spolocenská 258 Venezuele 25 Trpaslíka 1 Spolektiv 1 Varnenské 5 s hydroxylem 4 strhovacím 1 tikšoret 1 Tchajvanské 8 unifikovaná 1 špekování 1 transplANTed 1 udební 107 Štaufský 25 tramp 1 Urušadzeho 17 Staríce 1 s poutavým 1 Swatmaramou 2 STRACH 39 transmisní 5 Varziho 1 Spamboolimbo 3 Stabsführer 1 Tušaj 110 štáv 1 VERTIMEC 1 termálne 1 Vašcuková 1 Szygin 62 Syrané 1 trvej 2 svalo 1 Trňisichean 2 Tupejž 5 varecku 10 Tardieu 11 Vepic 3 stažností 1 vesnicke 1 Trutnovskou 63 umeních 1 Strížez 2 Úhyny 3 Trenkwalder 1 spojovatel 1 studujicích 1 sprévské 1 Vebendorfer 6 tesnopisec 2 ukojeny 2 substâncias 3 Twau 1 ubourat 5 trojnásobkem 1 trifenylmethylového 1 sozialethik 1 Telemského 3 svetem 1 Štursovo 1 S výsledkem 69 Soupravy 6 Tush 2 Vedat 3 Sphingonotus 5 spirálovém 5 TAD 1 terofyty 1 tchétchčnes 1 Vaclavkova 1 tisícirocí 13 valdenští 1 UDHL 5 utešitelka 1 Toopuaiti 1 Tendagurodon 2 továrenský 12 Transmisní 9 Stöđ 1 Squeege 1 Szivos 1 Tatawo 1 sourozenkyní 1 Starachowic 1 triatletu 1 Svatohorksé 7 šprýmu 1 tvrzický 3 sublimující 1 sputnikmusic 1 Swata 2 Tarpeius 1 stereotaktocké 1 toppingem 1 Stegmühle 60 Ukrižovaného 11 Summis 2 triatlonové 2 trasokrcka 3 tamašeq 3 Trecastagni 47 spokojené 1 Styggebreen 1 Vazuzskou 1 Userbars 1 Újtölgyes 1 venkovanech 1 Trevisini 35 trnovníku 1 versipora 9 úcelovost 1 Ukri 1 ÚSTAVNÍ 13 Tycové 12 Stoda 1 Ukládalo 33 Supravodice 3 userdb 41 Ústredními 30 Útechovic 1 TOMŠOVIC 2 spisuje 172 šterky 5 Spotts 1 sporto 17 stárek 4 Terziyski 1 Vejcka 1 stretnuly 2 venalium 1 Štýbra 1 TIVc 1 Uhlírskou 1 Verg 1 uinal 1 Truttmann 1 Vakem 2 StaticGray 1 sumýšovcum 1 Uvadecem 9 Spiegler 2 Südsee 1 syllogistica 2 strmilovský 22 Vestine 2 Torpedem 4 ulehcili 1231 tanku 1 Uhynuly 7 Tarabini 15 spasí 1 uklidilo 8 telenovel 1 Stakavievu 6 Unicovem 13 VCL 3 s vlastní 2 štukatur 1 srká 1 thioglykosidu 28 veštcu 1 Tammsdorf 8 Sungaca 1 Vestfelli 14 ssi 1 Vangonium 1 Tällä 8 upsilon 3 Vange 1 taxéon 3 Urat 7 velezrade 17 stabilizovalo 3 TitanMen 5 Velan 1 sybarita 1 Staabiveebel 2 Údelu 3 Stillsona 1 Tischlerem 12 Spotrebitelské 2 Trínohý 1 Udál 5 surfarka 29 Spreewald 2 Triatlonu 1 švališér 38 Tmenov 2 vedomostním 602 Veronica 2 Styggedalstinden 1 spadnút 44 Státnímu 1 stvara 393 uložený 1 Stopovat 1 šukravána 3 specializacním 4 Twitterový 1 Strenku 3 Toolea 24 ulehcil 5 Verwendung 1 TRINCKER 1 splavovaném 1 Tunikov 1 Superzellengewitter 2 Valuk 4 Trapo 2 tetroly 3 Varesina 8 Stuchlíková 10 Taška 1 Trestunho 1 Stadtguardia 55 tríhlavnové 2 Torunského 1 Swarley 2 Thunderhorn 12 useknutím 1 veliky 1 velehornatinách 1 SZOCIÁLDEMOKRATÁK 13 Spoluzakladatelem 1 Švua 1 Tragara 1 Toece 1 Šventas 4 synkretismem 205 sz 1 uzdraveny 1 Verešcaginová 2 veselovsky 5 Valšíkové 1 Vecchimu 1 Štrasburských 5 Tarbagataje 4 Tluchorem 1 s webovou 7 SRTCP 1 Stehelcziewssi 1 valcik 1 Tryce 21 Vetu 2 Trucoun 1 Talpra 1 urémií 292 Stárí 1 überraschen 1 Spreadheet 2 Tysmenycje 39 veleobr 144 trešen 3 stoparce 44 Stupid 1 Unterbözberg 1 Tognoletto 1 starosvetskosti 12 Sousedka 1 Tabuizována 10 Talleyranda 1 velknezem 7 udržovateli 26 stalinismus 2 Tankgewehr 1 Tessye 43 Tetrovití 1 Sweave 2 Tachoires 32 STZ 12 Swenson 1 Staatsbildung 3 veroorzaakt 2 svéhlavou 12 vandalismem 4 Titovoj 56 trojzubec 5 Tonne 3 spaceencyclopedia 1 Vasadávattou 112 Tolkiena 7 Timmins 7 ?arii 1 souruc 9 Stegosauria 11 Spillman 1 Treskina 1 topka 2 tricku 2 TransEuropa 2 Struneckou 1 VáclavCílek 1 tváritelná 358 Trnavský 2 spiscích 85 uklidnuje 1 Stávková 5 trapezium 1 tkne 1 užaslým 68 vecný 2 vesnicanku 1 urundense 2 Surmelin 158 Toskánsko 1 u Mezírku 2 Spanlangová 2 stereometrických 2 Torodd 2 Sudamerika 5 tikové 1 Tromsfjellet 3 Squarrosa 21 tantal 2 Stražím 1 tahacího 1 tutejar 1 tancujem 9 tolerovaná 42 tíži 15 tonzura 2 šterbinám 1 Uršanabiho 1 tangoimperial 13 Spoluvláda 2 Velichovský 3 suttách 4 Valvasor 1 strecxataj 2 torne 2 titovských 4 Turzovsko 1 Titanomyrma 3 Thälmannovi 3 trojramenným 9 vedry 1 Srí 1 vascello 1 Transovariální 2 Tadega 21 Suverénního 4 Trangoška 3 tulliana 1 venicewiki 56 strojník 1 Stoilovem 1 Tisztviselotelep 1 Stockenroth 1 Šter 1 tarme 1 Sphinctanthus 4 Svederník 1 speci 5 Toes 5 Takadži 1 Urquidi 4 Trocadéra 14 synantropních 28 THX 9 Tarnovo 2 tagoriane 1 Veselinovicová 1 validizovat 2 Swarzewo 1 Vašákovou 1 Stenku 1 truhménskému 6 Theudeberta 5 utiskovaným 1 spravodlivú 1 trisubstituované 2 tardivní 1 Ulvrové 2 Vällamägi 9 STREDNÍ 17 svatovítskou 1 Telmarín 1 sponzorujícího 2 Toivonenovi 1 vael 2 Trades 16 trojúhelníkovitým 1 üsküdarské 6 starousedlých 1 Ušatce 11 superciliaris 6 trén 12 Toušic 2 tote 1 Thengenu 7 subverzí 63 Trop 1 Udžijasuovi 1 spechat… 3 Syringe 1 Thobeki 5 sveráku 1 venni 10 Thicknesse 4 Ternitzu 1 Stavoslav 2 vesikulární 1 supervozu 6 tyn 25 štedrou 9 Tyrese 1 tenuilineatum 1 Štefanciak 2 Sušský 22 strelkyn 22 Vedli 8 Streleckým 80 ustálená 1 teroidy 8 Vastitas 35 uletet 1 Trentonových 75 Ucitelství 2 truman 1 stredotlakém 2 ukrojený 1 Umbellatus 3 TSW 11 veprovému 1 Swamped 1 tranovický 1 Tarkó 26 typografem 7 Tashu 1 Unabhängig 1 Takajo 38 Uytdehaage 2 TePb 6 velicinové 8 Spolecníky 1 Stĺn 6 Souvztažnosti 1 uhranutá 1 Srijemski 20 Symphonia 43 uzdravila 1 Tanakaovou 2 Strzechowski 1 Udarnenský 10 udržovatelné 443 spodním 21 speleologické 2 uzávorkuje 1 tikvatenu 4 stomatitidu 1 Verune 3 Ugis 1 Tvoreno 1 Torzymska 4 tetrarch 2 Vallentine 116 utíkají 10 tween 4 s izolovanými 29 validaci 1 Švihovema 2 Torguté 5 supercelární 2 Trancosa 4 vápenomilnou 1 Stiber 3 tbnid 6 Trevirensis 2 strojkum 1 Stamme 1 Tabenny 1 tesavelu 73 splynul 1 Tokcon 4 tropu 1 Swarn 1 Vesubie 1 Vertugadin 4 Temburong 2 Totožnou 2 Velkomoffem 1 tožické 3 Spillville 6 Vakulenková 52 Vacenovice 1 Telta 1 Šventyte 11 Terapeutická 31 thajsky 4 tabulature 1 Straparollinidae 1 s rybníky 32 tavidlo 1 Toeplitzówka 3 soustu 513 Tobias 1 Straatbeeld 16 Strother 1 sporoforech 1 Vejmluvovi 9 Vacheron 4 Travunsko 33 Strahova 1 truchlíte 1 TRAUMSPIEL 5 Sumgaitský 2 Uzina 56 UAV 1 TurboDaily 1 Tloque 140 svazeccích 2 Trechisporales 1 Stockwellu 8 Touškovský 4 uzdravily 6 Strep 4 Tríšilinková 1 ultracentrifuga 1 Thráke 1 stadionovou 2 Stefanel 1 století Aldousem 1 vacsora 11 Ugandané 7 trombu 35 Telos 2 spamovat 1 Tonkust 2 Taulis 1 Thespianu 5 Vandewalle 2 Thannhausenu 1 Varekova 1 Tersata 1 Staškova 1 transversály 3 Tasmanovým 115 túry 1 Udržuji 1 stretnút 1 Valleyová 13 tectorum 5 Unterseeboot 46 Stellaria 9 Trochidae 2 Srnci 1 stvající 1 transliterovaný 11 stredozobých 3 Verăo 3 tlingit 1 Venustinius 1 Stassino 32 Todos 22 uvázla 1 strelickou 1 tezaurum 1 stavidlového 19 Tveru 1 Storbreen 2 Taharkova 72 Thingol 1 Sperlonga 9 Transoda 5 Thorold 1 troodontidu 2 Vasles 1 trinkst 2 turovice 19 Thomayera 2 Tukaja 1 Synurus 1 Stallburga 2 spins 1 údolníckem 17 ústupkový 1 Spriggem 2 staroegyptští 3 Tatenen 2 Tribar 147 Svedberg 3 tríbarevným 1 Venerdi 10 Thýn 2 uplývání 1 Sulajmánských 3 uhrazovací 1 uvodil 1 Streptophyt 1 urel 1 Témiscouatská 37 srovnávacím 1 Übereil 1 tythemi 3 Tuj 1 Sporca 2 tsao 1 Städelova 20 Užské 23 TMP 6 stupnujícího 1 Táhiruv 4 velitelova 1 tylnojezykowych 1 Tužúra 3 tynk 7 Trinkulo 18 Stredobodem 22 Tichelt 3 Versuchs 2 Suffolka 1 tricetisícové 1 Tchang? 1 utce 2 tumorum 3 tírthankaru 2 Tatal 1 VAIGENDOVÁ 1 terstskou 3 Strashun 1 Todtova 2 Spielbergovy 1 Toncourt 6 tavilo 1 svlaccovití 12 subdukcí 1 thermidorským 4 umajjovská 1 spartana 4 superarbitrován 3 spotrebovávala 1 sunovým 1 Tetradymus 1 Sternkatalog 2 tongánských 1 Véroce 4 Vernam 3 Standerem 9 vadžrajáne 3 stipendiím 1 Steenfollská 1 Turtmanngletscher 1 Stierlein 5 subdomén 2 Szigat 1 spaluj 1 Téléstar 1 Tägtgrenem 310 Über 1 Tähkäpää 4 Ubehl 1 Trikovém 7 vaj 1 Terminologického 1 trítisící 1 Trachytes 61 usmernovace 1 Tuniskou 6 Statistische 1 Varovského 7 Vazy 2 ultralevicoví 3 Variské 11 Synácek 4 Vĺgberg 1 Stratocloud 1 sršících 1 STUDER 2 Überlebende 3 ubrán 2 Urbanizovaná 1 Vebensenu 163 user 2 Titmarshe 1 taxikárích 2 úqui 1 úzkokolejovým 1 Tagiru 1 Telissare 3 Stilgoe 3 Sverdlovem 2 SVID 3 stykovému 1 Taggartem 1 trojtraktového 33 Vážil 1 Swanbourne 1 stádovým 1 tvrzorlice 3 Štybara 21 trýznení 6 Stonyhurst 3 uzdecku 35 Susy 1 Sportfilm 1 Vágszakály 1 Styku 1 Stöckalp 4 Šukriho 1 suchožlebští 1 TERRIER 1 tažných 1 Stachniukem 7 spojových 1 Tannberka 1 veníkem 1 stredicímu 5 uríznutou 20 Šuranová 11 Toužimského 2 Tavaglione 1 tombacea 1 Vác 12 Tarnawa 1 Spálenku 1322 Unie 2 Synurophyceae 1 Tlašadze 1 SPONDEO 1 Überzeugende 1 strednevlnným 2 Varhulík 2 Urath 1 Universiádu 6 Vertijet 1 tržiši 1 Tischendorfa 1 Spolecenstvích 81 Tibetanu 1 Tubici 1 UTYIS 2 Svalbarđsstrandarhreppur 1 težkomyslnost 1 ŠvedovováKvitová 3 Tmenovovi 306 Strážce 1 turskyi 318 syndromu 1 Squarcia 2 TVNZ 10 únosná 1 Trhají 1 surrealistku 56 tuních 1 Svatolucijští 1 Varenských 10 trasován 333 vald 1 Uhligová 3 tókjú 1 umacká 1 Tougouri 1 Trachylinae 1 Vaesa 1 svatohostýnského 1 Trencavelum 1 Trumfu 12 Unidos 8 stresovým 1 uctívej 5 Tiwaz 1 tektéž 1 Spolupusobit 39 Spagna 1 Vatopedském 3 Struttem 1 Stínovi 7 Trmacova 1 trojsvatá 1 úvalovým 7 spájení 2 úporností 1 Supervizori 10 Turzii 2 titigon 1 Tetanolysin 3 taifská 13 Theologiae 22 Stantien 1 …Tím 7 trades 1 Stakcínem 1 Svarínu 124 starobylých 3 Sovnarchozu 2 Tacianu 1 SWEATING 2 Tyrannides 4 spolužákyne 1 trojslabicné 5 strižny 1 Verchnodniprovský 1 Stocktonovým 1 Vendômským 40 šterkopísku 3 umjetnosti 1 Taujském 53 stodol 1 ukápne 1 taglarsson 2 Tourrettia 5 Spewak 1 Tryceckyj 20 subtypu 1 trombocytóza 1 Ukmar 1 Tandareis 1 trnohrbetovití 2 tabletka 124 teropodního 17 stafordšírský 21 utrakvismus 67 ulickách 1 TByte 6 Thuzad 1 Umbrielu 36 stockholmské 3 Toxoplazmóza 1 tehelna 5 Temotu 1 Trinci 27 Valci 2 Tey 1 Tutenchamun 8 thr 1 therapic 1 treasuresf 2 uhedu 1 stoljecu 1 vágyam 2 Synesiovo 1 Tümpl 1 ulpívala 1 srozumitelnejšími 1 subboreálních 2 TwentyFourBit 5 Suitner 24 Švarec 9 Tulu 3 Uniplant 2 Taë 58 vacnatci 2 Vergila 3 Varianten 3 Telecasteru 9 Ultralight 1 tiberiových 1 transpacifických 1 Svätobor 8 Vavrda 1 ÚCE 2 Thuellin 2 Sovrano 5 strediskový 1 Strebler 2 Twisteden 2 Správe 1 superfixacích 2 Torquat 2 souperky 3 Špicáckým 2 verbírum 6 UMELECKÉ 2 tunovi 2 Telcicích 3 Trávníckem 1 suaviter 2 tripzone 1 staroslovinskému 280 uciní 113 Spolupracovala 1 TopStar 1 Tauberova 11 uchovaná 412 srbská 1 Svatoslavského 21 težení 1 thumbByl 17 Triggs 3 Stajner 1 üürd 18 udatne 11 svobodníku 1 spectroscopist 2 upsaný 1 Tutanchamonovou 1 Townships 7 studenokrevní 2 Svjatoje 3 umbratus 1 Tanuter 36 temperou 6 Veleslavínove 38 Torquemada 1 Struzyna 1 Sušárenské 2 tríadresním 11 Tetsu 1 Tudraj 312 toleranci 1 Vdechnou 1 spaced 3 tucnejším 5 Tomšícek 1 Torremocha 8 uliginosus 110 specialistou 1 Spezialeffekte 1 Valcyte 3 Synonymne 173 velryba 1 Toyobo 7 synekdocha 1 Ungursch 2 Tjřme 1 trojhlásky 2 trojkových 10 s detmi 9 Valpellice 1 Tuttera 1817 svrchní 1 Trízápasová 9 Tunega 1 tiencouskými 3 traditionale 7 Spoluprací 1 supinová 3 Stupnovou 1 uchylování 1 Tonerre 11 starostce 1 svalovými stahy 1 TrollSatu 3 Thrushcross 1 veršuv 57 stat 1 Transmoravský 4 spolusvetitelem 3 Temi 4 transcendentalisté 1 uvadlo 1 thyrodních 8 Srpice 1 tzolkin 1 Útesový 3 variente 150 Spokane 1 svobodomyslnejší 2 Urzut 1 Spankova 657 užíván 1 Trebechove 9 Teticky 2 vaznici 2 soustredenu 1 tibetu 18 Starobylý 1 Trautmannsdorffský 1 Southminster 1 twingem 1 vakuování 1 teo 1 verejnými 1 Sztankóczy 27 Tagetes 1 Stanchfielová 3 Táboritskou 10 ultrafiltrace 4 unlink 1 Suuregi 1 Strisowitz 1 Urruci 1 SrTrPb 1 surmani 3 usedlících 1 Trnobranského 1 velvaru 1 Thoemmes 1 Varhanám 1 stopery 1 Tittelbachem 3 úradníka 2 theoriím 1 Turboblaze 1496 techniku 1 submitivita 1 Szepesvármegye 1 trizómie 1 s vyspelejší 3 Syagria 11 úlových 48 Týnském 1 velebny 2 Tranše 10 subkutánní 1 Vejražkové 20 tiebreaky 1 Trikotine 1 Strzetez 1 Swybbertszoona 2 truchlíc 5 Suplement 3 Straatena 1 stärkeren 2 Varazdata 1 Staubunki 2 unheimliche 1 Universem 2 Tolmino 3 Velícím 2 svära 1 Uvey 1 SRTE 2 Torunská 2 Sovara 1 Toihaus 1 STRTrk 1 šunavského 2 Strapem 1 Unexpurgated 1 Vermarktungskonzepte 1 torpedometu 1 stavropolském 8 Teresia 16 Úredního 7 tefra 2 trager 1 superstrats 13 Thrills 1 Válcujeme 7 Topolcianský 13 Turianik 1 Stonaiciu 8 Srovnával 15 Specifika 9 valonského 1 Stjřrdalselva 3 Teiresiova 1 trbka 2 symmetrica 1 Tepilia 2 stupnovanou 1 Versuchsgärtnerei 3 Unangan 7 tatarštinu 4 Syrien 2 Vartenská 8 tabulkovými 10 Stormwindu 16 Vetších 2 spéculative 2 Taysir 4 verberant 5 SSDP 1 struie 1 Ubajdou 1 tauras 1 Theonesteho 1 vehalsní 1 Ucinen 1 Tranquillini 21 souteživost 1 verejnost pro 125 špenát 2 Trojden 6 urozenejší 1 Václavkov 7 strahovskými 1 Trzebiatowskie 1 Truhy 5 Tomic 2 Vervezelle 1 Tsaregorodtsev 80 Veli 1 Tónk 26 tesák 2 teplákových 4 Tiffanny 18 svárecské 1 turbinosa 1 tramwaje 2 Tujiazú 1 stĺende 1 Urrozová 242 úzkorozchodné 9 Unitarii 1 Štimplová 2 thttpd 2 Stetsenko 1 trerénem 2 Tvrtkem 1 Stahleckeriidae 1 Vastmanlandu 1 Veruschky 1 treshold 25 Urticaceae 2 Tegeler 7 Ukazatelé 4 Tuathy 1 svlékaní 1 Vajnahunyad 1 svazkovité 8 Tadeo 2 Veruška 1 Starodubecská 1 trength 2 splenektomie 2 Sumeckovití 1 Stijgijzers 1 thurzovských 1 Stackování 2 stornován 42 studován 14 vadná 3 Triznov 1 velkopopovickém 1 Teamových 2 Valletti 6 V?n 3 Tielů 1 Stomiiformes 1 Sverenci 22 Venabili 15 tituluje 1 Vchinic 1 speargun 4 Ujistete 1 týne 1 Tendrová 3 SUBSFÉRA 2 Vasiljevicem 1 Spacium 124 Veber 2 Spezialortsrepertorien 6 SPCHJ 2 štož 1 Treviském 1 tarsal 1 számon 2 Swidzinski 1 Upadéšámrty 1 triazacyklohexan 1 Tožanu 1 Trochinella 190 tango 27 Torgajev 1 šprýmování 1 Tomicek 3 Summu 11 trešních 1 Svatošovo 4 tradicionalismem 1 tedmosbyisajerk 2 Tuvora 2 Tahitská 2 Tereska 1 Tattersallem 1 Summerscience 1 Suledza 1 Sweertz 110 Suezský 79 Spravuje 5 Užík 91 trojského 1 staropacký 8 Tumlírová 1 uhlazujeme 1 Tatínkuv 2 toufari 1 veignés 38 specificnost 1 Tecuamburro 4 stredoslovenskými 1 takako 1 Šúmatsu 1 štikulenkovití 1 Terpsicore 8 Vermenton 1 universalmusic 2 Tenocha 2 starovekyegypt 2 taurotragus 1 ukrutnému 1 Torulem 4 Užitné 2 ujímaná 26 svatebcané 1 Swansonovou 11 Tvrdošíjných 1 Trondheimská 2 stupavského 9 Varin 5 Vadila 217 typum 4 Vajsovi 1 telekonvertorem 15 Udina 1 Taschentuchbaum 8 stredohorský 2 Swaté 1 sposato 1 Teizoden 6 Stepanišcev 1 URGO 1 Studní 3 Valentinské 1 štaldy 1 Vachonova 1 tehotenství 5 strouháním 1 telekonferencí 1 Trinecané 1 s kanonickým 5 staníc 720 Versailles 16 Vernoux 19 trie 67 symbolice 5 teplokrevníky 1 trudných 184 VAL 1 Táji 3 tuká 2 tzvn 177 Vertigo 1 Tannaberku 2 vapore 1 šuntem 60 upgrade 1 Vavic 29 Tauris 9 UDMA 1 stupnovanými 1 vehlasne 4 strávíte 118 toskánského 1 Trebícskem 2 társadalmi 9 Superioris 137 svolat 4 Sovereigns 1 s Bohunkou 51 Varena 11 spolubratrem 1 SYRIZY 1 Stýkaly 4 správcovského 1 subsistens 2 Tribolazzione 1 Ustavilo 1 Stevesynnott 2 Stukov 2 Typografickou 27 Sylvestera 41 variegatum 162 stany 3 stážistky 1 Svenssonem 22 Ukrutný 1 syndiagenetického 2 Venangu 1 tankvaku 1 s Akademií 1 Tabotchap 1 Varfolomejevová 1 SPORTSTER 9 Tuttosport 3 veršotepec 1 špeky 1 Vestálská 4 Sporé 7 syrakuský 5 Tiret 1 stehst 1 tmavoocasá 28 Texaská 1 Twoja 1 TRÁVY 2 Svatmaram 1 Stargroves 1 Tilby 165 Tanner 2 splavnovací 1 Velkov 5 vázacího 1 stvrzujícím 1 Vclenování 2 spoluherci 5 Turbodmychadla 9 Stranany 1 Sundarínandu 2 velkokomandér 1 taeniatum 1 Tiszaderzs 2 Taxuvku 1 Tiernahc 25 Tištín 1 Trójgarbu 2 Titovets 3 Vchodem 69 ß 1 sparujeme 1 Toprakove 1 Strassmannovy 2 šupinatek 2 úcastích 2 svetovládnou 1 Úlehlovi 1 tratat 1 spisovatele 2 Spiraler 13 Srovnává 1 Tyddewi 1 stavitelnému 1 tawy 1 Timesithea 5 Tupadelské 8 Swietej 1 Thegdag 1 štítníkovitých 1 tisícov 1 urlaub 9 Townsenda 110 trakcních 2 spavostí 1 trochoforovou 1 TESCOMA 14 Verratti 1 Štancl… 1 Uterqüe 1 statokoniemi 1 Tyszkiewicze 9 Strelítov 1 Vanyukov 1 Struttovým 1 towering 2 trioktaedrická 3 Spaanse 1 univezální 67 Strathclyde 1 Todesgang 30 Thompsonem 3 Trápící 101 Vestonice 3 Tocili 1 Tésenfa 1 trěs 1 Tronovi 1 usmrcovací 1 Traiectensem 1 Thelander 1 venlo 6 varný 1 štvána 2 subid 120 Tessa 1 Spielpläne 3 supersonické 2 UKNC 4 Spinops 1 upejpavá 2 ŠTE 7 tríbení 1 ?y 2 Toresfostre 3 Stoddert 2 Staatzu 1 s prepadem 5 Syprzak 1 TVV 6 Tasmánské 1 svátekKupalo 1 Tjeku 53 varhaníku 6 toxoplazmózy 1 systémem… 24 Valaská 1 SOYUZ 3 Švýcarek 3 vazokonstrikcne 4 van 1 Triedrem 1 Udždžainí 1 Vanuaaku 4 Vedic 1 vazodilatátory 4 Stredojižní 1 stehovákovi 36 Tongy 1 tyfovými 2 šroubovat 2 Tautenburgu 5 Vesterbro 1 taidžin 1 TongLing 1 Vangského 4 urážkách 158 Stupne 4 Steingrim 1 STOLTE 1 Turkmenec 90 vcelaru 2 újezdská 3 šueje 3 Terrno 1 ThesaUrUs 4 Stabber 1 Tallachini 4 TopModel 1 syrakuském 5 Springboard 5 Starships 1 starosyrském 5 Talbotova 1 SUPERLIGY 6 Thermopolisové 1 strakácu 2 Tibatto 1148 Tajemství 1 vestilo 1 Stabsgebäude 1 Steinina 257 step 1 Universytetu 3 Turnbullem 1 Tváricka 8 Tomm 1 timore 2 upleten 12 Specializací 8 Tentacles 2 ugbo 67 VarioLF 8 tríctvrtecním 8 velkodustojníka 7 TEREZA 1 Velikotarnovo 112 Úplná 1 Synergist 1 Vecchina 1 Trojekurovum 2 Tallisových 12 Sugestivní 5 Tassova 4 Srdcovou 2 Târlea 19 Thunersee 2 Stoupnete 1 Vetevníci 2 Strzyzowskie 1 Trithorax 2 Stammham 2 Syne 19 tkanice 3 Tešik 5 Suhail 2 Thoroughfare 1 Stenbekk 1 s obcerstvením 1 Vertinskij 17 ukládáno 1 UNAMSIL 1 ubližujícím 1 stint 111 stlaceného 7 váju 73 Vápenný 34 uším 1 Vepsovská 1 Tongsa 4 Tarnovská 32 srdcovky 1 Tafelschnitz 3 uhlazene 3 Úleva 1 Tőll 3 Veetorni 1 Tunnun 64 tiskárnách 1 spermatikoi 7 Uklidnující 1 Usutu 38 Veporských 4 Tonar 1 teoreik 2 Takers 1 štíhlejcí 12 Szonyi 1 Sverrirov 2 SVITÁK 1 tluchuba 13 tenzi 54 Steinegger 2 toes 10 Termesivy 1 Tankerud 1 Uprosted 13 Suriana 2 Troise 1 Unicovským 1 svináku 2 ujednotil 3 verbista 1 Trimalchionovy 2 subcristatus 2 Strakovo 5 Suder 2 spusob 18 u? 1 Tcheiši 1 stredovekárského 2 TOOL 1 Šúsakova 3 syndikátní 22 Úsmev 1 Umrlci 1 Tasoz 2 Vassel 1 stredopaleolitický 1 Tubax 143 Termodynamika 1 Sylem 1 spálene 4 syntetizery 2 stuhárna 1 Usvedcený 6 testovinové 23 Spirituální 1 Tmolos 40 Valerii 14 teste 1 švihnutá 1 Spieljoch 10 Trídílný 2 Varisco 3 Velivar 1 Vardarskou 3 Tybee 1 verbalizovaným 1 Trhlíková 1 tullet 2 Subirat 1 Špionománie 4 Uzda 2 Thomᚠ2 Sunnmřre 1 Tulkasovu 6 svážel 1 Vemurafenib 4 Vejírová 2 Technikové 1 Vazové 1 Turgeona 5 tuberkulózního 1 Tothil 1 spadeném 1 Tresmontanove 2 Tardiana 228 ucence 17 Štemplovec 1 Standoff 1 uvolní 19 Tónika 1 Triju 2 Trassanel 1 Torczyner 1 substatia 1 Stephaniestrasse 3 Televisioon 1 svedecne 1 Urnenfriedhof 1 Túttukkuti 2 Trumper 1 Šušnjevice 1 Urcunina 7 Úhonicích 140 travin 2 Vermischte 32 Valsecchi 1 Trasporter 1 Staffelegg 1 Thomštat 9 Stannisova 1 trolkou 1 úklidech 2 Stabijské 4 startováním 30 tisící 1 ??stežují 2 Thomasovým 10 Švestková 1 Supercharger 1 Uherskohradištská 1 VEPREK 4 Theologický 11 verozvesty 7 štetinovitými 1 Tulenko 26 tricátou 1 sportovníhu 146 ustavené 3 vábný 5 srpkovitého 2 Spácem 2 Svitáckem 3 vegetativa 1 vekového 102 studeným 1 Thozamile 4 vendredi 1 témaum 1 USTISH 2 Talese 2 Suve 3 staromadarský 3 Syban 3 statuofilie 1 Verheyden 1 Tomašoff 1 spätkeltischer 6 vavrínovitých 2 Stolonifera 1 uverejnujete 2 staropolského 1 tortuoát 3 Vehementer 1 Talitrus 1 Tropár 1 subatomárnímu 15 Trčves 3 topurkách 1 tralfamadorský 1 šprcguma 2 Srešcemo 1 vakokrtovitých 2 Valdix 1 Ultimativ 2 Takayasuova 18 stíhaného 4 uvízlá 6 tyranských 6 Ukrytá 4 Tsurumi 18 válcováním 1 soustružnicením 3 spectrometry 1 Turiansky 3 Telramundu 1 sountracková 2 Strekovský 66 šperku 1 Švábiny 1 tmavouchá 23252 vesnice 4 Valeriina 2 Stredoafrického 34 vápennou 1 Thierreich 1 Torbrex 1 Sterbehelfer 2 TRGVA 2 Sungovy 1 twycrosszoo 3 Spivakova 5 Thárská 2 spížím 2 Sydir 2 tribuat 121 toliko 2 Submatucana 1 veštiti 3 Venezolana 1 Steyrlingu 1 vérole 1 Vécs 16 Stolicka 6 Šríharikota 1 Tybergových 12 uschovává 7 Svácek 1 Tadesem 2 Stoibra 4 váhajícího 2 Toutenant 1 Spávalo 2 Tannenheim 1 Úvodními 4 Štrpci 47 splavné 3 Sterlingu 1132 ubytování 18 Trkov 4 štetem 4 Transversal 3 Vagonbuves 2 Šupinatka 3 Tuscan 1 Sulivoj 1 verlebte… 291 Statistika 1 ufolgia 6 Tongou 2 trojklanými 17 Švyturio 5 Tagoe 1 UNiBA 1 venezuelae 26 Taste 1 thestar 2 stredicí 4 Trifolieae 2 Ulrikenu 4 Vakfi 3 svetlotisk 1 Soyombo 1 Stínované 2 Studentenstadt 1 Taksopark 62 Tiki 29 stocil 17 ucebnou 8 Tuležim 20 Velemyšlevsi 1 stredoslovenskej 1 Šreiberzejf 1 Sozomenós 1 šrautasútry 1 Subhᚠ1 Uljanovskij 1 Stiassneho 27 Sylviidae 4 Usenetových 1 Uralische 11 Targum 1 Tiske 1 Torera 16 uškodila 4 tocených 1 Swyeruv 2 trojvazný 1 Truchina 20 Vášnivý 1 Synthesen 18 úkladné 1 Sual 49 usilování 3 Sviluškovití 1 Steinfurter 2197 tituly 1 stošestactyricátý 1 Tamtaddu 1 Sungkiti 1 spolecenký 1 Tomarza 1 strobovaného 1 tónovali 2 venam 2 Squalluv 1 Unorchestrated 12 tés 2 Tokko 3 Tocina 5 Túra 27 toulání 1 Theotókos 5 štrbinou 1 Tvarosková 1 VARD 2 Tyrhénskému 4 Tizon 1 tervingský 1 Swiebodzki 1 Türkay 1 velikánská 2 Terral 2 Tamaiová 5 Verpilličres 1960 svahy 1 spinosa 5 suzerenitu 1 Trojhon 1 stýkaní 4 spáchanému 19 spekulacích 6 tarzální 1 Sulmtálky 22 vášnivých 1 tarts 15 vejmutovky 1 Trímanský 14 ver 1 Tóthom 1 uzavíratelném 9 stenty 2 úplneji 1 veny 1 Špicanová 11 substituované 23 Taberyová 1 vevázán 1 Ugandanka 1 s klienty 20 Udržovala 1 užance 4 swého 1 TorT 3 tironských 1 Thlypopsis 2 strelickým 1 Tyjemeová 1 Tatiánuv 2 sterilizování 2 tríprstým 1 Tulça 2 Stangeru 2 Usolka 30 Veblen 1 Tyja 515 svedku 4 supplementem 1 tálita 1 Tadasuma 1 Thomondským 27 TAXI 4 valde 10 Trofimova 1 transfázovými 9 Standardizované 1 Taevakivi 1 Techel 1 vesenky 3 Tetereva 3 Stenové 1 sýkavkovitých 1 Tomaševská 8 Thyry 1 Studentenulke 4 Umkreis 2 Tátoš 1 spänning 1 Sulzenauhütte 2 spodobnením 1 Tolfských 1 tsukiotoshi 5 Tifinagh 1 Utbilding 4 Spektroskopicky 1 styd 4 tísnená 29 Turínské 1 süvässi 3 verursacht 1 Tólu 1 trojúhleníku 1 TTe 1 Vaiday 5 tetrodotoxinem 1 velkniha 40 Turba 1 s Jamajkou 11 svešená 1 uodal 1 spolusvázán 1 Stredotunguzskou 1 ŠTÁBY 1638 Tereza 1 Truchanas 1 Uttan 1 spoluodpovedným 3 tibiotarzu 1 Spykenu 1 Troostové 1 taggovaný 2 Vaunoise 1 Tastavinsaurus 9 symptomu 1 Tvrzskému 1 sternocostalis 1 Tripartellidae 19 svalit 1 Trebechovský 11 Tortose 53 štábu 1 strepnit 1 ubourávána 2 Transkortikální 1 sunos 1 Tschernschitz 4 týme 2 Vazovských 1 Sudara 1 Tanejevem 6 štukovanými 2 Tartlau 5 Tereziino 3 Tenebris 6 upozornena 1 šuró 1 šuplícku 1 Taboulé 1 spitnieks 1 Systematiky 2 útlumového 2 Vasylyuková 1 tabelacních 3 Uzu 57 Trenta 1 transkontinentálním 1 Steun 1 strevlicky 2 utreným 7 Vanniova 1 varvažovského 2 UBIETO 2 vernerictí 5 Udelována 3 Telurid 2 Turine 3 Spirem 1 tajuplných 3 Spindel 15 spím 1 steile 8 Svjatogor 49 Suzie 1 uddána 1 Trencanském 2 umocneným 1 Tauchfahrten 2 Tafilalt 4 Stracimir 3 Ururu 1 VESELAJA 2 Suchomelové 38 taktickým 1 Telecinemateca 1 tunelárskou 10 spojitými 7 trojspolek 1 Sušickou 1 Streamliner 8 správcuv 2 Vážku 3 Vacah 1 tradukoj 8 Štáfla 1 TESK 1 vdecícímu 2 stredoeurópskych 10 Verejnými 4 Uuras 1157 umožní 1 Varák 1 Übersaxen 3 uovo 1 Stredozimka 9 tucnejší 1 Stiplist 1 Stoiberovu 1 spilkové 14 transgenních 1 Tabors 1 väcšieho 1 unisexové 2 Stobs 1 =Tussacia 1 vaidja 2 staronemcine 2 Swansong 2 tréninkovému 4 Thorntonovy 2 Troopergate 3 veštebné 3 Tapajó 1 vanjskih 16 Stenava 13 stoupali 3 Vejvanovským 2 Tursachan 2 Valandur 2 STADION 1 Terlecki 1 Vertejn 2 subatlantských 1 Trevorovými 462 totožné 7 Thabana 120 uších 1 territoret 2 Tnua 1 tch 34 Týncany 4 Svanhild 1 stolovník 1 trapina 16 squatteri 3 ventana 1 Technopčres 1 staromilská 3 Terinkou 1 Stepanos 1 Strukturovanost 8 SWC 1 Trypanozoma 1 Thereziana 35 Trojského 8 Vencelík 1 vbodnutí 1 spolupodíl 1 spustošeny 8 trífázových 1 sútram 1 Štítosemen 1 Stürmende 2298 turistická 8 tasenými 1 spenkovým 1 studenum 2 technicistní 1 Tarap 2 subatomickým 1 Valešovský 2 trikolpátními 1 stopá 3 stoupe 1 spušte 69 Varela 2 ustájená 5 Telematické 2 uklizeny 102 toužila 1 Ústském 1 Squitierim 1 Teglová 2 Theutonicorum 15 tecná 39 ušetrili 2 Švirlochová 1 Turovic 676 vazeb 15 Strašil 5 stredoitalském 1 Šulove 1 Tassadarem 2 véritables 1 Tujuken 227 tolerantní 1 ubytovatelku 1 Tattered 1 Timberline 2 Trupová 1 VARIABILY 2 UNAC 2 stvorenost 1 versailleských 22 transparentním 20 Vadlejch 10 Stropcice 3 spolužákyn 2 Uvdža 1 Sydthy 3 Trebonských 2 Surrain 1 versari 1 tackklu 2 SSPX 16 Soundsystem 17 Tocchet 1 upotrebiti 2 Trebotovicích 1 Utsunomiyy 80 Tribuna 1 srostloobratlí 3 Timocrate 1 Tooleovi 2 Urvastő 1 Tadanae 4 suspendovaného 1 Tazateli 3 Válení 2 Vargupys 1 syslích 1 Tablicem 1 Vaygach 2 Tristany 1 uznáníhodné 3 vedérka 32 trojné 1 Subsystémy 1 Tagijeva 1 Spirochaetaceae 1 Tetralophodon 1 úvahovosti 2 tryskovou 1 Spomoziž 4 uhynulí 1 Trdlice 1 Standeserhebungen 17 svolná 1 tänan 9 sverením 1 TemNETu 1 uniport 2 tvaružkový 1 tecomp 1 Taruna 1 sverujícímu 1 svetstký 1 Strangité 1 velebného 1 transferovat 4 Tavas 1 T?lT 1 Tlusticz 1 Vesterbrogade 21 Uva 1 Tokolopi 1 twal 82 velkostatku 1 valoiském 1 územesprávního 1 Težebními 1 Tunnoton 1 Štýrsko 8 Treignac 9 spirituali 1 Usmernovacími 18 strádal 2 Tirrenu 5 Sturken 1 Velima 1 Vagaj 1 VagonWeb 2 superdebatu 14 spolustraníky 1 tsaruchi 1 ve 1 tez 2 Velbachy 4 štoudví 1 úzkostlivému 10 Telesto 1 Stehlíkovým 1 Städelu 3 stránke 3 Trebetic 1 Svisloci 1 Spehr 1 Uranylsulfát 1 Varyta 2 Tiong 1 Uralmašzavodem 1 Stowasserovi 1 vestigia 25 Symon 26 Tolmin 2 Véel 1 thioktová 1 týkové 2 Stohla 3 Tuone 1 Storhamaru 1 Timbavati 145 Vermeulen 6 Stannern 8 Stanislavova 4 Triebsch 1 Velkenye 1 Vachlt 1 Tekstylny 8 uchopena 5 Stereofotoaparát 1 Torkamanu 1 sposobów 1 unikátech 9 trídverovém 1 Vergeles 1 tacklovan 1 Sterrit 43 vesnicku 1 tacivským 1 tupením 108 sušiny 1 Tóniny 58 tiho 1 trojkvetý 1 Szemeretelep 1 ukusovali 7 vedkyní 912 Stále 5 UNIKS 1 utrháváním 30 strep 2 theokalypsis 1 Spravedlivyj 5 Studentessa 1 Squashový 8 Spahr 1 tonique 15 Štavnatka 1 tetrahydrokarbazol 1 syncytiálního 1 Trauttmandorf 1 Tchĺlerwč 1 Trigrane 2 Versek 23 ubírají 1 Štulcovými 2 Tedor 2 sušenkami 3 uranovým 2 Vasoprotektiva 3 Stružnou 1 splátková 3 Tannert 11 stalinským 104 úspora 1 TAMIFLU 35 stolicka 1 sualpínského 1 stru 1 vanoci 1 stto 3 truhlárskými 13 Tiran 5 Spaseni 1 Urios 1 Vasifedoseev 2 Télégraphique 23 Svetlušky 45 stromku 1 Trofimenkoff 1 SZENE 2 Štandlem 29 Srnka 2 Tšekki 4 sudetendeutscher 32 Talibanu 192 starali 3 VernissageTV 5 Templari 1 Tropidechis 2 Valperga 15 strašidelná 1 spongie 1 úšastnila 1 Spinacina 15 vedeckovýzkumnou 1 Ukmas 1 Stážísti 1 umrelé 68 Texte 2 Tekstil 4 Tatooinu 1 Vackava 390 Stezka 1 vejlupek 20 Thráku 1 symplast 1 Spenglerem 2 stolet 1 Stealeym 1 Štáva 1 Tiranané 1 tetrapakové 1 Utet 1 varieata 3 Vaulruz 1 Teterjev 3 Standfordu 1 Teufenu 1 synagoze a 1 SPRY 1 Tunkela 1 Urabewe 1 Ueberlaufturm 1 Stomatium 7 vetknuté 13 Verfassungspartei 1 strpením 10 ubýváním 2 trojkomorový 1 stržen 2 TLTV 1 st? 3 Uchu 1 tanaitský 21 velících 1 undermount 1 Stuckuv 20 Štítov 21 ubytovacím 7 trojdílném 1 Úseckou 3 speedu 1 Stanshallem 1 Thébes 71 Trebonsku 1 sympodiálnímu 4 Soustavou 17223 státní 1 vazopresiva 1 stoun 43 útocícím 204 souseda 1 Terrenou 4 Tureia 1 Sternbergovy 11 Sympatomimetika 1 subotické 1 stylity 1 Szoky 1 Temenuchus 13 than 31 TAO 2 Sumatran 1 Valkó 4 validitou 12 Svámího 3 Svištové 1 Stefanopulose 5 turbanum 4 Svinenskou 2 Štáralace 12 variantních 1 Srebotje 31 Vejmola 4 stavebných 1 speleologicky 10 termoclánek 21 Tristanem 1 Stinsonem 1 Verjudung 1 stejne 21 Sypaná 50 Strakova 1 Speciunas 1 Tristramella 5 trináctidílná 2 Vayne 2 troju 1 Thaoum 2 Útušicích 2 Tuarégu 1 ustavobranitel 8 Teaching 1 Ventrosus 1 Trojrole 2 Tindefjellfossen 3 Spisovateluv 1 Stambolijskeho 3 Syktyvkaru 6 Štvrtku 4 südlichen 5 sultánských 32 Unaveni 2 Triacylglycerol 10 vcelky 10 únosností 5 sprajtem 1 Urracas 1 Trattlau 2 Verhoeffuv 85 Štreit 4 Sülldorf 28 svádejí 1 Trencyn 1 velkomlýna 1 teliosporách 1 SpT 24 spouštený 24 Valdes 1656 ústrední 7 Svát 1 Steinhübla 2 splanchnocranium 1 STENE 1 trojmocnými 3 trihydrátu 24 Svídnicko 4 Vasilievic 1 Szemely 1 stereoscénár 3 Súrénas 15 tríletému 1 Tasením 1 Trinete 1 Umfangs 95 vašich 1 sphereing 1 supranasalis 2 Tódžóa 1 suévských 1 uhlíkovo 2 továrníkova 1 Trainwreck 97 Úzké 1 Szatan 12 tryskem 1 sumerskému 1 sváfu 1 Thébe 1 uloženýma 1 Trencsénpéteri 2 Stupefy 2 vedotin 94 štika 11 Turovecký 1 Stáhalíkem 3 Szatmárnémeti 5 ucpávat 1 U sloupcu 1 stereopohlednici 11 štechovické 1 Sphaeropleaceae 1 Strowgerovy 1 Starosaská 1 Télégraphie 2 Valentínova 14 sumka 17 souradnicovou 1 šturcu 1 Thomasovo 1 Stajkovem 175 vestavené 1 speciesinformation 1 Utvecklingssamarbete 3 spermabanky 1 terminfo 3 Újlak 2 Vanceu 1 stírac 1 tisknuvši 1 uezum 1 spoluorganizátori 1 spalovanými 1 tažinna 1 stránok 9 VCELA 1 verfassungsändernder 4 Veski 1 varicosus 1 Spendiarjanova 1 Strophen 1 Spirostylidae 1 Topieliszcze 2 Vercoiran 78 úcinného 1 szomorúság 1 trójském 11 Thrallem 1 thýlakos 1 Tramtarino 1 Tjarnaglofi 14 Ust 6 válecnický 2 ultratenký 1 TEOF 7 Territorio 6 Štepky 1 undegroundových 3 Stordal 1 technicians 1 Thurociensis 1 uvarit 1 tríboké 3 Tanijamova 15 Stáli 5 Sussexem 1 Ulmerská 1 Varnonu 1 treiben 177 Stává 1 útocneji 11 spedice 6 Starostenko 2 Strachové 1 stamineum 1 Throno 6 Urocissa 2 Stafordširský 5 Tajmen 1 Tancuješ 1 trochanterica 1 Theli 15 vetešník 1 vcitujeme 1 sumac 2 Stanický 1 Velkomestská 242 Vejvoda 35 Stainless 3 Tyczyn 1 Ulicním 1 sympatáku 1 uranicné 2 svadbu 1 Thyia 1 Tinte 1 Swaucký 1 Tvelenov 12 údelným 6 Theóna 1 úkladny 1 technizovaného 1 Torgašino 8 upoutanou 1 stredohornonemcinu 1 Velkokrížem 1 štátom 103 tajemnou 5 Tlupy 1 tps 1 Tókiciró 5 UNIL 3 Svetljak 34 tisícovkou 3 Spoluzakladateli 1 tellurnatý 1 velkoobjemovém 1 transverzí 1 típání 9 Spišským 13 Váju 1 Strongholdu 17 tancilo 1 Veríc 2 valcíkový 1 tymská 2 Temický 1 Teremiski 7 stacionáru 5 Tricátého 1 Upmane 2 Stachniak 99 think 1 Suikoden 1 Titzenthalerovi 2 Tausendundein 2 Szepse 4 Teorema 1 Štefánikových 1 turnvereinu 1 Veldkiricha 2 Toblerova 1 Typycký 6 tracníkem 1 Štrbicích 1 Terbishdagda 1 Svojkovská 3 Tercina 1 Tobercurry 1 Turtkulu 2 Tholiany 12 Superhity 1 Téoz 99 Specifickým 2 TRK 1 Stenzelovou 1 Strukturními 15 usneseních 2 Trambly 1 Thelypterispuberula 14 Sportclub 3 tríchodová 62 vcházelo 9 Stáhalík 8 Taniquetilu 1 Tamforea 2 Venetidis 2 tekomy 1 Ukonjärven 63 textare 1 Svansen 15 úklidem 1 Vanunove 1 trimolekulární 3 Topiarz 1 trypanozomiázy 5 Sudislavice 1 tykat 1 s Ministerstvem 1 Veltin 1 Synthlipsis 1 Trvalého 1 Tripolitánie 61 STEM 3 trmického 1 Syrovátku 1 Ubaldina 1 Tatebola 1 trígamovou 1 Thingspiele 4 Valsassiny 2577 stránce 1 Theognóstove 3 špalíková 87 Stokes 1 televangelista 1 Turibia 1464 úteku 335 ucházel 11 Teufelsberg 1310 ucinil 3 turkutského 1 vazali 1 Velkú 1 stavlisty 1 Timbargu 2 staflika 1 Twinstar 1 STREDOAFRICKÁ 3 tycoví 3 Tordinona 1 Temedad 9 Thunovském 1 unilateralismu 3 tecnovým 2 Valalská 1 tavuto 1 Srovnavaci 1 Tlatelolcem 41 Tefen 7 svedeckými 2 Versuchsanlage 2 Trojhra 1 Svetilnik 1 trailli 1 tangenciálou 6 Vejdem 2 spolecenskokritického 15 splaz 1 Thornhillová 1 Transportgruppe 1 Torreónu 2 Valimar 1 straovekých 3 Tradizione 1 Veneza 1 Trigga 1 Štockem 1 Stalinska 1 Védskou 1 usla 1 Sutar 6 Starhon 1 Teofrastových 13 ulomení 3 Trostlos 1 teenageri 1 Ultrogotha 7 Tempsky 1 Squizzi 1 Stirbey 1 Tubarăo 1 Vallonnet 1 Tomasika 18 vendinger 5 Utonulé 7 ustašovský 158 Vermandois 1 Termofotovoltaika 4 Vangidae 1 SpotifyUSA 1 Vermenagna 2 SuperB 12 teprv 1 Strubegger 3 Šternem 7 veleúspešnou 2 staráme 1 ulomak 35 Šrubar 1 TButton 1 údely 1 Unmoored 20 tretinové 1 Tarasevice 1 Šprclík 1 Triadická 2 Stadig 28 Torquato 1 stordito 1 TTAGGG 1 Steinitzovou 1 Spacil 3 Troumouse 1 Tuomaala 1 Steinhuderského 1 Tirakhmír 1 sporitelu 1 Tarpura 3 Uspely 1 Technicamente 4 Valdštýna 1 stoheliských 1 Udesianim 1 Uracha 2 trápenie 2 Velkoformátové 1 Tragelehn 1 Usherovského 3 tocím 2 Tianchi 21 Tratový 1 Sugimuraová 1 vetlužského 1 testimone 2 Turksum 1 Sztremlëzna 1 srbocharvátštiny 2 Tihange 1 Torilidetum 2 Tanecné 28 ubývající 1 Upsaroka 1 Stranskiit 3 Štáchové 1 Ummud 709 stanovisko 1 Steilküste 2 unmöglichen 1 vazo 1 Talulka 1 Színfoltok 1 Tauner 3 Tenu 11 Vejdovského 1 urografií 1 turích 2 struvitové 2690 sousedí 5 Staráky 1 Stenwick 1 urartské 1 tabina 3 terminating 1 Tullig 1 testerech 1 vč 1 Theaterverlag 1 staccatového 2 Stredomoravskou 1 utvárenost 1 Švachem 3 ühsi 1 ubytovaného 2 Travnikem 2 Tubicka 1 Sweolandu 87 ušlechtilý 2 Ulysseus 35 štvanice 2 versos 1 VElký 1 Sullovou 1 szëgekkel 26 stabilizovány 2 Theuderica 2 uwakuganza 1 uhlícku 1 Tajovském 4 tagmat 38 stimulované 1 starostenská 1 tubiforme 1 suljettu 1 Thanhausen 1 TRUHLÁRSTVÍ 1169 trofej 2 tibetologové 1 trojlaloková 1 Talackoniu 1 Succinyl 1 ulekare 3 toulcovitých 8 Sudduth 8 trachytické 1 Torrelodones 1 Tafaroui 1 Veselje 33 taxislužba 1 teskovice 1 s Závažnou 4 Soustredilo 48 totožnou 3 Úr 9 Tomcák 3471 svg 1 takbiskupem 1 Spiano 2 transferum 6 Valivá 53 Stewartem 8 sýrová 4 turnanská 1 Tarnasem 1 Trimera 1 Svijeta 36 Sury 9 unsern 110 usporádalo 1 Štebrová 3 Tríkrížový 1 Unquestionable 1 sypkovinám 2 Verticordia 1 Stonarzowie 12 Tlimon 207 trávu 51 velkoknížetem 1 Staromestska 1 tüh 2 suchozemcem 1 Turcinská 1 Tokicirovi 3 theofilantropii 3 turretu 1 sugugium 1 vecierok 1 Szafranki 1 Tršnická 11 specifiku 1 Svitlovodsku 2 Svetozorem 1 Tomamae 1 tereba 4 Vansbro 1 troglobytu 5 svobodomyslným 3 vertebrate 47 suverén 4 sydneyské 1 Vaderová 7 venustus 1 vegetovalo 1 Udara 1 Štekerští 19 stážích 1 velebitská 2 Symbiodinium 2 Stiebling 1 tantiémami 3 užasl 1 Theoretická 1 Spertendorf 21 ukradeného 1 Toreze 1 Validní 1 trímesícní 1 †strelec 4 verdikty 4 studiën 3 Štávou 69 Transparency 1 spletkem 4 tetrahydrofuran 3 Traby 15 spev 1 Tackmann 4 Sporadické 3 systematicností 1 umím 1 Tisomnicka 1 unifikovanost 3 tradovaným 4 tetrahydro 1 TAPFEREN 2 Struhala 3 Tchangskému 28 uhelným 5 Tagg 1 sušilovce 8 Unterweitersdorf 2 ultrastrukturální 1 strhni 7 stavitelském 1 Strihaton 17 trístého 2 Vejfuk 1 stanzy 9 Splnený 64 Štech 1 Vardanijou 3 Thunderforce 11 Värnamo 4 vakuolární 39 Váže 1 Vendelmar 2 Uvádeným 11 Tortura 8 stechiometrickém 1 Šumadijské 31 splátka 1 trojpramen 2 StartupMap 2 Uznávanou 1 Uroža 1 Stojakovic 1 Swainsonuv 1 Svataviným 1 trieste 3 Stabreim 21 vadného 2 Todorovského 18 Terara 3 staroruštine 2 Terpve 59 Telemark 3 Tuomase 6 tradicnejších 6 Tilskueren 8 s ruznými 47 Tankreda 1 trifoliatus 34 thiamin 2 starocesku 1 Ucarováni 1 subplanum 1 územín 4 varietas 33 špioni 1 supérieurs 9 Trigorin 3 Tacora 1 truhtin 1 utuženou 2 Svajambhúnáth 15 Uzbeku 2 Thielovu 87 Velkodustojníci 59 Squeeze 1 Sulinkiu 1 Vasquaz 1 taslanizing 1 vdechnuto 1 Tálínskej 1 Thulcandra 1 Studoavl 1 sparsionis 47 trionfo 1 tibetaine 9 titulovala 1 Uromys 4 Verce 26 travail 1 šterchátko 12 souputníka 1 tošin 15 tuniských 1 TOROL 3 ŠPICKA 9 Vavrinecké 1 Trcet 1 Sytech 28 Španelským 1 Ukrajiny Anatolij 4 sterigmaty 4 Telloh 1 Thereze 403 vesmírných 2 Svetozora 2 uchovávací 3 Vallduxo 1 Tacevsku 1 valecském 1 tokovou 33 uškrcena 1 spolutvurkyne 1 tuilerijského 10 Thang 5 svištounu 5 Tyvek 1 šupinokrídlí 1 Tripplehorna 2 Ugnouas 2 tallinnskými 1 Šticka 2 Tarchetti 1 trejduje 10 Strohé 8 sternberk 1 Turguti 2 spoluutvárení 1 stredopravému 21 transports 1 Tátonyu 1 téckem 1 Tokushimy 11 stereofotoaparát 3 tiptronic 1 teleférico 1 Štajerák 10 Trackball 1 s vodorovnou 3 S?U?M?M?A?R?Y 1 superindendant 1 Varvažovských 1 Takva 1 Vanurovu 2 varietates 8 Tarvonenová 1 Strážního 1 Svidnické 1 Spedice 5 Štenberka 1 Takurua 1 tešnovskou 1 Turkiti 48 Thagard 13 Vevce 3 Togaria 1 Stewardeß 2 vejcoplodém 3 Ušetril 1 vesperella 1 universiád 1 stracina 1 Tacibany 4 Špitálníci 1 s názorem 2 torturu 1 squamati 4 Tetraphidaceae 27 telního 2 speleologum 2 Systemizace 1 Trotschan 1 Spettiguová 3 sucouského 11 specialIcecream 3 Stadtrat 2 Syrach 4 Universas 4 Temniak 5 Úvozová 1 Staroitalia 38 Sylvilagus 1 Vakamova 5 Sychravy 2 utkáno 11 valencijská 112 válcem 1 Streetwear 102 uspokojivé 248 veky 2 spájených 1 STRANG 1 Trompetenschmetter 1 s tureckým 1 usporít 2 Swietla 1 Subschitz 2 Velectený 4 tocnik 1 Veszele 2 Svedectvie 10 Texlen 1 Vatanenove 1 Susenyose 2 uškvarením 1 Tárreguv 1 Soursweet 1 Udumbarika 63 stavovský 1 sulfosalycilová 3 Stillin 1 twych 3 Ugandanu 1 tortue 3466 téma 1 Treuenburgu 1 utrpeních 1 Vammelsuu 1 Termickým 1 Úhretické 54 synka 1 Špinkowé 39 Stomatologie 1 Tronnerová 1 Subluxace 1 Stoniškis 10 úhelníku 1 Verzovat 32 stár 4 varanum 23 usmrcuje 1 Thysochromis 1 též pupplay 1 sudbe 2 Teofylakt 1 Tret 5 ustavy 1 tríjehlicných 2 valisineria 8 Vazgen 6 Tiloukaikt 3 Šutera 34 stabilizátorem 2 Talneeme 1 Tonjukukuvho 6 válecníku 3 Terasovitý 52 Venty 1 Umeským 3 subprojektu 1 Tempahem 4 Štrougalem 1 Urdžinbadamová 1 Vaisové 1 Štelinovi 1 ubranitelná 1 Vasilachem 1 spojenecem 18 synchronním 15 Suspenze 1 uranicité 8 Tovuz 12 Trajdosová 2 Tardinim 5 štolbou 1 stronzo 1 Triadasse 14 tetraedr 2 Tisém 1 Tomašem 1 s?metati 1 üvegcipo 1 Ubisof 2 Sumaco 1 SvecovaB 2 stríbrená 3 starostová 1 Ultimecii 1 topvylet 1 Tamboril 1 teška 2 Turkka 1161 tvrdil 10 tvárím 1 Sunturnbrew 1 s Johankou 2 trifluormethan 1 tuznek 1 tmavokvetých 4 tanach 1 tercíkovým 3 strelenými 1 s rakouskými 2 Tifliské 19 velkovévodská 1 Třnsbergová 2 Thelemangasse 1 Tkazc 1 Stamanna 1 Trzeptschein 1 Tygranése 2 Ustjugov 6 teplovzdušného 1 trímilionové 7 Steinseiferová 1 Urogomfy 12 vclenuje 2 tetralunaria 7 úžehu 1 supraoptickohypofyzárního 3 Udodov 11 Stadhuis 1 Sverenskému 3 Teistická 925 tenisu 1 Valwyn 2 Tolstov 1 urinální 67 Šuva 8 tvarovými 1 Troglotaoysicidae 2 Terezkou 1 Tostigovými 1 SpiderplantFlower 1 súnecko 3 translacích 1 surfarkou 2 spolubojovníku 1 Šuan 2 Tuns 1 suspendio 172 UNICEF 21 údelník 1 Talinnská 1 Svalování 123 tríkrálový 1 taureny 7 turbínových 1 starodemokracie 125 Svojanov 1 stisknut 1 stagnum 1 umíchal 1 Tumilovic 40 Tetetice 2 Sweatmanová 1 unitaria 4 Spoluautorství 2 tricetiminutovou 1 utekajte 4 Spätrot 11 Tanvaldská 1 sterolum 2 Tonkou 1 Speightstown 2 Thomlinson 1 spiritualités 358 Valtrová 1 Tehupravleniem 2 Veroce 16 spaloval 1 vedeckým 3 trísetletý 4 sug 7216 spolecností 4 TAMu 1 Tusba 1 Vereinszeitschrift 1 transferinové 1 szervek 1 Stallehr 1 tagine 1 Ufnukaný 1 stehuje 3 Suhagu 1 teurgii 12 transuran 1 strume 1 Szülofalunk 2 tuchorickém 2 Veskov 15 špionážního 1 Tuncata 4 Täby 1 Vasdeki 1 tvistade 369 stoupající 1 syntetizujícími 19 undatus 3 UNGERMANN 224 Udinese 1 tácovým 1 Únetitcer 19 Valerija 1 suggestivního 1 Tooze 1 tunzích 6 trilobus 1 Velvetiin 23 Váté 2 Tuchomyšle 219 vazbami 59 starocechu 1 subvittata 2 Srážkove 1 Stuhou 1 venosní 7 Tridentum 1 tupejším 3 Tkotz 19 Szalatnay 2 splenomegalii 1 Sudži 6 tabuizováno 11 Stracený 3 Štírci 1 Vázán 1 Vágmedence 1 Tankock 5 Trapnest 4 Stablo 394 tankových 2 TekStyle 1 telesne 6 veszprémský 1 Vasiljevicovi 1 syntet 1 truboprokatnyj 1 Stredanských 6 Venhodová 1 Valckenier 579 studijních 2 väravaehitis 2 stríli 50 splavu 6 utratilo 3 Trombocytopenie 1 Stepfegg 1 Unitatea 5 trestuhodne 2 tech? 6 Stridor 24 uzbecky 3 tvrdívá 393 textilního 4 Thézac 1 Thierbachermühle 89 trasami 3 Štastný 1 úhlomernou 1 Torreyit 1 Südslawische 5 Struhsaker 1 Vagunda 2 svalovala 3 termofolií 3 Velvarského 2 uzamykajícím 1 Sukošanské 7 tykvice 11 tamilštiny 1 tenatum 7 sour 1 sylvínem 1 s infekcemi 3 športov 3 Sundial 1 Thelypterido 18 uvedomelých 1 StarHawk 2 turkestánského 4 Sporopolenin 1 Trautmansdrofu 2 stimulováni 1 strážnickou 10 turboalternátoru 7 sparák 1 Tremesny 4 strojení 1 Sveinbjörna 5 velrybím 1 uine 2 Tauru 1 Supanat 2 uhrazování 4 Šupcíka 5 tlustozadké 1 velebne 2 vahi 2 Surmaj 258 trik 1 Talara 2 štúrovskou 1 Tampellou 1 Várka 9 veporikem 4 Starecká 1 Stoický 1 veselost 35 Styly 1 ulrichity 2 velikostnímu 2 Varováním 1 štavelanovým 2 thangkas 4 unisona 1 Vejhák 4 Ullmannovou 1 Speerstra 26 suverenitou 1 Strzeminský 3 Vacations 1 Vanmaerlantstraat 4 Thézy 1 tchajcouské 1 specifických instrukcí 1 Stanovských 2 Triethylhliník 52 taz 1 Spekulací 3 Vedric 23 thajskou 1 ultimae 3 Trodes 1 Szentjakabfa 1 Velenovic 1 Teratofénus 1 Urmija 1 uctivostí 2 Terrina 1 Stavstroj 4 Tish 3 Tapiovaary 1 teckovitost 51 Udržal 1 Soycek 1 Tuernich 1 Sugy 1 Uškvarok 1 tripolci 1 stomu 2 Tawesco 6 Trox 1 stati 1 Tsuneo 2 Thannen 1 spláchneme 1 Torchiho 4 Társadalmi 8 Tinianu 1 Valverdeho 1 tuhlík 2 utišená 1 Târnova 2 titin 53 stolicek 5 Tysmenycja 19 Tolštejne 1 Susneuv 1 Špetlu 7 Štrudl 1 Streitbeilegung 2 Tacuno 2 upocené 1 Terutomo 3 squadu 1 Tunnym 3 Thignonville 1 Uzíku 6 Suarezová 2 Szmagier 5 Tife 39 Thomayer 13 Stad 1 sprejum 1 Strzemie 22 triových 1 Spathulosporomycetidae 1 unbipentia 1 Stokap 1 Útešné 3 VCP 1 Tolstojove 1 turnout 1 Šourkuv 1 Týfónovi 3 Vertiko 2 stigmasterolu 1 Théotolon 8 Sultanáty 1 Titeica 1 Tuire 16 Svete 1 Štýbrová 5 upírat 1 Stanislavu 15 stredovému 8 Súrjavarmana 2 tearDown 1 urbanizována 1 Vermessungsamt 18 ukazováku 1 Stammwappen 1 udmurtsk 3 tufovým 38 Thelle 1 vedme 2 svijanskyujezd 1 Tupaiu 1 Sybilliným 2 Veszprémský 3 štedrenci 8 Tója 67 Valles 3 Sveitarfélagiđ 1 s kunovským 2 Studierende 5 townhall 2 s nástupem 1 Tauts 2 Trebnouševsi 23 TDD 7 subtilních 10 strihacka 2 špagetovým 1 Valáškem 1 trevírští 1 ubývave 2 Tivernon 1 s Panathinaikosem 1 terminaision 5 Tísen 1 Superu 2 Uruguayských 200 Utrechtu 3 UGMK 7 Strategies 1 Ullischwarz 1 urimasu 1 uplne 4 Tetbury 1 Umerle 1 Tamassia 1 triakontoroi 2 Štoudev 1 Vakufski 1 Tiyé 1 vermummten 1 Tailladovi 1 Velitem 2 úvazy 1 vdpWindow 1 Storhovu 1 Tarangul 1 tricitkou 1 tafta 1 sunnyleone 1 Tairovskii 12 Tannerovy 2 Temou 1 Tribušany 1 uitstlani 7 úrokovými 1 úpátí 1 Thorsteindóttirová 156 vedoucími 1 Štonda 4 Üniver 1 Tropheryma 88 TY 1 vakuotlakové 1 undecylová 4 transmisometru 9 Uhlisko 3 Tepaneku 1 Verbickaja 2 úklone 2 važte 33 Toblach 70 tranzitivní 1 Székyné 3 váckovitý 7 Vernírovic 1 Superpohoda 3 Tárápíthu 1 Subsampling 3 tríadresního 2 Surrealistickém 1 Tethydní 7 Vazal 1 Spolužáckoviny 2 traut 1 Thanim 104 syrskou 3 Thysdru 6 Tiberiadu 2 trnícku 2 thite 196 Valy 1 sqlMapper 1 veriteluv 1 súru 1 Tschöppera 1 Ucriana 1 trikutí 1 Šustácek 4 subasociace 4 Syersová 1 Tounatea 2 Spocítání 1 Souwera 131 udelováno 1 Sygma 6 Telluridy 1 Sourabh 1 Trpasllík 4 tetrahydrofolová 1 tupim 131 spádu 1 Strombilder 30 srovná 1 svedk 29 stearová 13 stylistiku 1 supraphonské 6 strumy 1 superlearningu 2 Tyrozinkináza 1 Vavrouškovi 1 švabachovým 1 Stroganovskému 1 SourceMage 4 Thoire 7 televizorech 11 Trojky 1 trawlingový 1 Telemachosem 1 Toveyovy 4 sunce 27 Spiderman 1 torangi 2 Tewassoul 12 šupinoplodá 1 stereocílie 1 Velarium 42 Urgell 1 spusoby 37 tura 1 Univerzitný 1 Svappavaary 2 Stoppardova 1 Theosophischen 1 Trešnák 1 spje 1 Vancouvrem 1 uhynuvšího 1 Tanchelin 1 Tehol 1 velkorozmerným 1 starckového 18 stežnu 5 Spooks 1 udávily 1 uchovejte 1 tanjur 3 Tanárka 3 tiliae 2 Versaillesské 24 uracil 1 Týmiž 1 Talc 1 Venilie 4 ÚTULEK 318 stávaly 4 Vernovicích 1 Szekendy 2 Terasovité 1 Tianhuang 16 unitárský 15 unikalo 1 s rytinou 3 studním 6 spisovatelkám 1 verdugada 1 teatrálností 2 Syrenu 1 s konecnou 5 vclenený 1 spolutrenér 4 Vennbahn 36 Vach 8 uskutecnovali 1 Stopex 5 tyranovitých 2 Stankovem 4 termosublimacní 22 užovku 159 Špejchar 2 Taguküla 25 svodum 1 váckum 3 Sycivka 1 Tesseed 3 uklidnovalo 23 tattva 4395 stroju 3 triangulacního 1 towarzyszko 1 TaciX 1 Vastgoed 1 Teplickému 4 Vébrovce 1 thér 8 Spartakiádního 1 textologovy 5 Uziáše 1 titulka 1 Trémelles 1 uvážili 1 Thavonat 1 stlacitélná 44 tesarští 3 spletly 24 sulfanem 2 uheldig 23 svrchnoturonskými 8 Varenská 22 tanter 1 Trifinio 1 s CSSD 118 Stránská 1 trichohyalinem 2 Tréauville 1 velkoproducenty 70 strontnatý 10 tešínskými 2 Svetle 39 Stradivari 3 trámcích 1 Uhlára 1 tvaroví 56 Suetonia 1 Válího 1 Varnute 2 uvážou 6 úchytech 8 umeleckohistorických 1 Taffari 1 Trenbunskaya 1 spolkarení 1 Srodon 1 verm 11 Veikkausliiga 25 Tridentska 4 spirálními 2 Tylenchus 7 technologem 12 ÚVV 4 titovské 3 velkofilmy 4 Spornraft 21 USN 16 trente 2 Szelepcsényiho 324 toxický 1 Subsequently 1 Stárkou 17 utracena 3 Tiszamenti 1 Trpyivá 3 stými 1 Tombaughovým 1 svodných 1 Trindet 1 stretném 1 syssleman 1 Veleckých 2 Steltzner 1 Umbellales 2 úslovích 2 Súchovská 2 Utonulý 1 strikacek 1 Stantejský 3 Townyho 3 Tyrionovu 4 špekem 61 Vetus 1 usazeném 1 Terkuell 2 Tatagliovi 2 Sterlik 2 vaspene 13 utržených 2 sportsite 1 spoluvydatelem 1 svrhneme 1 Treskonicemi 12 Važecký 1 systemizací 131 Tanja 2 Uverejnovala 4 Usazovaly 1 Tuffer 4 Starožitností 1 Technošamanismus 1 Tagoranu 4 uskutecnenými 22 Teuffenbachu 3 TSt 1 tergamina 1 veletuctu 1 úlitbou 1 Tanurkova 1 SPER 3 Svatebním 2 SPILKA 4 spokojeném 2 Uhlandem 1 Termen 3 stežovatelky 2 Varnalizdis 2 trhaní 8 Switalského 1 velitela 135 úkolum 98 vesty 10 Velia 1 variante 3 tajeny 1 Turáni 737 vernost 1 trimují 19 Vadzim 1 Steakobraní 1 Vendégh 1 TOTální 4 Stohy 1 TELNETu 5 tarifum 2 Spojovacími 1 Umed 2 Spiegelové 3 Troizenu 2 Unimogu 1 Stouchsburg 1 telediario 2 Tavarnok 3 Superlehká 4 Spockovy 6 Tortugy 3 Suiattle 1 sunnydaleském 3 udelenu 1 trapézovitá 1 Traumuller 18 Tejman 1 Subulitidae 1 TIQE 5 tartanu 2 utána 112 spotrebovává 54 tenisovým 3 Stays 1 Vaceslava 1 utratiti 1 Unold 1 trícský 1 Staghunt 3 Thunderjetu 1 Tringini 1 Uštedril 5 Steenman 67 valená 1 Tvurcova 1 steil 2 Tunkluv 1 Sutny 2 teki 25 svátecním 16 usnutí 2 svetloploutvá 18 sprežku 12 tetrarchu 1 Spivakovského 783 tónu 1 Tronda 15 státovedu 1 tuši 1 tórou 4 Teinosuke 69 Sovereign 6 Theather 1 Tormasovovi 1 synchronizujícího 2 Thurmberg 1 Triamteren 134 tankového 336 teoretických 2 šteku 1 stropkovským 11 Tournehem 6 Valec 5 Syrius 1 svetlezelenomodrá 29 Tine 1 Venuste 2 Vanosc 2 Storici 24 triasových 1 svatine 1 uco 1 Spontinium 32 Svatopetrské 2 teplonosným 2 Šušanu 1 tcheque 1 Versitale 1 Sposamme 1 Spelunke 1 tentatum 8 tomes 1 Turanami 4 statum 23 ucednická 11 Táboru 3 Tandžuru 1 Suevite 1 Valary 1 Suvorovské 1 supremi 13 Thrust 1 tancujícího 3 Tourelle 5 souosými 1 toubeleki 1 Tuberostylis 1 vards 1 Vanariony 3 Stranami 33 Vajont 5 Vaaver 1 targety 3 tisícovým 1 Togenkyo 195 velikého 42 Spermie 10 Tondou 1 Spasski 1 Verschoor 2 urzony 1 Turkovská 3 stecky 1 Tchmyreva 1 Swindin 1 Tischbergu 3 twarz 1 Vazovovej 1 tríslovinná 20 Trebotovice 2 Tatarincev 3 Torcida 3 transversi 298 Suchánek 7 stolístku 11 vdoveckého 1 Stojetín 1 theoformní 1 umanutý 1 Straffordova 1 Thioproperazin 4 termité 1 Troestrem 2 Tinadú 2 tropismu 1 Tertiärablagerungen 2 stát 2 Strážnickém 1 Španiér 1 TsuShima 1 spolucísarum 1 Thespróti 6 spásný 1 Trümperem 2 steran 2 Tellancourt 3 thigmotropické 3 strednevlákenné 98 Svetlý 1 šupinovkou 1 Vechia 4 Thénisy 1 Tanaberku 1 Talbertová 18 Suwa 1 trompetas 3 válcuje 2 Statné 1 vadnosti 48 uvítán 1 ubohému 1 Terským 3 Tamango 2 Triberg 3 tocivosti 3 Vaváku 26 symbolistický 1 Stoklasovy 1 Teistický 2 Vagtmester 44 tchangské 2 Trefulky 2 Vellexon 1 Suheimat 1 utilizing 1 vampýrech 2 spermacetový 2 ukoncována 1 trešnový 1 triakontan 2 utužuje 1 srts 1 Todhunterem 2 vejmutovce 1 Tínés 1 Tizsadob 1 Titanosauridi 41 spoluzakladatelka 2 Todman 15 Trapisté 1 VELEBEN 8 Telegrafia 24 Tikalová 1 Transwoman 1 Troizene 3 Štepanické 1 Tongarirem 1 svadách 82 strakatý 1 Steimerové 148 Specializoval 17 štocku 7 UNOMIG 5 technopárty 3 Uzdicka 4 stríbrenkou 20 Svinica 1 Šúni 1 Sufer 2 succulentae 4 Transparenty 4 Stomis 4 Thunberguv 1 Tibau 2 Trattado 1 Urcite 2 šplhajících 1 Timida 1 Stoupala 2 Valíckuv 3 Tôn 4 Úsmevem 3 Starohornonemecký 60 sverenského 4 tajuplnost 1 Ustyug 11 speciaci 1 VAULT 16 Trigonella 9 VACULÍK 7 Versaillské 1 Tomáškovu 2 Tsz 4 tangenciálního 2 sruga 6 trubicovitého 2 vajgl 4 stig 14 Tetovaný 1 transvestitském 1 Sýbrta 1 Valyrijský 1 Ussachewského 1 trainining 1 Theravády 9 Stanislao 4 Travet 1 velikánech 1 Vésálí 18 Stremošice 113 standardizace 4 ustrelil 7 Stuartova 1 ústavodárných 1 trítelesovou 2 Tillegem 2 uzlovému 1 uchohybné 2 sytejším 1 Sunshineová 1 spoluobjevoval 1 Sulistio 2 Tibaldim 8 tetrevovitých 2 Strelcovova 2 úpské 2 utecenského 1 Tarnazsadány 41 ubytováno 3 Velešove 2 Starostrešovické 1 Sturmové 1 spixova 6 tuneru 36 Štrunc 1 überraschenden 29 Svítkov 2 toxikologu 1 u staré 1 Väinämöina 3 Suchitepéquez 1 Traed 1 vaistine 1 Udždžaina 1 SteelBath 1 Štetkárová 3 tesil 3 Thelypteridaceae 1 termofytu 1 Velikonda 1 s padouchem 33 usychání 1 translatum 1 sygyzyy 3 Trckove 1 Tirao 1 sveták 2 TaNbTi 4 Tauridský 3 Trovador 1 Totenburg 3 Tsé 4 šoupálci 1 Stefanis 19 úlovku 3 Szászberek 1 tärkeimmät 12 terciárské 1 Tecumsehuv 10 Sovremennyj 11 tenuifolium 14 trenažér 1 ungunstigen 9 uprený 1 Sweetfeed 4 Tiszacsernyo 1 Svedlunda 2 Sykut 1 vcuctnuta 13 ume 6 Švábem 257 TNT 1 Velflu 3 stínených 1 Tarigem 143 UCI 1 thú 2 tianwanského 2 Speziellen 1 Tejmür 1 Utilitární 9 udržováni 1 Tymfé 1 Veporu 2 totácek 1 Strapky 1 svanou 1 vejírovou 3 teozofii 235 umožnení 1 Varnenska 1 Šunroku 2 Stylosant 2 Veteres 1 Turbobrake 13 stojatá 1 Telnecz 5 Summi 1 s Olomoucí 32 typizované 3 Tualagy 1 termokomore 4 sukralóza 1 tyrosinóza 1 užikový 2 Tourainová 1 sublimes 2 Szacku 5 suvenýrové 1 tinyworld 1 Stojcice 3 Stabaek 14 Stežírky 1 udelowánj 1 Svetlovodským 1 Tonarzowa 1 Tymowska 31 Sprievodca 2 Tempé 9 Tinea 1 testvér 3 Terterovci 1 …vetšina 1 Verwaltungsamt 2 trpaslíkovci 3 Teatino 1 válcev 1 Trevíra 1 Strumming 1 transferovým 5 Speckles 135 Úponky 3 Udon 2 Szoltysek 8 uskladneného 1 Šuryn 1 Vahadenia 5 urozencu 2 VELUX 72 teoretiky 1 trckovské 2 startkodon 3 Tabulátor 5 Unciála 4 tubou 4 vatový 2 Uclaf 5 történelem 1 Speckaertovy 1 Svatoprokopské 1 Teyleria 1 Urizel 1 Valmontove 1 Turbiznes 3 stríbronosných 2 Turtleneck 1 spríznující 8 Spectres 1 Urmase 120 Spojili 20 versailleské 1 spinarova 5 ústricové 56 Sullivana 4 sugestibilita 2 upravovanému 1 Stadtgeschichten 5 strážení 4 Uvolnované 1 Vargasovi 1 Vdecni 3 Tincey 1 tuyo 2 Toshiyuki 4 Torrancová 1 Tolmács 2 Ustavicne 1 Turme 1 stowers 1240 spoluautor 95 Vavro 888 Studium 1 spácích 2 starosedlské 28 Tilschem 1 s klempírem 1 tardía 5 Teletoon 1 Takatsuka 2 Thuille 3 vce 16 Swingin 1 trénujem 5 Tarpon 1 Syntetictí 1 …veríme 2 urraskými 1 Spacializuje 4 vaincus 8 šugendó 1 Švehlíkovou 11 Vardak 2 transrodových 1 stádovou 1 Uiteindelijk 1 systematyka 2 TMRP 1 Tiszaszederkény 29 Termonukleární 92 svázány 7 Tiramisu 16 Technice 30 turovitých 1 vectorized 1 telekomunikacne 2 tavolara 15 turbomotory 2 Trélivan 184 švýcarskou 2 Strachanovou 1 Vänttinen 1 thionylchloridu 1 texano 6 Tomíšek 3 suchopýry 2 triklopyru 1 Tayinloan 1 Vattalil 1 Vascin 28 spechat 2 Sztojkovics 2 VerLyn 4 termofyzikálnych 6 sumací 1 u brehu 1 Ugriumova 1 Umoricoleus 1 TANTK 2 transfigurace 5 usporádáními 1 VCP 2 trójským 2 Taltitz 65 Udelal 130 Težký 25 trsátko 6 Tigeaux 2 Takamotovu 1 Sovajärvi 4 stromovému 1 Topalovuv 1 trokken 1 Sušumná 1 Varjazích 1 Thernöe 238 útvarem 1 Stáncija 2 uskromnení 1 Supersstar 7 Stubaier 3 TFlops 1 tunkový 73 Ústa 1 svštové 1 Ustjanský 1 Titticut 6 Sultánka 1 Vásovcu 1 Tepljakovová 1 Ungernia 1 vecickami 1 translyvánského 8 Thielemans 7 Umschlagplatz 7 Troplowitz 1 specialní 41 sungská 1 tormentera 24 vesly 1 Vedralova 7 Štiavnickými 3 Stokerovým 9 Starbreaker 1 Stygothrombioidea 5 tequilu 1 Tofflera 1 sprogart 22 vakuovou 73 Stilicho 1 Trubadix 1 Stuašuivý 10 Tarmo 1 Taycharukh 1 Valencienská 16 usekli 1 Timpano 130 USHL 1 turbiti 6 Suckley 2 tropopauza 1 temnostního 3 spinakrem 1 Teljukova 4 Sportplatz 4 Vachnjanyna 3 vakuotlakovou 1 TimeSys 6 strázne 5 us 2 Torricellim 2 Tetreaultová 1 staroružovými 6 vejmutovkovou 1 tiáotiáo 1 vavry 2 tetradekanu 74 Tempe 3 Vejprnicky 1 Svolavše 1 Sundbackuv 1 Termelo 4 tuneru 1 verolomnou 1 Straet 3 Stravinski 1 Štorkánu 3 Teatret 1 Suchovršicemi 2 Tetrahydrát 2 Ubrusy 1 unupress 1 Stuivenbergem 3 Sunara 1 Tennessen 30 uceného 1 suda 1 Surmia 3 Terada 1 Štulíková 5 varnášrama 1 vachán 264 Váh 7 šoupálkovití 3 tlapových 1 Umístujeme 32 Tórou 51 Tolkienove 1 Steedova 183 udávána 1 szlovák 1 Szilágyigasse 2 stachanovského 1 Venstresocialisterne 2 Tacámbara 1 Tzetzovi 1 Teigovu 2 tarafit 13 vešení 1 Spiruline 5 Starostína 1 stykovocnyj 2 Uvarili 2 s pudou 10 Trenkwalda 2 štvrtý 1 Troche 1 Valbusovou 1 úpešným 3 Stráská 1 spektrometrální 6 tablete 1 Turtlestar 1 Tsuboniwa 10 Umelcuv 20 souosé 1 TERRATEN 2 Tiikeri 1 tylní 1 subpleurálních 23 umbrosa 1 Stochovu 2 Taragon 1 standartních 2 Tramontane 104 Timrĺ 32 Uprising 3 Suchomastský 2 Teslic 1 Úpad 233 stredoškolské 2 stromolezecké 1 Suessiaceae 1 Strítežského 1 Turgajský 24 Tzara 1 Stígarnir 17 vážením 8 spectabile 1 ukroutit 22 spišského 1 Strasz 105 trojlistá 1 Ulesie 2 subharmonické 3 Vespasianovy 3 Taniu 2 Šúei 134 Svobodného 1 tagjai 1 Upadneme 2 Sout 1 válovým 1 tabparam 11 Tarbíci 1 velkosériový 1 Varenny 1 Tammalahti 1 Stankovová 118 Turistický 3 Svahový 1 Unierzyska 1 Stockholmští 1 s laloky 1 tachodynamo 2 Svrchované 1 Temperer 40 Taba 19 Tola 20 Threading 1 thionylchlorid 162 stisknutí 1 vetevnatí 3 Telekompanija 1 Theilera 16 stratigrafický 1 tongerenský 1 tarydium 1 tádžictinou 4 Štenglem 11 Uzavrenost 1 Tvorihrází 3 stornovat 2 submarinní 1 Trnovcová 19 spoutá 1 Umhlangany 1 staroknínský 282 stavena 1 Tangutové 1 stery 1 sünnivad 1 tughlakovského 2 trímotorovými 135 usadily 1 Stredoseverní 4 Uhlaender 1 Studienhofstelle 4 trojrade 1 topali 1 stredoproudovost 12 tísnilo 1 Triodanis 2 strobilace 1 Szentgotthard 6 ukazka 1 Traumatocampa 1 technigluonu 1 Thoomkuzhy 1 Spartyunaja 1 Tríválec 3 tlacítkový 1 Súcast 1 Sunnonia 4 Štekr 1 stadardu 1 Topolny 2 Svaige 33 Sturmgeschütz 4 UNAMID 3 Streichorchester 2 Umov 84 Tkanina 2 sulfokyanatan 1 Subwar 1 Talestris 6 Utrera 17 Tekutý 1 ucitelováním 1 tvejch 1 Uštkne 1 Vernonova 93 Thai 1 Treschitz 1 Talyna 1 spolehlo 35 SPT 1 TextLink 54 Tausch 4 Thate 1357 težba 10 tympánu 1 Stereospecifickou 24 Tarapacá 1 svoradovcanu 5 Vešák 2 VertIn 1 š?????? 27 tluste 1 uroporfyrinogendekarboxylasy 2 Stromokocúr 1 Szynder 1 trojciferných 1 Thorwaldsena 1 tuttáré 1 uprednostnovanou 1 Tagová 19 spolukrál 3 sozialer 3 Tenpaku 45 symbolismem 3 strelené 9 speleologických 1 trojkolejný 5 s temito 2 Tayla 2 tuží 1 strcení 1 vedmin 1 veršyn 3 Thouless 4 uan 1 Tobora 3 Svatavin 1 vejewe 2 Vanzy 1 Stolit 1 Varaminu 1 vetri 1 ulicnicky 3 umrtvením 1 Spontiniove 1 Versed 1 Texturou 4 stejnorodost 7502 velkých 2 Veithova 13 toroid 1 Stihnov 2 Vejríka 1 souper 2 stežujícím 12 Tuzman 15 Úhercice 1 súdená 2 Tarasteix 3 Tlustici 1 Szifrón 26 Tenacious 2 vergibt… 1 Tadeášuv 6 Šubertem 1 Tunegových 2 Vehemence 10 Tvrdošíne 2 Tadžura 1 Spanian 3 UnrealEd 1 spívá 1 turboodsávacem 1 Triplandenia 1 ucestnicil 1 usedavým 1 teritorij 1 strocka 28 spolecníkum 4 STUDIUM 5 troodontidae 321 Tripolisu 1 Trzeszczkowska 1 Stawicka 4 Usnadnil 3 Veltšmíd 1 vešken 1 SpielePreis 1 tawsit 17 svírat 5 usmernované 1 tovarne 2 staropaleolitické 1 trinidadská 7 svini 1 tucekweb 1 studentischer 1 tricetpettisíc 4 Uralistika 1 Velkolosinsku 1 usmály 719 Tyrolsko 3 Stanfordovou 1 Šporkovský 1 s žádnými 1 ublížíme 1 spocteným 4 Vardalos 9 tholos 13 stabilnejším 13 Tren 20 ÚSP 5 Šoupal 1 Varronovi 2 Valami 2 Spruch 1 Utsumikazuhiko 1 velikolepé 13 Strážnická 1 Tudeski 1 Varleyho 2 úrazovosti 1 Utren 8 svojho 5 Southwell 3 Spojkou 3 uprednostneno 2 stereoizomerie 3 Theofylakt 1 Spellingová 7 tchanga 7 Tyckar 1 Urease 7 Swangard 1 Sprowston 1 Stesichora 1 trevigintilión 1 Tósenovi 8 Sulfoxidy 4 templárští 11 Srbova 1 Sundevil 1 Turrachu 55 trichomy 2 Srdénkovou 31 tónovaná 1 trettonde 1 spraye 1 špaldové 1 Starna 1 Toomasem 1 Stenersenmuseet 1 spinuliferum 19 terciérní 1 strcením 9 Starodvorské 5 Spojbusu 1 Typhoonem 1 tympan 9 Swigert 1 štepinkové 2 Tihanyovský 1 Ulanova 53 Vereins 1 Umspannwerk 2 vanilinem 6 Umístené 3 Treuberg 1 trojlísku 3 Strmole 1 Spoznávanie 1 tabemasen 11 synsetu 3 Thyreotropní 1 Ubrykové 1 valencijštinou 1071 uzel 1 Tulanském 7 Sportforum 1 Štáralová 2 Souvans 2 Talevski 1 ubechuv 2 Striplight 2 Stredolitevskou 3 Tratzberg 1 uddu 1 Téckove 3 Venosy 28 tykvovité 2 sponzonech 1 Velíškové 53 Tisové 8 spojari 1 startlist 1 Varjažskou 1 venezolano 1 štávicky 5 Stalemate 4 Uglici 152 Spocka 1 Trójankami 1 Vertlovky 2 Starlancer 1 Toisón 10 universitním 1 Stubenvollovou 32 svetelnosti 3 Supino 1 Tetrazin 1 Stecyk 2 Teleš 1 Tongánští 3 Štolbova 1 Tägerig 1 Tipps 1 Terénem 142 torpédové 1 sparringpartner 17 Torez 1 Trundlem 1 Tanierika 1 vernacular 1 Valandilovi 3 Stenagostus 12 Tabard 1 Twistor 1 Strengelbach 1 Uvézt 1 Vábnicka 6 Spoluúcast 1 Thermianum 2 Vauselles 22 Stuchelová 1 superzakázky 1 veneziana 1 událi 1 Tentenierové 5 stozec 2 Sulzbašská 2 Symphonicities 3 tositumomab 4 Varmint 1 tÁth 1 Špinarova 1 Utrhnout 3 vermis 1 synergogika 1 sziklák 9 teamu 1 Tranys 3 terminated 1 svrcka 1 Tropika 1 umyvadýlka 1 VARCL 6 Vejhybka 2 Swierczewského 7 Varlichové 1 submykénský 5 Stadtschreiber 16 Strížek 39 Úpsko 3 Vahr 16 vcelína 1 Tibetiana 1 Švarcer 1 uže 6 Ulubiona 1 Toszku 1 Subroc 28 Strídají 8 transkripty 4 súdánští 1 Štaudinger 120 ukryli 3 Szentpétery 4 umoudrilo 1 Suraiprasad 1 Vettes 2 spotrebováváme 1 Strauss… 1 svatootcovské 1 Starhemberkové 1 uiné 1 SURFboard 2 Strübin 6 trnavští 1 sprosty 27 Superbike 16 uzbeckých 2 Urríes 1 ursulae 3 vencovka 1 Suhlem 23 strídy 1 trojdoteky 4 telegrafistu 1 Vanžurová 1 Urubambské 15 transhumanismus 1 tieus 1 Storfosna 1 Sudamerikas 2 teleologickým 6 tend 1 Touhami 3 Súlimo 1 trasologických 37 Thrane 2 suknickárský 1 Svibor 1 Vanhemmat 10 UCM 3 Steingaden 4 spikla 1 Stavejte 2 Tahirou 2 tyrozinových 2 svatojanských 9 Telemnar 3 Stillwateru 6 Šterbuv 2 Vendulce 9 Tychách 1 thanatologie 1 Uparisína 6 štolový 1 tremandra 2 veleslavínský 2 terakotového 2 Strihovská 3 Todorovou 1 Tukcin 1 stríbrníky 1 Urbachem 1 Vadovicko 1 Unvermeidliche 3 Upninkai 1 sviecok 1 verzovaným 1 Terasie 112 težkosti 729 utkal 5 uprosit 1 TempleThéâtre 1 Uxbal 1 trezírovacím 13 Taiji 1 Svatonovický 1 Speyeren 4 Tóga 329 typickými 7 Trojkrídlá 3 uechtritziana 1 Tigernach 5 užasli 1 Tropicis 12 Suffocation 1 Tapussa 1 Tpy? 1 Trabzonská 1 Thajcum 2 stabili 9 stinný 1 UNIRAF 1 strednezobým 3 stropum 1 Sovetakan 1 unne 1 sprengschaechte 1 Tiergartentunel 1 Varmy 2 Strítec 75 Španelština 4 topora 1 Sulovsky 2 Stejšt 1 Spodnejší 2 Tuen 8 Stálkách 2 Steinbuks 2 Tärkma 3 vdavekchtivých 15 varecka 12 toporivých 1 Torgilssona 1 trpaslícci 1 stríhaným 2 Traineauem 1 ursinovský 22 stoupajících 15 stácející 1 Vedderovi 1 Ustrine 2 Sušilovo 82 únoscu 40 umývání 5 starobincu 6 štavelu 5 Ústy 1 Taberym 1 ustrnut 2 Tlupí 2 Sýkavka 1 trepotaly 5 Tanzini 3 Untertauern 1 vencelíkovcu 1 Tekameli 1 tuletőrjemuuseum 6 Termínovaný 1 vetrání… 17 Stodoly 3 Vendrynské 9 Torjú 1 Trbuhovica 2 tryskacího 1 tiglitt 1 Šuar 1 Troudem 22 strukturálními 11 veršovou 1 svaroven 5 sponzorováním 1 tešínitu 5 Veselynivka 8 Súdání 1 Švede 2 starki 9 telocvicnami 1 štamprli 1 varjot 1 styloblaty 2 Talavery 1 Stoictí 12 Trojkoalice 3 Svésedlic 3 Valteruv 1 Trenchcoat 1 Tschörch 1 Spiritualnatural 4 Tríkrálových 1 Tavarnamezo 7 trhaných 1 Tradus 1 tleilaxnaských 2 Vaselina 7 srdcovce 21 stydkou 3 Tokarský 2 stavecími 1 Ummuna 241 Tiso 1 Tyrrhenum 86 trvanlivosti 1 Uhrineves 32 Tedder 2 Štikoun 4 Svištící 3 Trhovec 1 Uqlidisi 1 turby 4 Ujest 2 trucovat 1 Trasírka 6 Šustou 2 Tišinu 2 Thirasia 1 štatistického 1 Triveneta 1 Spravodaj 1 Tasteho 1 Tamunoibiton 3 Twenties 11 Tallien 1 tríslovinová 10 Tkadlíka 1 Svedínek 1 Vaitiekunai 3 Tyssa 1 spoluarchitektu 1 Step?anakert 1 Theresianumu 1 Taschenbuchausgabe 2 sukcinylkoenzymu 4 svazeckovými 5 tame 3 Tago 1 Studtit 3 trímesícnímu 5 stríbritému 1 Tadeášová 2 Tafelmeier 1 tucnolisté 4 STMS 1 Stanojevice 1 Trenckových 3 Tyche 5 tenet 1 Unternußdorf 1 SRPNA 4 úskoku 1 Utes 59 Ss 1 tvárnému 32 svornost 1 Umána 1 Stechau 1 supertribus 1 Thubpa 1 težbe 2 Spinicaudata 1 TeleUspory 24 Spartanum 4 splítková 1 Turgenevského 1 stepare 2 Unipessoal 2 Tompall 11 stavebnicové 2 Studnickovou 1 védantové 1 Tajfúr 1 subcaprea 1 ventalina 5 sprchovým 155 statických 3 Stolek 2 Thoada 2 Torngat 9 stavkirke 1 transferovány 1 Tieleští 2 Updikeovo 2 Verwandte 1 Stemony 35 spojnic 3 trifidum 1 UPA 4 Utrechtem 223 tlaková 2 Vener 2 TICH 63 Vendryne 2 Stankevicem 8 UNASOG 1 Sproulesovi 1 Týrští 1 Tvaružky 12 totálních 1 svellermi 3 univerzalistických 4 Värmlands 1 sulfa 1 Trzebautitz 1 sprech 4 Studijním 3 uklánející 541 Thor 7 titanový 1 usnadnováno 1 Territetu 1 Ukrýt 8 Thelxinoe 1 Valtem 33 uvalené 1 spája 132 ultrafialového 4 uprchnutí 1 verdelho 1 tracheostomickou 1 Vargfjeldet 1 tamizdatovém 2 Steinochera 2 Tekstilkent 1 suizen 10 veleben 33 tvarován 121 stredními 17 vegetariánkou 1 upouštecí 1 Tacariguas 1 Velmou 1 stoikum 1 Suwandi 1 Vanessiová 5 stolarské 1 Userkaf 4 studovnami 1 Velíšská 1 svjatyj 6 Stojmír 3 Velenického 1 Stolzmütz 2 turkmenském 1 tauri 12 Ujgurská 33 Vallier 2 vardarské 3 Stavovou 1 Untutored 1 tetrajodomednatan 1 Talevska 1 Turon 6 Szackým 1 Tucsonem 398 tvorení 2 vendéen 1 Tedjakusuma 1 Sperlingbergu 1 Sovadinová 77 Strawbs 1 Technoplyn 1 Staccatem 1 Vágsütörtök 1 staszowski 1 Strihvka 1 veneer 2 Tabeira 1 Sumquayit 277 Vajícka 1 usmerníme 6 sprška 12 Taufík 23 stracka 12 uldským 1 Subleyrase 1 Torcuatem 3 stemmingu 1 verdotu 6 Tukani 1 stredovelšským 66 Symbolika 5 veštkyn 1 SPMP 2 úmístení 1 Thiersheima 1 Vensutis 2 Underbergu 195 velmistrem 1 subaerické 2 stelárním 3 Tampotisk 46 Src 25 Tropy 1 tmut 1 Ultricularia 227 spojilo 1 trvalejšími 39 Tatហ1 tsinime 5 Topicová 1 Theaudience 6 Šupich 5 Ujgursko 2 tetena 1 superum 1 vedychtivého 2 TenNapel 23 Vettori 1 sullivani 7 Sverkerové 1 Vesicae 2 Tanglewoodským 1 trojpšenice 1 TORA 1 Tachlovický 1 tolnánské 1 Variotronic 1 stellingmolen 1 Tvárená 5 Tasnadi 4 Tiburu 1 Trolltunga 31 ucnovská 4 Uzavreme 17 Stepancminda 10 Stejskalovi 3 Vecka 4 užitkove 4 svetlezelených 1 Sztraka 37 Tooth 1 Svankova 2 Suliné 13 Tägtgren 3 Thomyris 411 Sweet 1 tetryl 1 Szentmiklós 1 štítinského 1 Uvarí 3 Thongsuková 15 valut 1 Spilbergena 1 úoru 1 Unechte 1 Stichianthus 3 Tanqueray 2 spintronika 1 Switchblades 1 uveru 229 strevo 4 spríseženstvu 16 Vartenberk 1 Tysso 2 Valvidia 1 vetrackami 1 Súilleabháin 1 stratoidní 3 Tiahuanaca 2 Stanišovských 1 Vermondo 3 Ungváriho 1 taborem 2 Trattenbach 1 universalistický 1 úsobrnské 1 tulun 1 Tjřrstad 1 Svetloplaši 2 Tabachniková 2 Tlachapouda 1 tengwu 1 Verdia 11 Unn 1 Svenskans 2 TZi 3 Tytti 1 vejár 2 Speciálnevýchovné 1 Takedove 1 Velniem 3 Valgay 8 Tatarština 2 stácírnách 859 Tower 1 Swefende 1 Stravují 1 ther 4 Spannbrucker 5 stvrzenka 2 taschenbuch 1 Tirúa 1 Unspunnenfest 1 Urychová 1 Štercová 1 s delníky 1 Trymalium 80 USNS 3 spadixu 287 univerzitního 1 Stadtprozelten 22 syriacus 5 Stralczynského 1 THÚKYDIDÉS 11 Súca 3 theravádových 2 valtinovském 2 Štarcary 1 tremadoku 5 uial 3 vandráci 24 SUS 96 vedám 3 Vcházení 1 Standarda 1 terroristen 7 Torroba 6 štekavé 2 Versols 1 tchyna 1 tóxico 1 Vellová 1 Tužinky 1 Vaasovi 2 Stupina 15 Tsang 24 Telnici 2 Tourcoingu 11 tamilštine 2 Terronská 3 vejdete 7 Tchajwanského 1 Svjatoslavu 2 Ubie 8 spícímu 1 Týda 150 uhradit 4 Tetraethylolovo 1 trístopý 3 titulkové 2 sowulo 7 Tomovu 1 szyk 2 Thrawnove 1 thymových 4 Sphaerotheca 5 starokatolíku 3 strejdy 132 studiovém 1 Svanda 121 stech 1 Tourmakeady 627 uživatelské 91 suti 1 Ultraligeros 9 Veltežská 16 Varatchaya 1 termotisk 3 Tricka 2 Tecku 1 ti'jjin 2 variabilností 1 tvárickami 7 uvázne 1 Thieracka 2 Tunkinského 2 Tomanovo 4 údržbárská 1 Uštebe 1 Sportprojekt 16 stolními 4 vejicku 8 Srostlé 2 Venelles 1 Ursynowie 1 Vallhaly 1 Supplinburskému 1 toulouseském 2 Tasikmalaya 1 Staviská 1 Šubertovi 3 Turambarovi 21 Vdechování 1 Veronští 13 svedených 2 Vesná 1 Uhladený 3 Šuriken 1 thomsonit 1 susohiki 6 Tazenda 1 synkrecí 1 Trebusic 2 tribologická 8 STANEK 2 suarezensis 1 várból 9 Taguchi 1 vallásos 1 Thalassiosiraceae 1 takvané 2 Stommelenem 2 tlouštce 32 staroceštine 1 Stegastes 3 Tretjakovská 1 Ukládaly 2 taškárem 2 Tuonely 1 studnicním 1 Umocnením 1 Valentinského 1 Titanotheria 3 Tornyiszentmiklós 8 spolec 1 Täkulaid 1 tremolove 1 Tripplin 2 teplákovou 15 Tass 1 Vampíru 1 unavilo 4 Ticky 1 Steagall 3 talírovka 5 TIL 1 sršnem 1 Sputniková 1 Tedaniidae 1 Unoedicteble 4 Úprk 1 Stríteckého 1 suandes 2 tiento 2 Theobalduv 6 Torger 1 TELO 1 synchrotronu 13 Stoprocentní 16 uzmul 1 štajf 2 Ultraworld 1 Tuparow 3 Šrejnarovského 2 spojlerem 14 Tonelli 1 Urciteji 1 Tibetskému 1 Temteken 28 Traugott 19 spolknutí 1 Theátre 1 šterkovitém 1 srušenog 12 Talat 10 textarky 2 tloušti 1 s viceprezidentem 45 Srebotnikovou 2 Vagrants 1 sultani 2 Veseláku 2 svetový 1 tasinarioi 2 succesosde 1 Teude 4 studiove 149 Verejne 48 textilii 1 Supigisdorf 8 Stožeckou 5 Stuarda 1 tranvía 1 starzach 2 Spadalo 2 Štefkovou 1 Unescem 1 suill 1 Umstellen 6 uvala 1 steeldrum 1 svetafór 30 Suvretta 2 spanilého 1 Tištenou 336 Tah 1 Tugberg 8 tchčques 1 unalaschcensis 1 Ted 1 strojníctví 19 Vélib 2 typicnost 28 Uvský 3 Tundavala 2 teatteri 1 tisíc polských 3 varjažsko 1 Tranlohr 6 Stanescu 1 Spinosis 2 uhlazovat 41 Tradici 1 subbuteó 4 valeným 1 subsekretáre 1 supertinteligence 2 Überschreitung 30 Vallo 4 Toguzov 6 úzkonosým 2 Unissued 28 unus 3 tríjehlicné 4 Tragikomické 1 Tillota 1 Tactic 1 Sperm… 1 termohydrografu 1 valencijští 12 Sympieza 2 Svedená 1 Surgutneftegazu 2 Symbolictí 5 vedutami 2 studlov 2 Uintaterium 3 Unesené 1 Verendrye 2 systolu 3 Stonka 1 Válecno 4 Sychrovu 1 S vetšinou 4 Srdícka 2 tmavocerná 1 ufology 548 sprintu 5 Tohisoo 1 Squamarina 88 verohodne 2 stylizátor 2 Tonkinskému 1 Szirmayovcu 1 Terstané 3 Tchamba 1 spolusponzoroval 1 steadicamista 3 Tardar 1 Triebfahrzeug 6 Tyrozinkinázy 21 Vars 61 spoluautorství 3 Šteticka 3 svera 1 tešitelkám 7 ukotvenou 1 tchanán 318 Urbana 2 Tahkuna 28 TDKIV 1 twinem 1 Triarylmethanové 1 Statesmen 4 Svinar 1 Vestislav 18 vedeckofantastického 1 Standerlova 1 uštepacnost 6 termoluminiscencní 3 tiel 1 težery 1 valciri 1 Spinnerette 1 tvij 1 s Realem 1 tvorbaInspirace 1 Sulmony 5 troyeská 3 Suchumské 1 teleshopingu 1 Telekonzultace 17 Štamgast 3 suspectum 1 Tells 1 thiamini 2 velkodolu 2 SZTK 7 tradováno 1 vecmi… 2 Tudose 3 Špicberská 1 usouvztažnovacím 1 Sutulovich 1 udelováná 9 svlékáních 1 Vapnarka 1 Stettine 1 usmírena 5 Sullovu 4 Toška 3 Utari 1 Tradidizione 1 TUŽBA 52 Staška 2 uTorrent 1 Toph 12 tellurium 4 Takadžó 1 valovského 1 tijunas 7 stlacovány 3 tatam 1 stahovaného 15 strelka 1 Urv 1 tripreporty 3 teplokrevného 1 Umsetzkästen 4 suvenýru 2 težarem 3 talmudského 2 Thervay 56 sprašových 79 TSG 1 szynobus 1 trojúhelníkovitému 177 Stadler 2 úcastniti 2 triodion 22 Úsova 2 Svitalský 2 Tyrnach 1 Svébytná 1 tangsudo 8 uchytili 10 unikátum 2 Tethyshadros 1 Vektorovému 10 Taher 37 Starkiller 47 Studiový 9 úplavu 1 uruckých 3 sowa 256 unikla 1 Úveru 1 Udušení 1 Theilhaber 1 Tungal 1 umilujou 1 stampi 602 stavitelství 4 únavný 13 vesmírní 1 urinoterapii 1 Štýlové 1 Svébytnost 2 venkoncem 3 Svojtky 2 trojclenkou 1 stendalská 1 Verghé 1 Swatém 3 Stennes 1 václavku 3 Tržaška 1 Tríhlavého 158 uveznil 1 Specsavers 3 Štofíra 4 válcovitému 2 Vaalserbergu 1 Stevebaker 1 VCh 206 Srovnání 3 uskupených 4 úplatkárskou 1 Tanten 1 Svodidlo 1 Tanejamagahara 1 Stoßtrupp 1 uspeju 1 torpédborce 1 Täfelchen 2 Turkutech 2 Trnoploutví 28 Tornáda 1 Telmarani 7 Usne 3 tríkolkou 1 TerezínCrematorium 2 ڞasnou 5 upnutými 3 Tofukuji 2 temporary 1 Veleciku 1 Svazkem 36 ÚZSI 1 Todtenhaupt 1 totusende 5 uklízeci 1 Torjanik 1 touny 1 Tejady 1 tripelata 3 Upecené 1 táimid 27 uzavírky 7 Sporným 11 uchránení 1 spalicky 8 Suppého 1 Verezanantsoro 182 Úvahy 2 Tajnasári 1 Tumbukctina 1 Tinchen 28 Splnení 3 spenková 4 Špátové 3 ubezpecila 26 tempus 1 Tatň 5 Variantami 1 veltrhu 1 subcrotillus 2 Timar 1 tutt 1 Svatomorického 1 turbiditním 2 ßa 2 Ventimiglie 11 únikovým 2 Symtech 2 TAMU 1 s potravinami 3 taek 1 tunguzskými 1 Transfagarašan 1 TONCUR 1 Termoanemometr 7 úzkostnost 1 topédového 2 Stebark 14 tahanic 2 Urli 219 Svetozor 1 Spahlinger 2 Titanosauroidea 1 Tairum 9 terror 8 stvrdí 1 Strossova 4 Špýchary 2 Vádím 1 Sumnikovová 1 táboritovi 5 Vaukavysk 2 ultrahlubokých 5 tienem 126 Tiago 2 ústrel 3 usedlejšímu 8 TVŠ 37 svázal 2 Tobbyho 1 subglaciálního 2 Toriibaty 1 Valestrand 1 Toces 1086 terén 1 Strömungsmaschinenbau 1 Štiavnickou 10 státníkum 10 Valchárová 2 ujetým 1 taenidiemi 1 Trefaldwyn 1 supt 16 ugrofinského 9 traverzem 3 Sur 1 troúhelníkovým 1 Trikanasana 2 Valonia 1 Tripitakou 3 trígeneracní 9 Uwais 2 trojfunkcního 2 Ubce 1 strížkovskými 1 Teyber 3 Starnberském 4 špuntu 1 Sovjet 88 Tucnák 1 Symmese 1 uverejnovaná 1 suonando 1 Trachycephalus 2 Spasojevic 1 Tersánszky 1 vallhunda 1 Spörning 1 Ussuriském 3 Szegedin 274 Tlak 1 SpZZ 1 StankovCestaDoRakous 4 Terathopius 4 sukup 1 Tienhaara 1 umístitelnému 1 Tanczacy 1 Symforiana 11 Tubbs 1 Tórshavnské 1 Ultramylonit 1 Tubernátora 12 Uražený 3 triceticlenného 3 ukraj 5 syrii 2 trýzniteli 1 Tepperovou 3 tankerum 1 Taufoou 3 Tietę 1 Tittemont 1 useruploads 1 traceurovi 2 Ulfstjerna 1 strina 3 tamtud 12 Terminologická 7 Spojivka 24 srpnovou 1 tonás 35 spektrometry 1 Spiellokomotive 2 Ukradena 2 velkolitevský 1 Trubacík 1 Soustredovaly 1 travertinoví 58 trináctá 1 troupe 1 tolarum 2 užitecném 506 srbského 23 Trel 1 Terrington 773 Vatikán 1 specmat 1 Surnâmé 3 Velociovité 2 stájová 1 Vcítení 1 stupidního 4 Verta 1 TIPPELT 5 súdiech 2 Tadday 1 Taragaje 39 Turbíny 1 Teoretictejší 4 Tonstudio 2 svítidlum 1 vážením 1 vdaný 1 s inzerováním 13 Turnajová 11 taktickému 1 stoptlak 1 Treas 1 Udíren 1 Verlegung 1 Soutzos 1 svinutím 1 Sturmarech 66 velikánu 1 Subprogramy 2 veslovitých 1 velkoprofilovou 3 tchadensis 1 sumana 1 vedun 1 UPCASE 12 splývavé 3 Trölitzsch 6 suspendované 5 tancíren 6 stvoríš 6 UEM 28 tribuni 1 Varberg 3 Udiny 5 válec 15 ukousne 1 tarditatem 294 Šumperku 15 Svatogothardská 1 ústredne 1 ttö 1 Sudeková 1 udržujícími 1 Tabunne 6 Urzica 6 ucaruje 29 srdcovka 1 Tillemont 4 Ticketmaster 1 Tauberou 1 terazniejsi 2 Vajerij 370 Studené 15 Stew 2 Tintinovým 8 Sporic 1 sulfoaldehydová 1 Tigersharku 12 Ustilago 2 ušlápnutý 1 staríku 2 upjatému 1 Synkovou 1 veramente 73 uomo 2 Uzavrely 1 Ududaja 4 variables 1 Tubingenu 13 stážistu 3 stresován 4 Stoer 3 Velislavove 1 Vangelista 1 úlibického 1 stopetatricátý 1 temperaturami 1 vertoond 1 Vetrovskou 1 s pitbulem 4 Svídna 18 Svatonice 1 Veselovskym 2 TPR 1 Tarsitano 3 Tisdel 17 topzine 2 Trémeur 4 UNIXu 1 Strausberger 1 Staropaleolitická 1 tenisz 16 Stellerova 14 Telecomu 2 Stonavská 2 tychlostních 1 trsíchna 1 syn? 75 Sture 2 sumicku 1 Strohnaier 15 Valta 1 strednesilnou 5 tahara 1 Vašírovem 1 uńj 108 Správne 1 transglykosidáz 1 transsexualní 3 Trumpera 1 teteks 1 Ukolébání 1 trisacharidu 1 Staatzeru 1 SPŽZ 1 Strassenfest 3 stojích 2 Suski 1 termosolování 1 Tachmina 109 Standardne 1 Ueberlandgrund 1 üz?rind? 1 trekcore 1 toxikotolerantní 6 Tanakuv 15 starokatolickou 2 Stadický 8 trank 1 štampe 15 ustanovován 1 Testaferata 9 úlitbu 3 svijanskému 5 stísnenému 12 Špagin 10 Toplij 4 Štolbová 1 Verböczyova 227 stárím 1 svítiliny 2 Telegrafista 1 Trisetaria 1005 Ulrich 16 Trismegista 1 Theonistus 1 Usb 115 Stonky 3 vespilloides 1 Sübutejem 1 Turitg 1 TRIKO 1 sutajských 34 stejnosmernou 2 Stewball 2 svrženými 1 spectrumbrands 3 Utgren 1 UtiliCorp 1 Suppo 518 uzavrených 1 Tropková 2 Syracuské 1 submilimetrovou 1 stádovite 29 Uladzimir 11 stramonium 1 Sydneyi 1 Švarcvald 1 vedecteji 1 trojrozvodí 36 trojských 2 Statuens 631 uvažovalo 1 Valeriánus 1 Timun 1 Valongo 7 terestrickým 1 úžasnejším 49 Tepelné 1 Stupescentes 1 Troubaduren 1 Tulpou 1 stvrzujícího 1 Tschernicium 2 Totenkopfstandarte 1 TORC 24 strevními 1 Uniatští 1 Vdejte 3 Tošimasa 4 vaskularizace 2 Stiborík 33 Toxické 1 Uchwala 1 sýrovo 1 stupiditou 2 Tayassu 1 Stržatka 1 splachovacích 1 Vedalai 1 Újszalonta 1 vestalinnen 1 starovéké 1 túžbami 1 Tochovicium 2 upevnovaná 6 tetraploidních 248 suchu 3 Stupecký 1 Thieriotem 36 svarena 1 Svarová 1 Stratowa 1 Taovu 1 Tamír 6 Tefnacht 1 sverenecká 3 ustrnou 1 stopetactyricátý 1 tlacic 1 Spielboden 1 Tymichová 1 starakremnicka 2 Supersours 1 UCCIFE 16 Veselícku 1 ÚHUL 9 Vägen 1 Unleash 1 Tužby 2 Tabernaemontana 1 tisícpetsetkrát 2 Študentka 1 Stabusch 2 Tuhou 2 Tintet 1 Thovtovým 1 Sznuk 2 uvozovku 3 tady… 1 špejlování 12 úvazkem 1 šumadijského 8 Umtiti 1 Vágbánya 1 tabemašita 1 Vergusu 1 Spojenectvo 23 Svoradov 2 Stalinogród 1 spinocerebelárních 2 soustrastné 6 Strážovskými 8 technu 2 Spenceho 1 Tulca 1 Tuwangste 9 vej 11 textilku 1 statuum 1 Verzug 1 Stjärnström 2 utáborená 1 Theoprasthus 1 štavel 1 toegelicht 2 Szelazek 1 Tinnef 1 svazvojenskychveteranucr 1 Vasconum 1 svarována 1 Tejkeš 7 trojlistu 4 Transzendenz 5 Sparwasser 1 Sůtč 1 Varparanta 1 Staubovy 5 SÚA 1 Tisíciletých 1 uskoceno 1 Stonuv 4 trativod 2 Tušitelé 1 speciálníku 1 VALCHÁROVÁ 54 svetoznámá 14 Tythonu 1 Szuzanyánk 8 velehradském 1 talloos 372 trasou 1 tlumicími 1 travníkem 1 srázná 3 spolknut 1 Togotoviry 1 stropdrager 2 Taifalové 2 Valkeric 2 tužšími 5 sundského 1 Sturla Gunnarsson 7 tufem 1 Thomasinem 1 Suyuf 2 Suvou 3 Topes 1 Tawadros 18 umelcovu 2 synthpopem 7 urputná 1 Valašinskas 7 venandi 2 typovaná 1 stredotlakými 1 upnuly 7 Svinenský 3 Sýslur 1 Týniným 1 Strieder 1 sphenethmoid 42 šuplíku 2 spatrovati 1 Taxisovského 11 Thermae 1 Ubasti 5 ubránen 6 Usue 1 Stetsonl 6 spoluprožití 17 treslicovitá 2 SuperAllsvenskan 1 Superbalic 1 standartum 1 Varnickovi 930 spolecenský 1 styku ci 5 Trägera 1 Techcnická 15 Štecha 8 strych 1 Tamakai 1 Teplicou 4 srncat 1 Sulkové 2 tenerum 2 Stürzenhofer 97 Stromovka 1 Telocvicna 3 spotrebováváno 2 Tamša 1 Teboho 1 utenfor 1 vendéeském 1 Turího 2 Sureshe 5 suchdolského 5 stojato 1 Tamilnád 126 svazových 10 ubrusem 3 Tapir 2 supinaci 2 Velkookovití 1 Trzesstcze 1 stáých 8 Turovce 1 Spotsylvanského 2 Sparassidaceae 8 stojek 1 tritónové 12 svéhlavý 1 uríském 1 vášní… 1 SubVirt 15 Svito 38 Teje 1 tuahskou 1 Traclovou 1 SPraem 1 uvazem 1 toxikinetiku 6 trípalcový 1 s vedlejší 6 Spolumajitel 3 Uthaug 2 staroslovanskému 1 štítenky 1 Trägerin 2 vdavekschopnou 1 speciálné 1 SQLNT 5 tsoa 69 teologickým 1 stríbreodení 101 Uli 116 Štrbák 3 tecktonik 2 Trpenovic 1 toboggan 9 Velíková 1 Vép 7 Vašík 2 Trinil 30 Spása 2 Valentinka 2 stehujících 7 Suđur 1 Stereos 1 Tenkacu 40 úderech 1 tauonovým 1 Szápáry 1 Stanukovice 1 trásnová 1 Streamu 1 transmogrifikace 1 Tlacani 1 turuentelen 1 truvéra 2 Štefana 1 Unterkunft 1 Tasemnici 4 Tucholkeová 7 Stabilním 1 venarum 7 vábením 2 spinningem 1 timestampu 25 Šunka 3 Vasseny 1 Submontánní 1 transciever 3 Tenorista 1 Usipetové 21 usnadnoval 2 Šovalem 1 srodkowych 11 Tragikomedie 1 Tanzmetal 45 Tv 3 Vendola 2 terichem 3 Ustja 1 TOTP 150 Strašice 1 subadelaidae 3 stríbrnatý 1 Úhlem 1 Tsurenko 12 Trefilov 3 symone 1 tetrapodomorpha 1 Suchardové 3 Springerová 2 truhlícku 33 Textilien 2 Thomer 1 Srbskokamenický 4 tkanicí 12 Thijsje 6 telepatií 5 traganum 1 TRANSTEMPO 1 Vahtsőliina 6 tunelováním 15 UBT 1 Vettery 3 specializovane 1 Terminate 1 ukonceni 135 ultraortodoxní 113 Stephane 1 stejním 3 Tlupu 1 trakcích 1 sphenops 2 Vazíry 3 Tadd 34 strídány 4 Svácka 2 utlacené 1 Szumowo 65 vápencového 8 stakeholder 3 Sziglová 29 Titel 1 Stepononiu 1 troglitazon 1 urychlovaném 6 Stauntona 11 tantrický 1 Unterlass 5 varjažská 36 tennis 49 tinu 2 urum 1 ThBc 11 Starozagorská 18 Štengl 4 stravagante 6 strízlivém 12 suna 5 Švibov 1 Terakowska 2 Suzzara 1 Valensina 1 trallský 3 Vallentigny 1 Staroslávuv 1 stahovania 3 tmavošedých 1 triplehelix 2 verteller 1 Tomohira 7 Utile 1 vasily 126 svázané 1 Triftgletscher 17 Sulejmanem 1 Tarannonove 8 stupnováním 1 Štítonoš 2 Uhlan 1 transvestivního 2 ulámaných 1 Vadurou 2 Turpentine 3 Tystnaden 17 starodávnou 1 Syrec 58 Sudan 4 Sparafeld 1 subtendinea 4 sponzorovaném 673 Square 1 thiofuran 1 Tarron 21 velkovýroby 4 Tischlerova 1 sphynxe 10 Templera 1 Starzynského 33 storyline 1 Tosudit 20 tykvovitých 8 Splay 3 Starbag 1 Stavroginová 1 Unidram 1 tääbbin 29 Tilšer 1 Tatzenkatze 3 suplovaly 40 užitnou 3 Tenmovi 3 USRC 14 tobolkách 1 Taxatoren 1 Tvaskuciai 1 Stanislawska 1 vazními 4 Tourreilles 2 Vallentune 1 Ulpianovi 1 Sprawski 28 strídmost 1 syrupem 1 urediniospory 1 Valgrisio 22 spraženými 3 Stockingera 60 utatý 8 Tetrabutylcín 25 strenky 160 Sovetu 6 Strupcicích 7 Udolfa 1 Topographisch 1 Uttarákhandu? 1 vesel 95 stávat 1 splozenci 20 tmaví 1 sypka 1 suweldo 4 velkorážných 2 SPJP 4 Terpandros 1 utrídené 3 Varšavských 1 s vaky 1 Timirjazevovo 5 thetopforward 31 ústum 2 synephrin 1 ŠOUŠA 1 týranské 1 talbija 12 Válcovna 2 tresknutí 1 Tesserakt 1 Telefotografie 1 u hypokalcémie 1 telford 2 státnebezpecnostní 1 Tül?küvan 1 vermikutu 13 Trask 1 Supersister 1 stejnobarvé 56 vepre 29 úcesem 1 ukájí 41 tatarština 1 Stadský 1 Tegmarkovu 1 spadnúti 1 TeleKom 4 Terman 1 tornjaci 5 Tikse 1 vepríkove 1 strímry 56 Stromovce 1 správceem 3 Symbolisme 1 Tsva 1 strevícníkem 2 Tumplac 2 stimulanciem 2 Trebarovu 13 uskutecnovaly 1 Upoko 1 spolustaršími 1 trojsten 1 Stafleu 2 univerzálna 10 štepnou 1 Špurkem 80 Studentský 1 Vahumský 11 Tire 103 svatostánku 2 trojskla 1 Tsebe 1 termobaterie 73 tesarík 1 Vachutkuv 1 Stephansposching 9 Vache 6 Trmantický 1 vearredahkkiid 1 trucakce 2 Tyloruv 6 s nekolika 2 Totalschaden 2 Strojeticích 1 S Leopoldine 2 Suquet 1 Tudrova 16 univerzalismu 3 Theocharis 5 tebje 7 utesnování 7 Strahoviensis 24 talentovaní 2 tengažská 5 strojopisné 1 s vodním 5 Trafalgarského 1 Transivan 23 úspešneji 1 Únavu 22 súdánském 1 TUNA 1 Spondogona 23 ubytují 1 tetrasomie 1 Sužován 1 ŠPAKOVÁ 1 Suspected 1 Stupnovaný 1 Trebícany 2 Tesárech 1 tridenský 1474 tvorila 1 uloupily 1 sreál 2 Tétényi 1 teâudd 1 Trochochaetidae 1 Vestfoldem 2 Trihlava 29 Tolkienovy 2 Taundi 2 Tmavomodrém 10 Tarchia 1 Theónovi 4 Subskripce 1 tradendarumque 1 Ulanudský 2 TOFY 1 Spartaky 1 Tulatula 1 Thebald 5 trustu 1 Sztutowo 1 Umistovala 1 TERKA 3 Stadeckerové 1 trikalciumfosfátu 115 uznaly 15 trešnového 6 souvky 10 stém 3 storyboardu 2 stádních 1 vagonoremontno 2 TCVCB 1 Turncurtovirus 1 Stratonike 1 Varniu 1 stredostavovském 33 Stejskalová 17 starostech 1 tereftalamin 45 Untergang 1 Umbriago 3 triaosmdesáti 10 Tracklisten 2 Venose 3 Tiaprid 108 Susi 1 Straita 3 Ubbe 1 vectoriels 1 Telijského 1 Sýrie… 1 Starbuster 1 unbiunum 1 užovce 5 uraženého 1 spilotus 2 Stencel 336 vedeli 2 tricuspid 1 unavili 1 thureofory 32 Vernets 3 Štítnický 1 tolkachova 20 Vazíristánu 1 trojkonsonantní 1109 uvést 1 Tresného 1 Tlapanékové 1 Tadeu 1 stickman 2 Špindlerem 3 Strachovicemi 1 sprežkové 2 Švercelová 2 Tahá 1 Trake 1 Tanyouo 2 tomaquet 9 Velkomezirícská 1 SULLIVANOVE 1 tchorím 16 tasení 1 spoluzodpovedným 1 Veljkovicowa 1 Tomanovic 1 Titkabal 2 Štyrskému 4 Svižník 1 urnadnuje 47 Téryho 18 Teleorman 1 sušickostrakonických 2 Uguz 4 tenoucké 30 suchozemskými 3 Trijo 1 Spawna 1 Typhula 1 Vélúr 1 Tsipis 1 vendome 1 traumatizováni 2058 stovky 6 svetlemodré 67 Titova 16 Ulrychových 1 támranílamani 1 Veers 63 Theodoricha 1 Tisalverovi 1 Sumatijain 1 Ventricleftida 2 Urial 2 švejk 1 torbu 10 úmoru 269 Talent 1 Usek 1 tluc 1 Uspešnejší 3 Udžicuny 1 umanuté 17 Stanovic 8 svídnická 1 Taxidermy 1 Umocnovat 11 Telelever 1 Streptocitta 2 supresor 15 tche 4 Steagalluv 3 Unta 3 Subbotinová 1 Takarazuky 1 Theofrastových 1 statdispl 3 Unicornu 1 truhlíkové 1 tanecníkovo 13 Souvrat 1 úplnejším 1 Vĺningen 1 stockerau 51 Strojírenské 3 Storme 1 Tanayamovi 27 teplomilného 14 Teologicky 1 s chrlici 5 SUMO 1 Verspätete 20 spoluvlastníky 11 Spratlyovy 2 Thayeria 1 s ministerským 1 Théŕtre 1 Urupema 406 uprchli 12 Takarazuka 3 Spolec 2 unáhlenému 2 sreda 1 Superdrug 6 Tevatron 24 Úmluvou 2 uvázlé 3 UCU 91 Tvorily 66 Trestná 1 tricetitrech 1 TASCAM 1 Theodorodunum 1 usenix 1 Štikovna 1 topographie 16 Tuchyne 1 Utvorme 2 vapincense 1 teleus 20 Tvarové 2 Subagja 1 sulfonia 5 svárecem 16 Valbusa 1 unparteyische 12 sumerští 5 unsrer 85 temene 1 Ubacs 1 Sykais 2 válcoval 8 stenových 1 teraplány 1 untrigintiliarda 2 tvrderockového 2 tsogang 4 tinam 2 úlomkovitá 18 Troia 6 tollens 1 Tartes 2 Tirionský 1 Šrejnárová 1 Terezianem 183 tech 10 Uhnák 9 uveze 3 Szombat 41 spoluautory 1 staetí 4 Telopea 1 Speighta 1 Ukai 1 Susso 6 tvarovaném 2 Venglár 223 stranického 15 Until 2 Tellini 7 Tisovské 1 Tušrattou 1 Titusz 4 trojbokých 1 trnený 2 usmrcenou 9 Syrakovský 192 sveruje 1 trypsinový 1 Streptokokózu 46 Tantra 3 spoluobjevitelka 5 Trojanovy 2 stylotvorného 1 uzrením 7 stoceným 1 Spellenb 2 trahens 1 trithionan 2 Titerová 46 uzavírány 1 Venco 5 Szokeová 31 Tuniská 2 štetinatých 3 starožitná 1 tetrovitého 12 urnám 10 tvĺ 3 Suurupi 2 stolonifer 6 Ugolini 1 topike 6 Troell 1 úbežná 1 Stiglitzovi 1 Štemplovci 1 Stryhaneckija 96 Teplotní 4 tovarišstva 1 Suliko 2 Trochodendranae 1 UJCS 1 Thantovo 2 Stockwella 1 Theagenovi 7 umelohmotný 4 splatter 1 tomasnetopil 3 šranky 1 subjektivistických 1 sumách 3 Specjalna 29 Urho 2 verifikovatelné 1 vectran 1 TextForge 3 verboten 3 Spät 1 telagon 1 tiangy 4 Špicáckého 1 splitský 1 ukrajinizmu 1 Toxcatl 16 Švácek 2 Stoická 3 tinctura 1 tríkolkami 3 štoku 2 Tordjman 1 Tuchorice 1 vaiolo 4 Uletel 1 uhnívajícího 30 ubytovaní 1 Travického 1 sterilovaných 4 uvnir 2 svazijské 2 Udajana 16 trapatka 6 Tetrevská 1 vermoordde 1 ÚVTIZ 5 Stošedesátým 10 Štiavnicka 2 spevák 10 veliger 2 Vandelliho 1 Strhliny 1 s vinutou 1 tátovou 2 Triplanem 1 Télégramme 10 Stangeriovité 1 Tongtong 187 stranka 1 svakíja 1 toile 24 Tongeren 2 Streckerovou 21 Svetr 19 teratogenní 6 Urise 1 Sudetskonemeckou 5 Svarené 1 súfie 6 Sternovi 1 tickler 1 tetrahydrolistová 9 svištouni 2 tenkozobcu 14 utrakvistického 1 toko 3 Strupková 1 tabernáklu 2 teorievedy 6 Svépomocné 5 Uvadlé 1 taceas 2 Tarlowski 77 velkorysé 18 upevnovala 1 Vejnovic 17 Stavela 1 Velšským 1 Spiklenecký 3 Uznaná 1 Trámec 1 transactionis 3 tokubecušiseki 3 Sween 11 stlacovat 1 triboelektrický 5 transverzála 1 stredovanou 1 Vengeur 1 Tykacovou 16 Veidl 1 turkménštinou 81 Štyrský 1 spbgu 1 varisai 3 Tálína 8 Testarossa 1 Succubových 1 Szentgyorgy 2 Stemodia 1 Umfolozi 3 spráhl 1 tóge 1 tijdschrift 50 Suppl 1 Uckurganská 145 telních 7 Templáre 1 Veterovské 1 Stepsons 1 Toniccin 1 Varesu 9 Tomkova 5 Stähli 20 svorníku 1 stránkovacím 5 tlumily 20 Stawów 4 Switzera 13 Steinovy 1 Szombati 1 Šulajové 9 utopená 2 Strahovští 1 umetá 28 tunáku 1 Vééovi 2 svobodomyslnými 1 Sowjetlyrik 49 Šríla 1 Torkham 1 Trassa 1 TEREA 1 Twirl 1 Toboc 1 Stürgkhove 5 Susegana 216 tibetský 1 storocnice 1 valodam 4 tokijskou 1 Stopesovou 1 STROUPEŽNICKÝ 1 Stellingwerfa 1 s nejedlou 1 Valinorským 9 Uhercické 8 Vecernici 2 Tongling 12 státotvorné 1 Urolfstal 7 srovnáváme 1 supervidovanými 3 Souzeni 1 stuttgartensia 1 vanuly 2 Vedova 7 Verreaux 1 subjuntivo 1 Untermühlu 2 Stanislavským 111 usne 3 spoluvytvárelo 1 va?ta 48 utvoreného 1 textotvorné 1 Stammerspitze 3 transamináza 6 Sprušil 4 Suprasl 6 stenocalyx 50 Šulová 1 telerijských 1 Spoilled 3 udania 1 Valese 1 Velbudži 1 Tesemma 1 Tunomíle 1 veterinarium 2 Technikum 1 spiklenecky 2 Vedely 1 Teofilem 1 svatoanenská 71 spartský 9 Týrova 2 vaduzským 1364 trídu 11 stavenými 3 traumaticky 1 Trumberonovi 15 Venoušek 1 Sukaramushu 1 ústavný 1 Turzovský 2 Thomsenova 1 touristische 2 vetrelcích 39 Tárik 2 vakoplšíkovití 1 trojchórovým 5 Trzech 1 Türcke 49 Tradicními 1 TERMINU 15 supertežké 1 Túli 1 Suthepa 1 Tigri 1 Transylvánský 4 suchanek 1 stejnozrnnosti 11 umenšení 1 Urophorus 2 tošav 1 stylefinder 10 ubližují 27 tchangský 1 sporranu 1 Tarantogou 290 úzkými 3 thipa 1 Venustou 2 subscriptio 2 Thunbergovou 1 TAROT 1 s rozhlednou 2 Šteinerem 1 triquetrucornis 1 stopetasedmdesátkrát 1 subperiorbitální 24 unitári 1 Talašem 1 Timelid 7 TREDOS 4 Spodnicka 1 Syrizu 23 spéciale 40 theremin 1 Subsola 1 Suasa 4 územnesprávním 1 Starrach 1 Trípísmenná 5 Šumicích 8 tyramin 9 stolnímu 3 tretihorami 2 trináctinásobnou 3 Tories 2 Tchilaišvili 2 tamburo 1 Tadeáša 1 Storyová 1 Upuv 1 SrCe 1 usnesena 2 †Tytthostonyx 2 vapen 1 spoluurcoval 2 textappealy 12 Touvet 3 Spójnia 3 Spongebobovi 2 Storfjord 5 tufit 1 sU 2 Sozinova 16 Tambora 2 Trambusová 1 Swadi 8 Uhlicité 1 Tekax 34 suisse 2 Švakrov 1 s neschválenými 115 Václavík 1 Unsane 2 Stomochord 1 tromboembolie 158 svetského 1 symbolisticky 8 Strojetic 2 tercíkovité 3 Staronovou 9 Szurös 1 spoluvede 2 vetrolamu 60 tajemnicí 178 Toužim 2 Vassonville 1 s Asociací 1 Vasilikon 12 Svatoslavi 21 Stichting 1 Tiefendorf 1 tremblar 2 Stripper 1 tajnoj 1 Tuymans 3 Tehtar 1 Trhomným 1 s Sharpem 2 Surikovovi 8 steps 379 svobodne 14 Svazového 35 Užovkovití 2 Stadtansicht 1 Veive 1 Tigerpalast 61 usedá 2 Trekfest 1 Späteho 1 Stipešic 4 sveta… 1 Špitálkou 1 UETE 1 starokatolicismu 3 Traukutitan 9 terpineol 1 Vepkhist 1 TSa 1 trussel 2 Spykerem 1 tean 1 ukovaný 6 stola 1 splendono 1 únavní 337 upravených 5 Stambulu 1 Veledubem 1 vetar 6 tožské 1 stürmende 4 Theatinu 1 TmEv 1 sparsata 1 Tessarakontarioi 18 Struktur 2 tomahavkem 4 Trillville 11 sužovali 31 Tucet 15 Stohu 224 sovetští 1 úkapu 1 Trudne 1 versal 2 stepoval 20 velkostatkárem 6 Thirds 2 UISK 1 stechiometrická 39 svetoznámých 3 Tomelloso 19 Uchytil 2 Stanslav 1 Teziolo 2 Teslovou 2 Vegeriai 1 Talenti 1 stormaktstiden 14 uchvátili 6 tumulus 30 Valtérov 1 Tiăo 4 Tychsen 3 Svitavskému 12 trídena 2 táhlu 736 tycinek 2 uvenu 2 Ukbary 1 SSNRI 1 vaesnici 1 Sprachfindung 3 Sveženky 220 tria 21 Úzkostné 40 trípatrový 7 Stanggassinger 5 Ulcové 1 spiropyran 3 strašilkovci 1 Sternalitz 10 SPACEHAB 1 Tindal 59 Ueber 58 splavnení 3 Tansomboon 1 terminy 11 utesnen 6 Urband 1 verste 1 starokališníkum 3 Tolmiea 2 udelujeme 1 stávajícímu 20 soustruhy 1 swarmingu 1 televizionnaja 1 Standarte 12 sražena 1 Sowinského 1 Úszor 4 stade 2 spravne 2 Ukitaovi 7 VBG 1 Sueca 1 s Rímskou 1 valhii 2 stredokamcatské 12 Trebechovicko 4 suborbitálním 2 tetramerních 5 Unreachable 3 Varkey 1 tir? 2 Stasser 2 Sporozoity 10 svetlici 3 vbodne 7 vacnatcem 1 Varílka 2 Venieriho 5 spéká 2 substrátová 1 s oblecením 1 Trapezová 6 Trávu 1 tektonity 1 Svarfdćla 1 tesákovi 3 Trebícan 1 Streitbare 2 Važov 4 Talstation 1048 spolecenského 1 umaštených 6 Spreeau 1 tethydních 1 Tálský 1 tt 5 SVIT 1 veštník 1 Tecuta 1 Theronove 1 Usnadnením 11 Tullock 2 Ungula 5 terrapene 3 Venaissin 1 trpitivý 46 Srpska 1 Sterobo 2 Tezze 1 Velard 2 velkooká 6 spannismu 1 vemeníky 2 Vakdžírský 3 velkytynec 1 tetradekagon 2 SSießler 3 transsaharský 1 Verführer 9 úhlovém 1 uštedri 1 trístnatý 1 Swacha 1 Trifixion 1 Temüdžinovu 1 Temešskou 1 tarvitsee 1 umiestením 1 Unavilo 1 STRIHAVKOVÁ 5 umele 1 Spaczek 1 Stanczuk 61 Stredoškolské 1 Urbanovitza 128 Spence 1 Szarowa 1 Székelska 1 Századok 9 susu 7 Stenky 6 Tesné 1 Vagongyár 2 Tatev 44 ucebnami 1 Svevem 4 švihy 2 Tažkým 1 Vatelinová 3 tvrdohlavými 1 velvyslanca 1 Vachkovi 1 streckum 2 SWARM 1 TAUŠ 1 Toulku 1 termocitlivý 1 Trettenero 2 Uklidnil 1 Storvik 1 Trihydrogenarsenicná 16 toponymum 2 trappy 1 Tanemurou 1 Tiká 8 updatu 1 velkomožném 1 Tescelinem 1 Svätou 11 Tleilaxanu 2 špaleta 1 Tothum 3 Velenu 1 ukládati 14 vagonky 11 tabletové 1 Truhelka 20 Šyši 2 Tukova 1 uralo 27 Tac 1 Sulkowských 2 terpenech 4 trídicích 9 tvoju 1 Šumpíka 1 Stuttgartia 1 subincanum 2 suny 1 Svébská 1 Tabidzeho 1 stuffin 1 Tiefmattengletscher 2 uklidnujících 1 Tiszaszentimre 3 Timorským 33 tuberosum 1 Svévole 3 Torgava 13 Stollárová 2 stalinizace 5 Technostres 41 vecernícku 2 spalným 1 Tochni 1 tríprstých 7 Totikašvili 1 svaku 1 vampirismem 11 Subrahmanyan 6 thrillerech 1 Terranskému 1 varázslója 2 Supremi 1 Spiegelsprung 29 towards 38 týral 1 SPEEDSHIFT 5 valby 3 Tankard 5 Tobianski 2 Turkestánsko 5 templerské 1 starý král 1 toist 1 trojznak 1 Tretyakova 2 sulfinyl 5 ubíjení 1 sväteho 2 šroubovicí 2 Sujong 1 Taverníci 26 Vesny 1 štepánskou 2 Strofiovi 1 tombriderovského 1 tvore 2 sterilizující 1 Tade 1 tematicke 1 Ulyssem 1 u mladších 3 Tsagaan 1 Uplatnený 1 Uvanit 1 SOUPERPOP 1 tolerare 2 tárogatu 1 Vasiljevové 1 tobasu 14 Streichquartett 13 VaV 3 Trenické 1 Šyrokauský 1 Tropidodiscidae 1 substituje 2 Ufou 1 Telekomunikácie 5 Toccacelo 2 Tammuze 2 Vámbéry 2 Superspy 83 Stehlíková 2 Tametsi 1 Teriazoume 11 utvorených 1 Tydiwga 1 spojitelnou 1 Thurstoneovy 3 Tlacit 1 Tulenin 25 Težkou 1 submersibilni 40 Tulle 2 Thelmou 1 trřtt 1 Vághorka 1 Staszicuv 1 spoluridice 1 Varnasa 6 Šteins 1 sportmanager 9 Strojove 2 strigiceps 2 Sutherlanduv 1 Verdaj 2 Traiguen 1 Taniantaweng 1 Strobilomycetaceae 27 sprchu 2 starostlivého 1 Sutanan 398 stredisek 8 Steinitzovy 2 topenárem 2 úštepku 12 úsudku 1 Ultrapravicáci 1 u anglického 1 Trmici 1 timbres 1 Synentognathi 5 Totman 1 studless 1 Tihaniovský 2 Tun 2 staženími 2 šovinismem 1 Symptomové 4 synklinála 1261 syndrom 1 šuplícku 1 turitickou 1 Tryskom 1 valarským 1 torbami 7 sycen 6 ucilišce 19 Špáty 1 strevovitých 44 Stadttheater 1 s výbavou 1 traditionum 1 Sterna sandvicensis 1 Takonínem 2 Varsinais 23 Tariq 1 té 1 Tajabone 1 Tofiq 2 tatrmane 1 triapadesáté 1 Útešná 1 Timotheovi 1 Vargason 1 Stafort 2 toilette 3 ugrických 1 Trojstupnová 1 Toughman 1 Trupelníku 1 VanLaerhoven 2 Szigetcsúcs 4 Spacebus 1 Tatatrinov 1 Taineho 1 szewc 2 Telegraphenbauanstalt 103 stavovských 1 španelce 1 Vaivou 1 stankovskii 1 Sportgeschichte 1 vaskulárními 4 Torezu 1 Tschudiová 1 Šupalového 1 uratica 1 Synchroskupina 480 terminologii 1 tetrafluorethylen 1 Tschirnerová 1 Vastaranta 18 Trávníckova 2 vejprnický 2 Tešila 1 Turke 1 Supradyn 1 Tjernsrud 6 stafylokoka 1 Theoderic 1 s bystrou 3 Vejrychem 1 svodnicí 5 terricola 1 Verne 1 toter 1 Urahata 12 Tezaurus 1 tevat 1 suarezarum 137 talenty 1 sový 1 Tempenny 16 veršové 1 Štrbic 17 Tuin 1 šroubovitým 17 trávnicích 24 tvarovým 1 tatickove 1 tarawíh 5 Templárum 4 soustredeností 1 Varínskeho 47 upevnili 1 Suntarský 1 Vátinka 1 strážnci 2 Tayovi 1 uranylwolframáty 33 Swimming 1 Ulfangem 5 uchyceným 1 Sudetenvorland 6 ubytovávají 282 ssp 1 triangular 38 Tlustá 2 varováními 8 Tageblatt 1 Vergangenheiten 2 Tnava 1 Šujskými 63 Štastnou 8 Uostadvarský 3 Überdörfel 7 spláchla 3 úseckách 8 Swierzawa 1 Umetnicko 5 summus 1 Tauchmanna 1 Stepmom 1 Spolocné 15 Stages 2 subatlantský 7 Vápeníkovou 1 Treme 1 vdovo 17 Versuchsanstalt 2 Tešovských 1 Timahu 3 ulmskou 33 stenóza 5 spooling 6 sunout 4 tracy 2 Tragoedia 2 supinu 6 theo 1 Ušak 8 Uvedomení 1 Tarzanovými 1 šumadijský 4 valanda 1 ventromediálního 2 Vartán 1 Ustkou 1 Tranje 14 Thermus 1 vandykei 1 tretikatolickou 1 vduce 1 Strugi 1 Sunwell 1 Unies 1 Stobaíos 4 Vaszója 1 traily 1 trolnitrát 1 tjpilanazborovice 1 umelkzne 1 Táherí 6 uchýlení 1 VALVe 1 Spreedorfu 3 superieurs 5 tisícého 2 tnh 2 súrách 1 tetraplodní 1 Staurakia 1 Valentinovicem 3 süße 4 Teasla 1 Ukrajinfilmu 3 Toruniu 5 Štaidlem 4 texan 65 Trash 5 trocnovského 10 startovacími 5 Vélines 2 Tomášovskou 1 sverdlovský 1 Tlustovosy 1 Traktorist 1 tramwaju 1 tacendo 2 Trebonskem 1 strkapoud 29 TNO 2 uulu 1 Sunnarafjall 10 Stips 1 venonována 2 termoemisní 1 spolupilotem 2 Unionbank 1 Štuchla 3 strahovskou 1 Spionkopit 1 Sportard 1 Trastŕmares 1 Stroffeck 1 Venerandissimo 3 Tavion 3 topícím 12 Ultrix 1 velkomembránové 1 Verstovskij 1 STERBOVÁ 1 Vaill 1 vadžrajánový 8 UTM 1 superblok 1 Unejovice 5 Topography 1 Varginys 1 Ulceration 2 straubinské 1 submodul 1 tracheitidy 2 svetlovodu 1 vakuove tesné 39 valbová 1 Šramanské 2 teknologioj 3 utnutí 13 vakuový 1 Vettor 1 stoppering 2 Taškran 77 Štepánova 28 Specialisté 28 Trails 2 Tichvinu 4 Strešnevová 8 Vandernotte 1 svetoobcanskou 1 tenkostených 1 Spartaco 7 teplovodního 89 Tathiana 77 StEG 2 s tvrzí 1 Transfix 6 thangka 2 strkajících 8 tati 4 synácek 44 sportování 5 twistu 3 Takedum 1 succensus 17 stupnovitým 1 s hmotným 1 Valderrábano 1 termátového 1 Štangelj 140 uštknutí 1 uzvisia 1 Uetlibergu 2 Stagger 6 Trol 4 tuje 19 Subterra 1 Stenammini 3 Turanskou 3 vakuolami 1 transsonický 1 Trojbradlí 48 štedrosti 17 splýval 1 tisicí 1 Tonorio 3 verwalteten 11 Stašovský 1 s podrobným 1 Utínem 1 váživy 2 Tošimici 2 Tadžikové 2 utrechtská 3 StarStyle 2 Streunové 5 thomsoni 1 trasláky 1 Tomomunemu 5 Vanzina 1 Striptýzu 3 Tropcic 1 thebuigallery 2 Tertei 1 Štefani 5 Tadayuki 1 Teusch 1 sýrare 2 Veillera 5 Tallinnský 2 Tiviers 1 s uchem 3 Trocová 9 spinelu 1 techpowerup 1 titanátem 7 Uzon 1 urray 1 sprašovité 1 taške 1 Valentukevicius 25 Staveli 1 Stoltzner 13 varšavským 5 Subtilis 1 štítovku 147 usporádanými 1 Válecníkuv 7 Sudetonemeckých 27 Stredoslovinském 1 Tuonetar 1 tlacím 1 Terentevic 4 Svážný 1 tuki 1 SOUZ 1 tecnolife 1 Úhorová 21 Tigová 1 Vaiga 1 svetonáhlad 3 Universetalent 1 uslyšavši 2 Tanejev 1 THANK 2 vesnie 2 Tuvská 3 Srpovi 481 úmluvy 193 symbolickou 1 Vaišje 1 TheirJdbcDriver 1 Statistikaamet 29 štýrském 1 Stredoslovenským 1 Tannowitz 1 Tarym 1 souvislotsti 1 staroondrejského 1 Souvisely 1 trojokno 1 Udligenswil 1 Uge 1 Vallauri 1 terrienne 6 tréningového 3 stevardek 1 štítarském 1 teologDvorana 1 vernierovou 55 teckovaný 1 Tejiny 1 tradicni 1 Teoforická 3 veteš 1 Trajaanse 3 Talmay 5 tetrívci 2 Steinerweg 6 trcícími 505 štafete 1 Ustecky 2 Taurow 1 URENCO 5 Stonewallských 1 UNOMIL 2 Tr?nu 1 Užys 1 Uematcem 29 Ujal 4 usmýkal 7 stub 11 Terres 5 Taralea 4 Tabonovití 2 spišskonovoveského 1 Špilendorf 1 švjentoch 1 Summeru 2 sráživých 1 spolukandidáta 1 strombolsko 1 Valensise 1 Stoerove 60 TVS 2 Trais 10 Triathlon 7 Vahanec 4 Tŕi 1 s králem 1 verené 2 Staurozoa 10 Ucitelského 4 Tempelská 1 Teuberová 1 tnose 1 svlaková 1 vedeckopedagogická 1 sympodiálním 4 Trentinu 3 Vánovský 2 Tschern 43 Surigao 1 Tvrzských 6 Vece 2 Tolbo 39 Uz 1 Srostki 1 s antukou 18 šternberské 44 tubusy 5 Spillar 29 telenovela 6 Thorfinnem 1 Sugaie 1 Troeltschovská 52 stredu 2 systémy… 3 Teegerová 1 Stupar 287 tajemstvím 3 Uvernet 1 úverovatelné 3 SWISH 5 Unterhachingu 1 Todsünde 14 Tréguier 9 Strasti 1 s dostatecne 3 ultralevicovou 1 sporádanejší 10 Úhlavu 1 Tomentosa 1 Tanachy 2 syrovejším 14 Testing 3 Sulibani 3 tratamento 1 sváko 1 vecovské 2 spolcováním 1 tunaji 1 Šúnemanku 1 Štumbauer 1 velodromem 2 Veronov 1 Tšuva 3 Španbauer 1 Thidrekssaga 1 Tvorca 1 TAKA 1 TwinsCom 6 utíkajícího 1 Valounovým 2 Unbestechliche 2 Takenouchi 76 Tenochtitlánu 20 ústavum 1 Stahujte 1 Studesville 1 verícíh 2 tr?pest?k? 2 Ununoctium 3 Sulimova 3 totemový 1 stosedmašedesátý 10 Tríkrálové 21 válcovaných 1 spocitat 1 tralová 9 Utajení 1 trináctiletými 4 Vanke 1 Veríci 3 théravádu 2 Stíhám 2 STEINWAY 1 Veglae 23 vepr 3 svítánícka 1 Tuhajová 1 staró 1 speedcuberskými 10 tavírna 1 TimeDB 43 Trtice 16 Transevropské 1 tricetimetrovým 3 štípou 6 tryzub 1 SouthViewChurchHolySacrament 1 Steyerbromelia 9 syrakuského 3 trojCD 1 ucívala 3 Stromum 27 Verse 1 strospesid 18 velrybáru 72 Vélez 1 Upssalské 2 Tyromyces 1 Thommeret 1 štouchaném 1 udelíme 1 tlustokrkých 10 Suspiria 45 Topaz 1 Utzonovi 1 spout 30 synova 5 Vasilache 1 supper 414 tisícu 1 Útesník 2 týmže 1 umliegenden 1 Tanaceum 1 Švabeho 2 Stožeckém 7 vedeckofantastickými 1 stoloniferae 3 undecimy 1 Thaem 187 substance 1 stríbreodená 1 spoluministr 1 Štechovi 1 Ubuovi 98 suchými 2 Tuberkulózu 2 Verkehrspolizei 2 újem 5 Trnitý 1 Tadanaoa 1 Topicu 1 Squillarim 1 Thomisová 1 THAUPI 2 transexuál 4 spektrofotometricky 2 uzákonily 2 Tumbler 6 Stallings 3 Tentacle 2 Treadaway 3 Svieri 3 Statistica 1 Uldové 1 Stubholtová 2 Tapuiasaurus 1 Staedtlerem 1 Templetonových 1 Talviolut 2 Teppner 1 Timberga 1 teologie založená 2 Valentré 2 Srozumitelnou 2 Sovove 1 vendotablo 1 Stražnica 1 Stevnem 1 Steiglitz 54 Stinger 1 turcomanica 4 Tebartz 1 Varhaníky 1 Tamul 9 Stírka 3 vejcoživorodost 8 Topia 1 tstrip 54 Steira 1 squashovém 22 Strety 1 velikoncní 18 trmínku 1 szron 5 Udžizane 2 Trebešove 9 triterpenoidy 1 thuvianský 1 truhlárnu 1 Trřndelaga 2 svahoviny 7 Vaals 49 urad 2 Svatoanežské 2 Untertitel 34 Tirso 3 toyota 3 Trisulfan 252 tribuna 32 Tirschenreuth 16 úrovním 2 trtinovém 1 Vedenev 1 Usuardova 1 Venkateswara 2 Veranius 1 Strašnickým 1 Sputnikmucis 3 Stefanyshynová 2 umyly 3 Synandrodaphne 54 územnesprávní 2 Turennovi 1 svatoreceném 3 urbanistika 92 Trautwein 13 tutor 1 Táhnem 1 Uglîdis 1 umeleckoremeslne 1 Tiy 3 Trolimon 1 Traditur 1 vampýrskou 17 uplatil 2 Unending 24 terénu 1 Stovku 2 Spritzer 1 svrabovém 2 svetlehnede 30 Subprovincní 1 Tetourem 1 Varletem 2 Tobiasson 1 Vernanta 1 tríkusové 2 stavropigiální 6 stahovacími 3 stoparkou 63 Tyrone 2 traumatology 2 svaril 11 Veltrusech 6 Spaan 1 Strakum 1 transofrmovala 1 svetlecervený 5 tanecníkovi 6 uhlopríckou 14 tázal 8 Užupis 6 Vegele 1 tile 1 sourcovým 3 Territorialis 1 Suleymanyye 18 TRAMPSKÁ 1 superpotentní 1 Ústního 3 Tripple 1 sudovitá 5 Thanadelthur 2 temaID 1 UPÁLENÍM 19 Trimble 4 utreni 1 Tvrdohlavci 1 Štullera 15 Tamilské 2 venkovech 1 uarz 1 Vermilingua 3 Útlý 8 Vadencourt 4 Trizuljak 1 temperovane 1 Vesermaaréa 14 Spener 1 Sterilizovaný 1 Valmagginimu 1 Trabitz 1 Transevropský 1 Stöhrovi 4 Sourdis 2 tertiana 2 superkanón 4 Terentiem 1 ulicnickému 4 TJA 1 uplatnými 57 Strážník 1 thujová 1 Steenwinckelových 1 unitedflow 1 Strompachovi 11 Sympaták 1 Špulíri 2 supratekutým 1 subjektivisty 1 Theoretické 3 Stéblovou 1 vcetní 3 uctíváme 1 traductae 27 uchác 1 Uhlírství 2 Theoktisovi 2 technopark 44 Szörényi 4 štavelanem 5 Televise 1 Szeklerland 4 Utekác 1 sousutrojí 1 Televýchovná 1 tokubetsu 1 ultrarychlých 2 Troussey 1 Spatarul 2 stabilisaci 1 Speciosi 5 Taoisté 2 unionistickému 1 Staublose 1 Veprekem 1 spokingu 1 Velutus 3 Sublaiu 1 Tijrk 2 Stadlberg 1 Topolu 6 Uga 5 Stykace 5 spláchnut 3 Toyoko 1 szeressen 1 templeStPierre 2 Türkmenistan 1 tan teriér 1 Turány 2 supersymetrickou 3 uvízlý 6 ssault 1 Sredobanátsky 17 úr 4 uranovými 8 Teve 2 urőr 2 tetraspanin 4 trítýdenního 1 vešen 4 Udidlo 2 Strípku 2 Stáne 1 Sršatec 1 Strateuma 7 trílistý 6 Tokina 5 Unification 3 stadionek 3 Velloso 2 velocidad 1 swintonioides 12 Urbánní 1 Urcitostí 1 Tlaxochimaco 3 Valdampierre 4 Strašnický 1 soutreduje 1 souslojím 2 Uderns 1 stulecia 4 Triové 1 ڞasnákovi 5 Trimsedis 2 thiolu 6 Tanchuma 16 surrealistickými 3 Sousto 3 spiritului 1 štítonosici 17 spjatým 3 Šubrta 1 Ugal 3 terę 3 Unterretzbach 1 Timurovo 2 Textfiguren 1 Traniová 1 trujúhelníka 1 Toddla 1 topeništím 1 Utulity 1 Stenothecidae 2 Staphylininae 1 Ullacharles 1 Špekouna 1 Speart 1 Télčme 1 težitelnou 1 Vanové 254 Stredního 10 Stĺle 2 Supergott 1 STOCKHOLM 1 trýznený 12 Thain 1 tappaa 2 Temla 4 tucnolistých 1 szafir 7 Ustanoven 1 verget 1 Srednekolymsk 2 tetryonové 152 tuhou 1 uchazecovo 2 Stankovskému 7 sumecci 3 stonožkami 1 Svojci 1 umluveno 2 Štenci 1 Symphyochlamys 1 Thasler 260 Tartu 1 Staouli 6 Ukrytí 1 Szentkatalin 1 Toppman 3 vencu 7 utali 1 Stuhlgang 1 Stroopovy 6 Sunde 1 undecylenová 1 Tabasko 1 Souphanousinphonových 5 Syrup 13 Steindorf 1 Spitzbub 1 trešnolistý 5 triclopyru 1 Turbanellidae 2 štastlivci 45 Szolkowy 79 toaletní 5 Trísovská 1 valíc 1 Vedunia 2 Techener 1 Teritoriálních 2 stoá 1 Špitálního 88 Trevír 15 úle 1 Venusi 1 trioxapentacyclo 1 Unterhaltendes 1 svrhnula 3 stotisící 1 Vavácka 1 tvistový 1 stanicy 4 velkorážový 1 Vanovicemi 1 Tunnanu 1 verolomným 2 Torontou 1 ŠTOLC 3 Surabayu 3 Spoletia 1 Transdanubii 1 Straubii 1 srocující 1 souvercích 1 Tužová 2 Veletržních 22 SSTV 1 Teschwitz 1 Úbežný 2 spoluvlastnila 1 uncached 2 utínali 12 Ulliel 2 Stadeln 23 Suri 203 tchung 8 trezorové 3 ucícími 1 specialzoval 2 uzlíccích 2 tisícistránkovou 25 syringae 1 vdavkám 56 Varus 2 svetložlutá 1 Ujfaluba 1 Tertiary 2 Treibacher 2 spratky 7 Starostrašnická 1 Umeleko 1 Svadbová 20 Trnávce 16 trojhlavnový 65 užitné 1 tellement 1 tuijin 1 Tosskorarhorn 1 tabernaemontan 2 Tommim 1 Tuccianus 1 s dekanem 3 Trilly 1 Truchsassu 1 untergegangene 1 Spoléhej 1 stošestatricetkrát 1 ualallal 1 Spaakovy 8 Troop 1 Tefalohy 1 Standfest 3 Verdem 16 Valentína 1 szt 1 vápencovatejší 1 Vecerku 2 s procesorem 1 úvalsko 1 štepánovská 1 UHM 1 Thrmoplastu 2 Stonehaven 72 Svatoplukem 1 VERHALLENOVÁ 1 sympatrie 1 Tolsey 3 upekly 71 spadat 6 uvadala 5 Vetterová 1 Travoltu 1 sudove 1 transpordéry 2 Unteraargletscher 1 Vagelis 3 taller 2 Taktík 5 Stals 1 uvodnate 3 Trappisten 2 thiruvananthapuramský 1 varice… 37 Stuka 11 Travicka 1 thioacetalu 2 Totemová 2 Teleskopgabel 7 Stev 40 Telefony 1 Szczerców 1 subverzií 7 Splügen 1 technooptimista 1 Theseovu 1 Tetsuovou 1 Vanácovou 5 udávit 1 Tishell 1 Tavolary 1 surripses 1 spikalech 1 tvarec 9 Trithuria 1 uLaunchELF 1 Stillsfromabove 1 srozumitelnejších 6 Umír 14 SteelSeries 250 stopkaté 1 Vasilonoks 4 uhlováním 1 Štang 1 Turnograjskou 431 Teal 381 Továrna 1 Trulo 4 stratovulkanickou 1 tanecnící 1 tuonzit 1 Ufského 1 s Andrzejem 1 Tuberona 1 Urisových 19 Ved 1 Vavrenu 1 streetmagic 1 Venantino 2 Trachomitum 1 supersection 1 Turkyní 10328 Švédsko 1 umberštine 16 TiNb 1 VelkyRodinnyDum 1 SUSA 76 Syrakus 1 Telsey 3 špalírem 1 Uzancní 23 trubicovitý 23 Tomy 905 TMA 6 Vahlensieck 33 Stefanov 1 staropackém 2 stredoformátový 1 Thierrens 1 Unqulified 1 vĺgor 1 vanima 37 spríznený 80 talmudu 2 summou 13 uso 2 Spota 1 Thorenta 2 Spielberku 1 Stadtel 1 Vermar 1 Stokaová 2 trunícími 1 Štilíková 2 Sportsvan 1 Tracheopulmonata 1 trísvazkovému 1 Tunalikevirus 1 uniportu 2 Tohvri 1 Trnava 1 Thessard 1 Tróovi 1 spirury 3 šterkovnách 2 Tauj 2 Unklar 1 Trevires 1 Steinmatten 42 Tarnów 2 Ugartove 1 TKG 1 tafsírech 1 sublineatus 13 statistikám 80 transkripcí 96 Svetelné 1 Strockele 1 UEMM 2 Souprosse 1 Venni 1 Teusaí 12 testové 1 Vejrážky 9 Vachler 2 terministické 1 univerziity 1 umorovatel 1 Squarem 2 trestajícím 2 stejnojmennost 1 Trogopterus 2 Triomphes 119 strhne 2 spoluorganizátorka 20 trhavá 1 stalinistischen 2 Šterbovina 59 tancil 1 Veiovis 3 týdennímu 1 tolmachevii 4 Spohra 2 Valak 9 Sthenó 1 Vestergreen 30 tenistkami 1 Tlac 1 tmbib 19 Vernona 7 Varením 1 svabhávu 2 Szeleszynski 3 Tritonka 2 vaišja 1 Tincani 1 trohet 24 Sparkassen 1 Trossiho 2 sportbox 83 Sudetonemecká 1 unterstützt 23 Thuvajni 1 Steedovi 1 u Turnova 1 Tössu 1 Stewiemu 2 užické 1 —válcovite 1 VeselyFX 1 Stilicha 3 UberSoldier 24 strastiplnou 1 Ušakovovi 1 tyttöä 1 Telecastery 1 s predáním 2 Tetálová 4 starofrancouzský 1 tutkimus 1 Torrettiho 53 transformují 18 Tông 1 the glass 1 Tribadernas 1 stodských 1 traducción 15 teleport 1 svetlosberný 139 stabilne 1 szulera 2 strouhají 1 Stežovat 1 Verocchio 1 tokaji 3 Tudulinna 5 stejnobarevné 16 Vautour 1 superfinale 1 Veritele 2 ulicovou 28 starorectine 33 terpentýnu 2 Štrbskému 1 Tuskenové 2 tautomerismus 1 tranquile 1 Trestnímu 1 Theunera 40 stojím 18 Taio 2 Štengarácek 1 tluceného 1 Thie 1 Tecnologie 39 tropicalis 1 sytti 2 Sturrup 3 Sult 1 Thoits 1 veledanek 1 Tanjeh 2 styrol 1 Stefaniuk 1 Szebelléb 1 s Ústím 1 teozof 1 uppsalského 1 toulonská 1 Teslík 1 vazokonstriktory 18 staroslovensky 17 tilt 1 Sušozera 8 tropopauze 1 vcasnými 1 Telefunkenský 1 Trúp 1 splul 1 Timaii 1 Treniotovi 39 velkomoravský 1 vedec 1 swietojanska 4 Takanaši 2064 Svatého 1 tarase 1 Suchyj 14 Taktovací 1 uitgave 1 tricítkový 1891 sovetský 2 Svobodo 3 tellurový 4 Teichberg 1 Tibilisi 1 Vespasiánovy 3 ucednickou 2 tartarických 39 uctívány 2 Tichvinská 1 Sylvestriády 12 Steph 32 Stanislawem 1 Vajolonscharte 1 veleobraPrimus 8 Umírat 1 Stocková 2 veršku 1 upgradovatelný 2 troubiti 1 Šturji 1 šúdag 66 veslarský 1 Teamhairu 8 Tatabojs 3 starousedlických 1 Stícanum 159 Vávry 1 Tropiezo 4 uklánet 1 taganrogském 1 TRMG 1 trichobezoárum 72 Sportovište 9 Špicaté 2 Svazijci 1 Taroon 38 stredoceském 5 Svíba 2 Thoda 1 splitského 2 Spekeova 4 streptokokovou 1 TEWS 1 Synagogální 1 trmínkem 5 Tartokas 1 Tudorské 1 Šprundibour 1 Todiramphus 1 ?yrolm 6 strechový 1 Stapfera 1 UVEPROM 2 studenské 3 Thoresby 1 telmofágní 1 tachistoskopicky 19 usilujícího 985 Stríbrní 3 Verkehrsfliegerschule 187 Valašska 40 syrskými 1 Tuppelinburg 2 Stalberger 1 Trimezia 1 Témis 1 Swindonská 2 SOVIKOMS 3 ukojí 18 upokojencev 3 Urzica 15 Tachtadžjanove 1 Standleyanthus 1 Sutovém 1784 uživatelu 1 Tegenlicht 1 Važanice 5 spodoby 1 Vecernitsa 1089 upravena 16 Tunklové 1 trubickach 21 usnadneno 1 Tamluku 1 Teevens 2 uthmánská 537 ukázka 6 vejdu 1 trídností 2 theologus 2 Trecenti 1 Sžehnuta 19 Textilrohstoffe 5 Talan 2 stvoritelským 1 Terbegec 2 Trahok 13 vagónkou 1 Treal 1 tatíci 3 Sufjána 12 svarení 3 svatohubertský 3 truvér 1 stadionku 2 Troškova 1 SSHFP 1 Sphaerosacme 18 spotech 1 štuchává 1 trojvazném 1 Turbuneeme 3 Vancurovu 2 tryznou 2 Treybalová 78 vecném 1 tanabemesto 4 Stefánsdóttir 1 Tarpanu 2 tura 5 subprefektura 138 tenisovou 1 tretných 1 Umistovat 59 Travolta 1 Varadčs 2 Tuckovým 4 Vespuccim 12 Tarnström 1 Spondiadoideae 1 subjektivneji 1 Thermć 2 Uchránit 9 Sýkorovi 1 Stillwaterit 1 Termont 1 usko 2 sudová 1 Trocholoma 1 Štavnatost 3 Tanejev 2 Steinfleckbergu 3 Váliví 1 Strihánek 1 Valentianiana 4 Spantig 6 syrup 267 transakcí 15 stanovém 19 soundu 1 Úlohová 7 Thielman 6 Úslavu 1 štíhhlou 1 Sveksnastogastulpis 11 Utrechtskou 1 únahu 1 teoretickoprávní 1 Uherskohradištský 35 Stacilo 7 toledská 1 Szydlowci 2 trichotecénové 4 Spasská 1 veršícky 3 Steurbaut 1 universy 1 Venusinus 1 spolocníci 1 Stalagnit 1 Suomalainenovi 12 Telek 1 Tournut 15 uschlých 2 Tonningen 4 Statmografie 1 Tarquiniove 1 ?ud 1 upanišadového 10 Šumenská 3 Šušik 3 umerená 142 usazenin 4 Táhirovcu 3 Todevskou 1 Thaliona 1 ultimates 1 Stojzu 1 Starokonstantinovu 1 tuhkatriinu 1 Uhersku peníze 1 varjagským 1 Umukate 4 Trew 2 Tobiášovu 3 urinaria 127 spatren 34 tchyni 141 stabilnejší 8 Strejka 1 šprotech 3 Šturbabin 2 subtilnost 6 suborder 27 subreta 1 Telovýchovném 5 Tessičres 2 studier 5 specializujícím 34 ubohé 8 Varlich 83 subjektivním 1 u Ostravy 2 Užvarmis 22 ukolébavky 1 Trepanací 1 stromroku 3 telugštinu 2 velosport 1 twau 1 Takabajaši 1 Undama 75 triumfem 17 Uvádena 1 stranicka 2 vartenberského 1 táké 3 Typhaetum 125 stejnomerne 2 Varclem 1235 teologii 9 Ubagan 36 Sui 1 Thalavattam 1 Trancé 1 svatojurské 3 Swardson 8 technicke 32 Velc 1 Valcharová 2 Verberne 1 Thurbera 4 Trafikant 724 Svobodný 56 Theatrum 1 Treskowitz 11 Stodolová 1 Sutcliff 448 svazcích 3 Standalone 7 starostove 1 SUMMEREN 1 Šuji 1 užaslá 1 Symphionematoideae 1 Talay 1 Swapu 60 Trošky 1 Strechova 3 usi 1 Stormblĺstu 1 Teddunham 17 Turbová 1 stenozonní 1 Tortillas 1 Tripadvisor 184 Vejce 415 Usedl 586 spravoval 1 temirgojském 2 Tischlinger 20 Ulrico 9 Thráina 16 Tudományegyetem 1 subkritickou 1 tonis 1 Texarových 6 transformujících 3 Verušic 4 Strukturovaná 14 stékat 2 vchlípí 2 Ulricin 2 teie 1 Strabó 2 Unterdrautal 1 tesákovité 2 svinutým 1 Tirikunámalé 10 Telefonicky 1 Újgyalla 14 Terho 3 Starecek 2 Triplit 251 teplomilných 763 stanovil 1 vadovická 20 vemene 1 tiros 1 turkménského 1 tonzilitidy 1 Trinwillershagenu 1 Štepáníková 1 Šyroka 1106 ústní 1 trochejemi 4 Variationi 124 tiskoviny 1 trezora 1 Tajmúruv 1 Uvrhnou 3 Vardun 1 srednji 2 statusref 1 Synesiove 124 Spacelab 7 váznoucí 2 usuca 1 Spikou 1 Sukth 4 Srny 5 týhle 177 stékají 1 SPOUŠTECÍHO 2 Vauclain 3 Timofejevna 1 supermasívní 10 Soyer 1002 te 2 Tricat 5 tuberkulosy 1 Southerndownu 1 Trollfjordem 1 Sytinách 233 tvory 1 Sudžong 13 Tuzlanský 1 Sustead 22 Sternbach 1 Uluchových 6 Strážnicí 1 tešne 4 udržitelnejší 1 thyroperoxidázy 300 sponzora 7 vclenují 1 Úvozní 1 unkn 1 Unducted 2 Stvorená 1776 spojeny 4 Uspenie 1 TiTi 4 Tolminu 1 spríseženstvo 2 štockem 10 uvidely 3 Sparrer 563 touží 2 Theudebalda 1 Subiendo 62 Telem 4 Tesmanová 2 Vergerio 1 Sprtovní 1 ÚJaL 1 ujasnené 1 Varsedžiu 1 štepovanou 1 s varhanami 3 Štekat 1 Tosašimizu 3 uplatnujíc 1 tríchlopnové 1 Stolzenwerde 26 starecek 1 Thassiho 78 ukazovalo 2 templon 4 thyreotropin 11 Úctová 2 Tortia 1 ÚSPECH 5 Sutermeister 18 testovinami 41 Tomaszów 2 Usporádanou 2 vákem 4 spevokolu 4 tmpfs 15 vernicosus 9 Trombóza 1 UltraSparcu 2 Thielmanna 4 uríznou 2 thyreotoxikóze 1 Tourniquets 1 Tichovský 1 Tutuolovi 2 štestícka 2 tortonesei 4 splývali 1 s elektrinou 1 sporební 1 Sukýnky 1 supafenestrami 1 šúha 1 Štepaník 1 Titulování 4 Tollense 1 Špidlenem 1 surbek 15 tykadlech 35 ustupujícím 1 strnlen 1 Vadurová 1 Tanzhaus 1 tru 3 Tobijᚠ1 Suvir 3 svet 2 sulfanylbenzoová 1 sylván 1 Trelawneyovi 1 topiramátu 1 syrovátce 4 tvrdýše 1 Valasjöĺn 1 Souškách 1 stejnopohalvním 5 Strophocactus 93 šterbinách 2 Valij 1 Thebaide 2 státovedou 5 Staatsmann 1 upovými 1 SpeechTech 1 sulphostate 10 treláže 1 starohamerského 819 štíty 2 sourdine 15 Turcianských 1 špenátový 18 Steinitze 1 veriegata 3 SSCSLP 2 Spirálové 1 texinfo 1 Sulfonací 1 verlorenes 33 Vegy 1 Srbická 1 Vanunovým 1 ukoncita 1 Tulácka 9 Šutruk 4 Tutoru 1 Tschamintal 1 Tagebucher 4 tahitskými 10 supertorpédoborcu 1 svatohubertské 38 strategiemi 42 stratifikaci 1 Strojírensko 1 Terzie 80 starozákonních 69 Vasila 30 Ubi 742 ústredního 1 Tasmáncum 4 sousosi 2 Thonem 1 tirolika 1 vedcova 1 Trameri 1 Theod 8 turbulencích 2 svárlivostí 3 Stieglitzových 5 treláží 16 Tirleaová 1 Trabaci 203 Valentinianus 1 Trepenité 1 Ulickaja 88 udržovaly 1 USPSTF 11 staršovstva 1 Stovinuv 166 uznávaná 10 stagnovaly 1 Thínu 1 tmavožlutou 1 Telferová 2 svací 679 vektoru 1 Sungir 1 Vesiculovirus 1 Vacai 14 turínském 2 Spektrou 21 Thorell 24 Tributylcínoxid 124 Vanícek 36 SRBD 1 štamgastovi 1 tergitu 1 Tribalance 1 Tonniho 20 úvodník 1 tholeitum 2 svojanovský 1 Vargasy 303 Studánka 24 sutemi 3 Vanajavesi 2 Ukrajincích 1 Steinfleck 1 Speeovy 1 Tricátnice 1 tríkorunové 3 Varadinu 1 souperíciho 4 Tadžimi 1 Verdener 1 spontáního 15 Štreita 1 Spáleno 1 Valtopina 1 suspende 2 STATE 337 úplného 1 Tandemy 13 Springfieldský 1 Túsího 1 Tuge 1 Udžiciky 3 špuntu 42 Svazová 3 Tricetiletého 1 Tarts 21 Undead 1 Splínovi 3 Triceratopse 1 Upecou 1 Trauttmansdorffovi 6 Theoretische 1 tajený 17 spalujícím 1 Svjatoslavici 2 Tachles 1 Starorakušanství 19 universitet 1 Terestyén 3 Storno 15 termika 2 Teuschla 1 Ulrichov 1 TYCY 3 Stintino 4 Venäläinen 8 spektrofotometrie 1 turistiku Dario 1 tcetí 7 TDC 6 Stebnícké 11 Strobe 1 Veljamovicy 1 Sudenpe 1 šterkovištích 6 tybinku 1 veganism 4 Süßer 1 sún 6 Thuzada 3 struskách 36 svetlém 6 Tubože 1 Spoluzavazadlo 1 Unconventionals 1 Tencati 1 Srisailam 7 Varey 7 spawn 241 Verein 1 Staveník 23 Vandy 1 utahovacím 1 Stubberud 2 tupoúhlých 7 Tokay 1 stanek 1 temnospondyly 1 strižku 3 Tidningarnas 1 triumviri 1 stossen 2 Velkoprevorskému 1 svátostka 1 Tholson 1 Suffolkuv 37 težkopádné 16 Umistuje 27 ukázkového 1 stavebnnictví 1 trojkoš 1 Twarza 1 testárnu 2 Torturing 1 VESMÍRU 5 transhumanistického 2 Valchan 1 Vaagan 424 tragické 1 Turnici 1 Ummadyahay 1 Steinerud 2 Tupla 1 Tartarosu 1 Trumpettiköynnös 1 tatana 1 sráživého 2 urina 1 Ulthane 3 umlceni 2 Vareškového 1 trojprodukci 7 Spindelegger 1 študýrovat 1 Springovou 1 typu srsti 6 Talit 5 spotrebitelskými 1 tabákovách 1 Toulonský 2 Šubaki 1 sulfinylovou 1 Tugomirem 128 uvedomila 1 Theodorosem 7 stenografu 2 Stejskalovou 1 Téko 2 valr 4 spiritualisticky 1 staul 1 thuda 1 Vatthúpama 2 Sponzorovala 606 státum 1 Tigra 3 Tourové 5 Toljanová 3 ukg 9 Tristrama 1 trogontherii 1 svraskaná 1 tiom 1 superspy 1 Stackpola 2 ufologovi 1 Taxiský 362 Starých 9 Suslova 3 stejnokrídlice 1 Szmrecsán 1 Štavka 1 Tuliphordium 13 Svijanech 1 s Oldrichem 49 vápníkem 60 úcinkováním 1 Vchynsko 1 SyMenu 13 Stredovekou 4 Varghese 44 svetnici 1 vešanje 1 sváé 1 tvrdé l 9 uposlechla 8 Tojoo 1 spojitelná 1 Straßenkarte 2 trhova 13 Vacar 1 tutoyer 60 SRS 1 Strigeus 5 Stvoreni 1 spojíte 1 Vaccaj 2 squilla 1 undetricesimo 8 verts 1 Stricke 1 trajectory 1 Steamrolleru 1 stigmatika 3 usmernila 1 turski 1 trofejé 2 svatoštepánský 1 Tolegen 1 velkoprodejnu 3 Stemyr 9 spolupachatelství 2 Tekavejší 2 ukvapenosti 3 Spencem 4 svacin 1 stéblovka 12 valašském 1 Sutjaginová 1 Svecana 1 typomanie 1 turianská 1 triasického 2 tunomíli 1 Sulaoja 1 Steinigung 1 vejrakova 1 Tenonovou 1 štenýru 14 Tertia 1 Vendikar 1 tristanovský 2 Usos 1 stockholm 1 Tuzluca 1 strádac 1 truskavka 1 Tucekit 1 téme 5 štítonose 1 Vanvinckenroye 1 Sümpfe 3 Stygamoebida 11 tancírny 2 Trákii 37 vandalu 1 sparagmitový 1 Varsoviensis 1 Sweelinckove 1 Todome 1 Teufenbachu 113 trestán 1 Ukrinu 1 Vereinfachtes 2 swj 1 sylvatickém 9 trezoru 3 Teurajärvi 10 UDS 1 Streptoglossa 1 Stangem 1 sufficit 2 Valecské 1 védántou 1 tragu 1 usedlejších 3 veleduležité 1 Uribou 1 Tukku 4 Syagriova 1 Theilerióza 1 s Aloe 5 Telegraaf 6 Vénu 1 Tvćrĺ 1 u veškerého 1 Vašské 2 Trinitiho 1 Svinte 1 s rekonstrukcí 7 TACA 1 TOMovi 1 trzesie 5 Tesarská 1 Ununhexium 111 Vetev 1 trackové 3 Terterjana 1 Tabátabá 35 TennisTrophy 1 Stanleyella 4 Theofrastova 5 sýrových 2 subtil 1 tenno 2 tyrancík 1 Sudmann 309 ventil 1 variationi 4 Valtournenche 2 tríetážový 6 Velebudické 1 uniplet 3 trapezuntský 1 varvová 1 sprinterku 1 UseMod 1 Superwizjer 4 Twiste 1 Ursuleasa 1 tabulkovitými 1 Verschmelzung 1 Sulliven 1 Strimické 2 tucnolístek 2 Teis 4 ustojí 4 ututlali 1 Strzeiesewoy 1 Srozumitelnejší 1 Tschugg 1 tesklive 2 Ukoncující 1 Unterrappendorf 2 Stácená 2 subseries 3 tetrandrum 1 spoluprá 1 umbratile 1 trickového 3 Tapirira 3 Srodkowobeskidzkie 31 útku 2 spojným 1 Sugcän 3 Trojánky 7 subkulturám 2 Verächtern 18 TEAM 2 Ssangyong 11 Svetýlko 2 tahouni 4 Turcak 2 Svatohor 19 uražené 1 tlumenejšími 1 Úy 1 tlumocnickými 3 unset 1 Stresující 2 spermatikos 1 Vefelov 3 Úsudkový 6 terapeuty 4 Tejat 5 stredoanglického 4 TULF 20 Tatula 4 Terminálu 11 Steenhuisová 1 Változások 3 Technikami 1 Sunja 316 Veselé 2 Syrtském 1 verenigd 3 trojtraktovou 6 Užil 2 tanvaldském 2 Sumurun 1 Tesákových 52 Stordahl 1 Tsodikov 2 urezání 1 Taxidou 44 vajecníky 1 stramineum 1 unculus 5 Štefle 1 stomilionového 6 Tešitelu 11 Tairy 3 úlevovou 1 Steudela 1 Uverejnuje 1 supermarkete 9 Unofficial 3 Tarbatu 2 Tešova 48 uhynul 4 Vajskovský 2 Tvrdovic 3 Trsztena 3 Tamirovi 1 sparknotes 2 Tárikovo 28 Szewczyk 1 theaomai 1 sSvržení 1 Tessler 183 stanovištem 5 Tatko 1 TYU 1 Stuhlinger 1 Strachonic 1 tézí 3 vermelha 19 ucpáním 2 Turpina 4 Überall 3 Terešove 1 Tintinnabularia 1 Sporochnales 2 Stubaitalu 4 Titanikem 1 Vedeckovyýzkumný 11 usazující 4 uvarilo 35 soustredením 6 Suryová 1 Übersetzen 115 Sulu 1 telefony iPhone 13 Terwilliger 2 Tarnobrzegu 1 Transformovaná 1 Stovin 37 uspokojí 7 Stanislawem 1 Táboritští 1 Timofteho 1 synem 1 tenkozobí 1 tymbály 106 UÇK 1 uštipování 4 Suský 1 Turoczy 2 Vám… 21 taveninou 48 vanadu 1 Taliaferrem 1 Teufelssteg 1 tattva? 2 sssr 2 štetová 1 udrzitelne 1 Tadkla 4 UserName 1 Švihuvek 1 Tracyton 1 svinutých 2 útja 20 tuhnoucí 1 trankeera 1 svudníku 1 Utos 2088 Texas 1 Subalpina 1 vcelarští 7 vanadem 11 úraduje 1 startujicí 9 Thurzovi 1 symbolic 1 téléphones 1 Tesácková 1 valtiopäivilä 1 statuaire 1 ustavem 1 Taterma 1 tára 115 Theol 13 Štedrone 1 transoxiana 4 úmorové 12 Vestre 55 Stopar 2 Thaddeuse 1 Thogoto 1 Urtriebe 2 Šrejnara 45 tubusu 2 Sportsnet 1 ŠTÁB 1 SPCCH 1 Trithyria 2 Tapieho 8 tortuosa 1 Svetlacok 2 subotickou 4 Sydänmaa 45 Trešnáková 18 svetelského 1 veltelini 9 svrchnokrídový 1 vampýrský 4 Stežove 1 Szumilasová 1 Unnelandem 3 univerzalita 1 Vedeckost 7 upoutávala 3 työ 5 Trichocerca 1 tddl 1 Tašbán 492 Štýrském 1 Vampiir 1 tangchangya 4 trichomonózy 5 šš 14 utvárenými 1 Stracinské 2 udolina 1 Steidleho 39 Thanatos 2 thorakoplastiku 9 Tajiny 1 Spannocchi 5 starszy 1 s turnovskou 1 urbanizovanými 1 ULAA 12 sporitelních 1 szükségszeruen 4 Televisió 1 Sponheimskému 1 Speedfolter 2 Ununseptium 1 Teutonskému 1 Spasském 1 supergenerála 1 Trstienku 49 Tajemník 7 Štepanic 1 Ugento 1 trigellského 6 spiritualia 1 VanDevender 2 Šuudan 2 tvarovatelných 288 trakcní 53 sverep 1 Strelna 36 Tebou 1 Veslec 1 státnik 4 Versfeld 3 uchovávanými 2 Trecca 7 splnitelné 1 srážkovoodtokový 223 ukázali 1 UMAT 4 Steenbergena 2 sublimovaný 19 Užitím 1 UTVOS 1 Uvozena 3 ultrafiltru 71 stretem 1 tolstolobika 1 úctyhodnými 1 synkopám 1 Tolaru 2 TAGS 7 Tancovala 1 Venglošova 2 Štruncovy 1 strakapoudy 1 Togolaises 2 Touchorin 4 VEL 1 UMREL 1 Tutting 1 Vairócanovými 1 Štátnym 2 takaisin 6 Tochovicích 1 Triodia 2 Suleymaniye 1 Uneigentlichkeit 33 srandu 1 Trojmezný 4 Tycoonu 47 verejnoprávního 1 tagorei 2 s konatelem 65 svetadílu 2 staat 70 Tancící 80 trojboce 3 Szunyogh 29 triumfovali 8 Štec 1 Suszter 4 Valcák 1 Tauská 105 Vašem 7 Vaneau 1 verboden 3 trípruhá 1 Tanluan 13 Szécsény 1 velandis 2 titulovém 266 teplomilné 14 Šporkové 11 truhlicka 9 Sudín 125 Tyrannosaurus 9 tovar 1 Vaalbos 4 Thornbury 1 Týla 1 texCUBEproj 20 vetvitá 4 spoluator 1 Tóka 7 Ugry 1 Szyndler 2 Syncosmetus 2 Thellung 1 Túžím 1 tyhan 1 Steplingovu 1 Tojoguci 1 Tripolitanus 1 strelné 1 Tersilli 1 Stadilce 1 stind 1 Upovídaný 2 Tadajošiho 2 tolkiengateway 1 Szech 1 Tatchella 7 trambusu 2 trmenových 7 tuman 1 sulfatázy 1 Spritzz 2 Veinberg 1 tújová 1 Tobasco 1 stearín 503 Velký 1 Sternanzünder 1 SubPortalId 1 Tepihu 2 Szeklerský 4 Tiptona 1 Tebuna 1 tesneny 1 Spoluclenové 4 Syrákús 2 Thoren 1 Tarzu 1 Trencavelu 1 svarabhaktický 3 trissino 2 Starobylým 1 strany TOP 1 stehovce 1 Tkalcovskému 1 Tumatu 1 vanadových 1 Tynesidská 6 Strenci 3 tiková 2 trollování 1 Thermopilon 1 Valdštejného 1 ustrašených 8 transvestity 1 špatnostech 3 Tarkenton 13 Théraváda 4 Turbovický 1 stekovec 12 velkouchý 1 Svámínárájanovi 1 trenérske 3 souznela 1 Stages…Best 1 Teppouo 1 subkomentáre 21 Taylorovy 1 Velemyslova 1 Tepatitlánu 1 Strukturanlayse 1 s ukrajinskými 4 Technician 2 Šprotavy 2 Suppe 1 Synku 588 spolecenstev 15 Tortuga 1 Stoiku 6 Thoreze 44 ultralight 1 talassica 8 Václ 1 textarský 14 Tarbíkovití 1 Stenosolenium 1 Takiguchi 1 Sprachbilderwelt 187 tažením 55 štafetový 1 speculatores 1 tropová 3971 vedlejší 1 torsy 1 SSTA 1 transpolarizaci 12 velmožové 3 supsetneq 2 tónovaných 1 stredopásmovými 1 Treb 1 tracey 1 Sveksnaevangeliku 3 Uly 38 vedomostní 7 upnuta 1 Ssimanow 1 Trinummus 1 Srzyezaw 1 Synclinal 1 SpiderSpins 1 thalicroides 1 Turistictí 5 spankingu 1 Veselícský 10 Touchet 12 Uríse 1 Tyrod 1 timma 7 štvavá 1682 Sovetští 1 Troicko 1 Starodarbnjojski 13 trojhranný 2 Sychot 1 tomtuto 1 Torlus 2 Tlon 1 s adaptorovou 406 stížnosti 4 Tuchacevský 11 székely 2 Spodního 4 umocnovány 1 trifenylarsan 1 Tremainem 1 Tardio 1 Stevové 2 Stosswihr 1 tekstiä 1 strívkárna 4 Tatrzanska 15 Toucy 8 Tithymalus 3 Teme 1 Spitzers 1640 staroveku 2 Turolla 1 tvrdochodci 4 Transcendentalismus 2 Tarczal 1 Übersetzerpreis 1 teletex 3 Tožští 1 spartan 2 Vavácek 10 Tempra 1 stredecské 5 teckový 1 Trystan 7 Štáflova 61 Utica 1 Torreano 1 Uromyrtus 1 Toubiana 3 Trísove 92 spolecenstvích 1 Takasugi 1 Tanai 25 tmavohnede 4 Švub 2 stolníkovi 10 usmiruje 1 svSarkandr 3 Velešínem 1 Termoformingu 1 Televiziunii 86 uchovávána 1 SZokraj 2 velkovýkrmny 2 Stinsfordu 4 Terabyte 1 Tajgu 1 Tileorasi 2 sunuty 22 vertebrae 3 Tennysonuv 75 Sukorady 1 Vcelpo 7 sztuce 2 trenažery 2 thisislondon 1 televotingu 5 tercky 1 StereoSale 2 Tulimyrsky 1 Srbiji 1 Usirew 1 špachtlovitou 31 stavbyvedoucím 2 vazospasmus 1 Valenwoodem 3 Tarzia 6 Tast 5 Toxocaridae 76 taktickou 16 Spolecenskovední 12 Tuvinština 6 trefování 5 uprázdnilo 5 vepštine 1 tríbarvená 1 Strigosella 2 Vadimovic 1 Truwisa 10 TNTC 1 strofám 1 Veštníku 1 tyda 6 splatných 211 strávených 3 Taksimského 1 summitové 1 Tukanem 4 usušen 2 tekutinové 1 spojivkovou 1 Vandel 1 Tacazzea 2 TYLDESLEY 8 tlouk 8 STAG 21 tvoja 1 Valčreovi 2 Tatliakovy 1 Sueurs 1 Tandelmarkt 1 Uchikawa 100 Šterba 1 spaightwoodgalleries 2 Štenicovití 1 TREUEN 1 Svodnica 1 špací 1 Splávky 20 spišský 11 Toxopeus 45 superzeme 1 Tešitelka 2 Trebechovicka 2 Vanilku 4 Šri 1 Ungarndeutscher 1 ujednotilo 318 usilovat 1 Tydlitákem 5 spoleczna 1 Velsinie 25 spáchaného 14 Taco 1 Statenicích 84 spadnout 3 Teslove 1 trúny 1 Soutružení 1 Ulanbátár 1 stvoritelky 2 Stredojakutská 1 Straszilowa 6 Speciesismus 1 vedeckofantastickému 1 Thulinovou 4 tokamaku 1 svinicová 1 vagabundu 2 turmae 2 Stirniai 1 Trivette 108 Švandovo 9 Tlali 3 tyfovou 1 stemaria 1 Tomikim 2 Uusikaarlepyy 7 Unu 2 Tejar 1 vanilová 1 Vatatzova 3 torez 1 utomatický 1 Takaminem 3 tetraedricky 1 Stasiunai 2 Strešovickém 1 ulíc 1 thymomy 1 Verkehrsverbindung 2 stopp 9 torrentu 13 Štancel 1 stamiliardových 1 Tereweng 3 stratosférické 1 Vadžrou 15 Varínka 1 tenzním 7 stellatum 1 Tygrímu 1 Usso 1 Turkoavarum 3 Trkmanec 30 Trichuris 1 Taškentané 5 Tapis 6 trichlorethylenu 1 tak mediálních 1 tlacívalo 28 Stok 1 sucesos 1 Svatonsky 1 splanchnickou 1 Världs 4 trojbokém 1 Štajnerov 4 Vašíku 2 ultrabazické 1 tónovacího 1 Varnja 257 Teologické 1 svetlupodobný 1 Submaximal 1 STOLICZKA 1 Tlustší 24 teenagera 6 teratogen 2 Theofilove 3 Svojanovem 3 sphaerocarpus 1 Synchronizátory 80 tkalcu 1 suqutri 2 Tamala 3 tetky 2 tambon 2 tenzorovým 3 sylvaticae 5 tét 2 uol 1 Suklaphant 1 tvarovka 2 Stavrakis 3 Stelmaszczuk 1 VEROZVESTU 3 Toulouské 1 Tarzanu 1 Usuzují 1 Trepanierem 222 tmavých 2 taubachien 4 úšovické 23 Typografická 1 šupky 6 spolupachatelé 3 Vaišnava 1 Verwaltungsvorschrift 1 Šumede 6 strone 2 synodickým 1 tamoles 2 Tužínském 15 tyranského 2 städer 2 Turgenevskaja 1 Upustila 3348 úkol 1 trikodér 1 Stroin 1 Témouchent 1 Tarcsafalvy 9 Terlago 1 Trehet 22 Správnost 5 Västerbottens 1 trafíci 44 Turbine 1 Teodory 4069 Vedle 2 Vaalimaa 1 Uffici 1 Valecove 14 Trabajo 35 Spišskou 1 Verburgová 1 Tolkkinen 10 Tamika 2 tablugu 1 sprežla 1 Tadjoury 2 spoluobjednatel 1 Štangleru 2 štajnhajmské 3 tbinom 3 Úkrají 3 stretta 7 Synka 1 Tamro 1 strene 2 tänä 1 Urningin 1 Szarvaských 1 upozornujici 35 technet 2 Uraš 7 šroubovým 1 Therkatz 1 Stíra 4 troly 1 Torrearsa 1 Tajmená 1 štyrský 2 subdisciplínu 1 TTVN 21 ústrednímu 1 Tašpulatavová 1 Toporowé 2 strastoterpec 1 Toddblumberg 4 Špicové 1 Symonanthus 3 spolupredsedkyní 2 Tisona 2 ustanazasto 1 Steegstra 1 spolurediguje 1 tuhlicích 14 Takaciho 2 Subhumans 3 stávkují 1 Stitova 3 utkvely 1 tocharskými 2 Steinsberku 25 Tadao 1 Tuldovi 1 Superkocek 1 Teshreen 6 velkovévodskou 108 Squaw 29 švábu 40 svrhnutí 1 titiev 1 tenda 6 Stumpff 53 TUL 12 Úneticích 1 Svitramia 4 Steklacových 1 Strevlícci 1 Sukiasjan 7 útržkovitá 1 Stichmanna 29 Svéby 1 vassal 1 spoludekana 1 tetrapyrolovou 4 Vervant 1 velarní 1 ústení 1 Štrasburském 1 Svetislava 1 Triantafyllia 1 Torontských 36 Theron 122 Tramvajové 1 Tavianiovi 1 Tarançiler 1 Vestibulu 9 Velicné 1 štvanickém 1 Tizianello 1 theon 1 Tangan 2 Spekulation 1 spolupusobilo 1 Tavassola 3 Tritiová 1 Srážela 1 Steponkaimis 2 Varcholová 1 Vallach 1 Thanabauer 5 vatovec 1 verzovány 1 ušatými 9 starohorní 6 umelectejší 13 Torpan 1 tradicnej 1 stravinskij 1 tartaro 30 Vernisហ1 Srazí 1 Tuongoe 10 Tibullus 1 Stvrzením 398 takovýchto 1 tasícího 1 Vallnordu 13 Starting 1 Tofalarové 1 Sträuchern 2 svacinka 2 vaccinifolia 1 Tafern 18 vedením 2 Sportland 1 Stánkari 10 strojvudcem 5 trenérine 2 trzecia 1 thallos 1 Veigantová 2 spermiová 1 ustrihnuté 2 spiritualistickém 3 uchopeného 1 Tragödieninsel 1 Sweetzerová 8 Terna 1 SVATÝCH 1 Strašouna 25 Splynutí 8 trísetleté 1 Šumadinsko 6 Telocvicný 7 trávícími 1 Strangziehen 2 tritonu 209 Susanne 1 Stredonii 1 Tachtadžjanem 2 SysOp 1 starehory 2 stabilimentem 6 Starycka 1 udýchane 555 statistik 1 Tolmanovým 3 svaž 2 srdecnými 1 uhynu 1 Syford 1 Szepanik 1 Tuomey 1 Valvasora 14 Urfausta 2 Tchajvan 1 Tillmannové 3 spinor 10 Uxmal 2 uzrelo 11 trophy 1 sporádala 1 Stredozemného 3 Svirnupis 1 turkitští 2 štepánovské 1 Tatkonys 1 Swapping 21 Vadžrajána 1 umístnuje 1 Sychiv 4 utajili 2 Tisell 1 Termoreceptor 1 vermakelijken 1 teleprezence 2 Tréviers 1 Stopující 8 ustus 1 valentýna 101 tríclenné 4 Strohbach 1 turbofolku 1 vetiverie 1 Upravte 1 Stophovo 1 Thessalská 1 titiritera 1 Trebizondského 38 sovu 107 Svojtka 12 Veselovského 3 Tardi 1 Tsylinskaya 1 tvarohovité 1 timberském 11 Surov 23968 The 1 velekrálovými 3 Tamudo 135 ukradli 1 Usluová 2 Varáha 1 válcovacími 3 Steinhuder 1 urumoffii 1 tery 1 Stainese 16 vecchio 2 Štiková 1 ulapil 1 VELOX 1 Vertikalzirkulation 3 staromoravské 3 spades 124 Svedcí 3 Tugendhatových 1 transnebulární 2 twine 1 symphonieorchester 1 UniChrome 1 spájivá 14 Thúkýdidés 3 Švýcarovy 1 Steppensau 3 texturové 37 stratosfére 1 Tromantadin 1 úponcích 2 uškrcené 5 tlupám 1 tayammum 1 Valtetsi 37 tribunem 12 Tenenbaum 3 Torslanda 10 ÚBOK 1 Therasia 5 Soustredené 2 veterovských 39 USER 1 Sterilování 2 sporožirové 26 Trusted 3 Stumberger 5 Tollyho 1 Uciová 1 troubivými 1 s hromadnou 2 Urobora 5 Tombalbaye 1 Štáhlavem 1 s držitelem 1 uponkem 3 Taungského 1 Styronem 2725 Vera 2 Vasarimu 1 Specjalistyczny 1 trylkový 2 trídení 157 tenkými 2 Šperechta 1 TriQuarterly 236 style 5 Spilogale 3 Tsiang 4 Stringfield 66 uvedomují 9 Spivak 1 syringaria 14 Superhero 60 úmrtní 2 Ubaldiniho 1 Starschedelu 1 tanašita 1 stcl 1 trachyandezitum 8 úctovaly 9 Valgaš 1 SturmGewehr 2 velkovezírovi 2 Turého 3 tchingu 1 Starik 63 Týnice 2 Tsoundzou 16 svolaná 1 uovice 1 Uhlenhopp 1 Týfonem 1 ticketingu 14 Tlouštík 102 Unicova 1 staroružová 40 Urim 5 TME 6 Tarraco 1 Šponka 1 švindléru 1 tvárnicí 1 Spoa 1 tetrahydrofuranového 12 stanislav 24 unciální 493 svatým 2 Tharaux 1 srdužiti 4 velkooperním 4 Tianetie 1 typographischen 2 Vasevová 1 spermu 1 suli 1 tomatillo 1 Ururimi 3 tuctové 4 Šuvajevová 2 Tarská 1 Szúcsgyertyános 13 Švandovi 1 Thuti 1 Steimarovou 1 Vanca 1 Sviridové 66 uvolneno 1 staronovému 1 timových 2 Stržanovu 1 Vedrim 2 tercového 1 šturm 27 Tobrúku 3 štatistický 2 Verkaro 1 Tárcoles 5 turtle 1 Stenosiphonium 1 stredovekáru 1 urguje 3314 týmem 10 Úderem 3 UNCRO 1 uvolnujcí 1 SPŠA 6 Supercela 4 Stryjová 5 ukonejšit 2 trapin 7 tuleních 1 tannovou 2 titulary 17 vápne 14 Torelli 1 tasili 2531 Svatá 5 Transmissions 1 Supella 2 Vallans 1 trastuzumabem 6 Synodus 1 Thumbtack 4 umenšen 13 Travnatý 1 Trolltooth 2 Šumnik 312 STAN 63 Telekom 3 Tüšetuchánský 1 velitelstvi 11 Tavurvur 1 TOKIU 1 Teutonici 1 Spenningovi 41 uniflora 4 valše 1 tribunní 1 Švestkovo 1 Taraškievicovou 3 Teasdale 1 sterne 5 udržovacího 3 startx 2 Tybergova 1 Stampflovým 21 Velkolepá 2 Tocane 1 Veinottovy 4 Tirisfalu 1 Trevona 3 Swinson 1 Šponami 2 uznᚠ1 vconfig 9 Sybila 2 týdenníku 1 talibánce 1 vedevši 2 Trixen 150 surrealistické 1 Súnoga 1 thiofenu 1 tééép 1 Štverták 1 Ústavodárnou 1 Stephansdorf 352 španelštine 53 šunky 35 Svoru 1 Tragonoros 1 Tagliaube 1 šroubárenském 177 UIAA 406945 ve 2 soustredeními 1 Trivexu 1 trachelektomie 1 tigron 7 uzurpátorum 3 Syblík 6 Swindell 1 Stockingra 1 Strezislavou 7 stavebnicového 3 Veltha 2 Thilman 15 vest 2 tichooceánským 1 superschopnostmi 1 Únešovský 1 Ubon 5 Vermiglio 4 Studnica 1 Tartyzjan 2 TMM 1 Thunlina 1 storting 1 Sundřybrua 1 Verschaffeltova 1 Tormodem 5 Stárkové 1 Spitzel 1 Venušanu 1 Szökene 19 tranzistorové 21 titanicitého 1 Valériane 1 Sucka 16 velko 1 Stritchovi 1 sujetoj 8 Tedd 4 steh 1 stenamy 2 synom 2 štára 1 trest odnetí 3 Spolecznej 1 Tadjedin 534 švýcarském 90 Vesnicané 1 Tsutsumarete 1 trneného 13 úhorní 6 Suriname 6 Úzus 1 Symets 1 stegosaurovití 1 Tuomů 1 Tellicherry 3 Tarekem 1 Talarczyka 1 SWLABR 1 Sugár 1 Thaletove 2 stareckové 2 Terasovite 1 Tovtry 36 stocená 6 spisovatelovo 3 vetchozrakosti 1 Thirova 2 stopkoocí 1 Utvous 1 špionovy 6 Tréportu 3 upírská 5 Spronsenová 1 Stresimir 1 trébol 1 stredohorní 201 stávku 6 Suat 1 Strazna 19 Torišima 1 trubkonosé 3 takovíto 3 vcítil 2 Unimara 2 Stupnovite 2 Teillay 8 upoutaných 48 Tenké 20 Tuzexu 2 Turbovou 1 TeamGym 1 Tangokönigin 1 Štolcove 32 vcasný 3 Terezku 1 streetartová 2 Stonema 1 tiik 7 strašily 1 Šour 1 tartes 1 Vermessungskunde 10 Sudkem 1 trináctistupnová 1 Szepetowski 1 Trenchcoats 2 tegmentem 2 Úplnkový 1 Turgajskaja 66 Szentendre 1 stakan 1 Tríbubnové 1 subgenomických 44 Svenem 8 Streptomycin 3 Tardinimu 2 Sverákovo 71 srazit 17 Steinerová 2 Švochnev 31 SpongeBob 1 üä 1 srovnávacek 1 Spojler 1 Sperrsechserl 8 Vajner 1 startbit 1 truecrypt 2 Verfemte 1 Špýrského 1 ústaváci 1 Swjate 1 Vašírova 1 Velopolku 25 Veselsko 9 verwandt 35 stvrzení 1 Stenstaden 1 šovinisté 1 tethys 1 verstecken 2 Stadtilm 2 tesknie 152 tlamy 2 Spideru 3 spacího 2 STACKSIZE 2 vcucla 19 Tulení 1 stretové 2 Újvároska 1 trebicske 1 TARANT 1 Tuktamiševová 51 sprinterský 2 Toop 1 Szimo 1 Supertatry 1 transgresivy 1 Spatrilo 5 veslarek 1 spola 8 Troskovické 1 Tynemouthem 2 tergity 2 úsmevy 2 Svärdsorden 2 Torsteinu 3 Tyreeho 1 tipovanými 3 Vasylem 4 Tartarau 1 Stoltem 1 Überkingen 19 squashi 8 transferáz 8 Underdog 3 technizace 225 splatnosti 2 ulétlo 5 Terenzi 15 Thalberg 9 ÚJCS 2 uloupeném 1 Trizma 2 trénovanou 1 Spolecney 17 Turice 6 Sperl 2 spolupatronky 1 Takticum 123 teplém 1 stosunek 1 Štolpišských 3 vakonoš 2 Srovnatelným 1 Stavans 37 spotrebovat 3 transhumanistickými 31 veršovanou 5 Vashon 1 Sulmán 1 stabilizátora 1 Undershot 1 Steinko 1 Tedorigawou 1 Sterberga 11 Stephani 2 Teyssieu 5 Vaidas 2 Sverdlovskaja 1 Triciu 12 Thursdaye 2 Šperkarský 2 spermicidu 2 trinecká 807 veškerá 1 Triliontina 4 Terk 1 Vanluchene 453 sourozence 2 stezkahistorii 1 špatné…ale 1 u pacientu 1 Tusculu 2 Tschaval 4 ukonc 3 Trojkolka 1 Tupliaši 4 THOMA 53 Stille 4 svahilském 83 ucilo 7 Vancík 26 UNIFIL 1 Titolo 3 úsluha 1 Szegerdo 21 tabernáklu 1 Tiplíci 2 tenorum 2 Sverigedemokraterna 3 tragicností 2 štítit 1 Undicided 1 Stangov 1 Spotrebitelem 17 thin 1 tikr 1 toluové 2 s prírodou 1 Valonen 4 úvalský 25 Tresín 42 startujícího 1 Sprachschatz 1 Sussieková 1 stárá 1 ssllabs 1 Tobertonu 1 suchopýra 1 traumatologa 1 Uketsugareshi 2 sulfadiazin 9 Stockholmský 43 úverní 14 údelný 523 textilií 4 trempy 4 Tavi 1 ULANFullDisplay 12 stredozemních 2 Štefancíková 5 Velocette 16 špinavého 1 Suzzane 7 typografickým 7 trpena 1 úspecných 3 Velli 1 Sunaye 2 Upstas 1 Šurian 1 Tallys 2 thymotické 5 Strömungen 14 Stravius 1 technickobezpecnostního 2 Trautenberkem 1 S predsedou 1 Šurdy 5 Sultánova 1 Tapákom 1 Sviatopolkova 53 termiti 1 stojáckovým 8 Verovických 1 sprašuje 45 strojnické 1 Vavrine 3 veroucném 6102 staré 69 srovnatelných 2 Thernobog 2 váh 41 Stredozemnímu 1 UNDC 2 Starynka 4 velitelstvími 51 trestáni 1 Trilocularia 1 Thiédot 10 Tršo 1 spekulum 2 Terville 1 trebichovice 2 Váska 1 stríbrohrbetém 1 Tocki 2 starnov 11 tendencním 11 spermatidy 3 Varreddes 2 svet… 1 Utilitárne 1 Süg 1 truby 1 spoluúcastnického 1 Ukrajinski 291 Šumavské 9 trpaslicímu 1 švestkovna 1 ústricníka 1 Töpela 165 tykadla 20 Transitional 86 trídílný 3 valorizována 4 touho 2 tahadly 2 Tutshill 6 Vancuruv 1 Syenitový 1 spolešne 3 syntezátorová 1 stoupenectví 1 Symetria 52 Tilapia 3 s prvky 1 tülchüür 1 Thamilselvan 1 Tedjakusumová 2 ufficio 1 stratiotiku 2 Ternopilska 17 starovercu 2 tesareský 2 Tennenlohe 5 Svatka 4 Svetlíka 33 Trout 1 strídavolistém 1 tnutím 74 svatováclavské 11 Tálibánem 5 Treponem 1 Tramontin 78 Tzadik 1 Sovojic 73 tobolek 133 stand 40 úrokem 1 Tušcibas 1 Tulcynském 5 twórczosc 2 spotrebujPolozku 4 Sulkovský 54 Ukraine 3 uhnízdil 1 Usnulo 3 Stratocaching 1 Tajsa 4 Strehlen 2 souosou 4 upéci 1 Temnotropidae 1 Vadeikis 1 Tálského 1 Succe 1 Symbolistického 1 Untergeher 3 valkýru 1 tangent 1 thoriová 1 uzrávalo 6 strýcovi 17 textes 1 Srakové 1 tangerina 11 Stredou 1 udereného 1 Urelim 3 uter 1 svatojosefské 1 veštím 1 Thaiboxaren 4 Tanurdžicuv 1 utíkajíce 1 Theodorovu 1 Taniere 1 umbrijštine 1 Ucnum 5 Taung 5 tuponosých 453 Tunel 1 travovitým 10 UKK 13 Úhretická 7 Spicer 46 Stanem 2 Tjilatjap 1 Vachalec 4 únorovému 1 Spiha 1 Sunnega 1 Turkheimu 2 tešanští 2 tóg 13 utkával 2 Tehož 1 Spolecnic 7 Taniguci 1 Tepalum 24 Trnovo 1 Trajkovic 13 souperkami 1 trivialite 18 Tavira 35 Spuren 1 Torunia 2 thirdhand 24 ukijo 3 s rokem 1 Stühlmeyer 1 Tanové 1 Štrit 3 Stefaniin 1 stimatissima 1 Tupapati 5 Strážkovická 1 svrchnokambrický 1 Tsogni 20 touchdownu 1 Stuška 1 Uladendron 56 Task 1 Tamaroffa 4 transportnímu 4 Troskotovicích 1 Sstiepanowu 2 Szentborbás 1 Totosai 2 velhensis 4 Stromgarde 165 stahuje 1 Suteethornovi 2 Uittenbogaard 6 universalismu 35 toutéž 5 Telesem 2 Torcularis 2 svoda 6 splacený 1 Teeley 30 Tutweiller 1 uznávaje 6 Talev 1 Vallonem 39 štolách 2 tohot 1 verbenu 1 Tabalu 1 stríbrnickému 1 TnH 1 ubroušena 1 Titanatý 1 tarapotina 1 Untertiefenbach 2 Sussudio 1 umožne 1 Verandách 13 strádali 6 ustálenost 1 Umeni 1 Transfúzi 1 Štírka 1 turbovýtah 3 Trunecková 3 Splinten 1 sulfobismutidy 4 tovacovského 1 Sukdola 4 Tissy 1 staroanglickým 13 továrníkovi 1 Uvachrom 18 souvislými 2 Stabilizovaná 1 Tísnen 1 Urbanina 6 Venema 2 Steinsland 4 vaš 3 Storchova 3 Suchovršicích 1 svolavatelu 1 Timofejevice 1 uvolnen 1 UNGE 1 Svere 1 Trifonovem 69 špicí 2 Traiasca 2 s Francouzi 63 usazeni 29 tenisoví 1 spravovatelnosti 27 Stranovský 1 Toukh 7 Stadicích 1 suffusus 1 Spraye 1 s Uncasem 2 Tonkünstlerverein 2 srovnávalo 1 Tyma 8 Väätäinen 8 Umsiedlern 2 Tiberském 8 Strachotína 54 Vedlejším 1 Tehlirjanovi 1 Underberga 1 Tatischeff 2 Sulajmáníje 1 Vaišvilkase 1 SUCHOMELOVÁ 1 Ujímání 1 tjloko 1 Tlustém 1 ušmudlane 1 soustrastí 1 Urzadzenia 1 SUDLIANKOVÁ 4 Tasmanem 5 Tutsiju 1 s verejnou 1 Vasju 1 Stachanovec 2 šroubovicového 1 Unterteuerting 2 suburbanizací 1 Trappuv 3 Urputný 6 Verberger 7 Tamarind 2 Stepanenko 2 Ujházyho 7 Tématické 46 Stripped 1 Stoicky 238 sruby 51 s tím 5 Vaganov 1 TOUPE 14 spekulanty 1 suputiit 1 spiritualizovaný 1 superlativem 3 Svede 11 Terrellová 11 Vaudémontská 3 tvrzenými 537 válecná 2 Uhwiesen 3 svarencem 113 urcili 3 Tomlak 12 starogermánské 12 uldská 2672 umožnují 1 Vellaeanum 1 Takujó 1 SÚH 1 Válecníckými 2 Vadnaise 1 Tooleem 14 Strategického 3 tulpas 2 Symantecu 35 verde 14 upresneny 1 Úvodnice 1 Veniro 1 Veteš 7 Tinh 44 Teriéri 1 Spiraxidae 4 Teylu 59 Stevenem 12 TTT 9 Trams 26 Tapolca 1 Süedâ 1 STATECH 1 Stuffy 53 sparta 3 Sphindidae 1 Trentola 30 Sovových 1 štajerka 1197 útocníci 1 uennalis 2 veritaséra 12 texts 5 ukazu 24 supravodivých 1 vasokonstrikcí 25 totožní 1 Szöcs 1 Synonymen 3 uhlírských 1 trimesacného 1 tichooceánskému 1 Tomboa 1 Tschernhasen 1 Varennské 1 Vartkes 6 Toribio 2 Syöte 2 soustrojími 1 Thalové 7 Tchajwanském 3 svobodomyslnému 1 tidsalder 1 vecicek 2 Turbovrtulové 1 Verzeih 8 upekl 7 Turkuty 3 sundávání 1 traseologie 52 strechovou 1 Tochtli 237 Tucek 4 Spaeth 7 spalovali 302 Strasbourg 3 transversae 2 Tamorou 51 vektorovou 7 Sypaný 1 uttant 1 VEntilation 23 Swardtová 4 strlat 1 Stum 1 Veselye 2 thespesie 1 šterkopískový 1 Tauše 1 Stokloßa 3 spocteno 128 vedlejšího 7 unikatni 1 Thanlyin 3 Tennysonových 1 thasijské 1 Szrenickiej 2221 ucil 1 Tharcisse 1 spańa 8 Svitavami 2 stravaganze 1 twta 1 Thyrel 1 Tluksové 3 Svanidzeová 4 teleologických 10 Späte 166 Sturmbannführer 4 ve? 2 šterkopísková 2 tentakulit 2 Tamilci 1 Uvodská 1 tripartitním 6 stejnorodý 2 Ulak 1 Transpadánské 1 stinova 2 souvýskyt 1 Terentianus 1 trávníkách 2 Vanendert 5 Valehrach 1 upjatých 2 Valjevanu 1 Terpen 3 Stratholmu 1 torysa 1 Thiovulum 4 Theofilantropie 14 utajeným 4 Trichia 12 šterkovou 8 Trema 7 spem 8 Svatošem 17 stranící 236 spotrebice 10 unicornis 1 thaumaturges 1 teorievelkehotresku 1 Trondr 15 Stícany 1 trojmezi 4 šplhadlo 1 S O 3 Trebelské 1 triálu 4 Srškic 1 Subáhovi 1 Tenochtitian 25 Tanga 2 Transmyokardiální 4 strukturalistický 1 SZÖVETSÉG 1400 terminologie 1 Thufason 1 Úrdhvahasta 1 upadnouti 5 tabletku 13 umierajúceho 3 Tenby 1 Tct 4 touchant 1 uhnízdeného 7 vanicce 1 Staromyjavská 645 Svatba 1 tríhrotý 2 sovmusic 2 startujeme 31 Ucená 1 Stechardovou 1 Trioleta 9 tíž 1 sysopové 2 veniam 1 strekov 1 TUplimsoll 1 trojsingl 2 Trenev 1 tiflíského 2 TSgt 1 turcanských 2 srstíni 119 telocviku 1 treponemová 1 urozenec 1 Stadlmann 4 stagionové 5 Trináctým 1 Surskriboj 1 Tarannikova 3 Struycken 1 stratoj 6 vafle 2 Tradita 1 Tiziána 4 uhasíná 113 trídního 1 Stronalsit 2 SVENSSON 22 Theft 3 Strevens 3 Sundell 1 Tisenhusenum 2 valvula 1 úcasníku 1 teosinta 3 Starobabylonské 3 Tuš 1 ulítlostí 2 Trinkulem 1 tisícikoruny 1 verdunském 39 theme 15 Trojlístek 32 Typhaceae 1 vaviny 1 Thiaca 1 suchdol 17 Soweto 8 Trubkovitá 1 spellinghervormers 2 Traperia 1 Streissler 1 Trekhova 4 srdcítá 2 Umibe 1 Tungstit 1 Stavridis 2 týpka 3 velkýho 1 Ussishkina 26 vakuem 1 týlnímu 1 stežnum 1 Ustojí 1 trumfovala 3 Strengberg 1 úlisnosti 1 Taenoithrips 29 tubusem 3 tricky 36 sterace 10 Syrovým 3 strukturová 1 umenovedná 20 váhavý 4 Tremml 1 Švejky 2 talita 3 Staremiasto 2 Tirthankaru 1 Stokowským 1 Štvánové 1 Tangah 2 trifluormethyl 1 t?u?wá? 1 stkáváme 1 trimethylhliníkem 4 Sytou 1 Se 2 Sturnia 1 Tevyne 1 SPENCER 9 termodynamickém 4 Stene 2 termalizace 5 ugandskou 40 submisivní 2 sporangioforu 3 Takša 1 vápnite 1 Titovka 430 stanoveny 1 surgutský 1 tulkarmském 9 Švihovskými 2 Therosaurus 17 Thorens 1 ummi 85 transkripcní 1 uyato 2 Terasou 1 Verdienstenorden 1 Stanislawova 10318 stranu 12 temporale 1 Tensőes 10 šperkovnice 2 tricátková 13 úchylka 1 úlekovou 39 Trvaj 9 Tepuia 2 Suminová 3 velkodustojníku 1 Titrací 2 Stunfisk 1 Tiergesundheitsamtu 1 sritto 2 vepríky 1 Varika 1 totalizuje 1 tenuifolia 4 vazacský 5 Swinub 2 Vardino 1 Tsintikidou 5 Štebih 1 Toggenburger 1 Tolemaide 2 Spicoluka 8 Trogoniformes 1 tanier 1 vejicku… 383 svetelného 1 sustav 1 televizvním 1 treláži 1 úspešnímu 2 sukulentum 2 tlumocníkovi 1 tertiarius 5 Tesným 1 svetlomilnejší 1 Vazoaktivní 1 Ulubate 3 varnsdorfském 1 thiokarbamáty 1 Uggovka 127 Verejnost 42 usmernit 1 turbadúru 4 Uwharrie 1 urbiae 1 Stodoligka 1 Tallarnští 32 varny 3 Tatsache 1 Suomenlapinkoira 2 Spegaz 11 souradnicovým 32 univerzálnosti 3 StVO 2 ukoncovalo 15 Tenebrae 1 Stitche 28 Týnecký 3 ubmarine 74 spínací 1 Tibetsko 1 Terwilligerová 1 Teufenthal 1 šuan 1 Strelkovi 2 Transylvanské 1 sufražetkám 293 strelnice 1 Uspokojený 20 toulavý 2 Spesartu 1 Terpes 1 Utajování 1 Toquinho 3 sušická 1 úzkú 9 Stenhart 2 s mírne 1 Torfinnsbu 5 tovim 5 únavovou 9 truhlíky 3 Tirasu 2 turnoff 1 Stafinem 7 težká 15 Vedomé 2 UNIVERSITY 1 Tschischka 12 soustredenému 3 Southwold 1 Tapalcatepecem 7 Svetlušku 2 umie 1 stikla 1 Telic 2 Trichocysty 1 trenem 1 telestich 126 spálení 2 UBÍK 19 sužovat 1 Totsuzen 23 trigonometrických 12 Telesný 9 Tomášu 2 Trehalóza 3 Spycker 5 upoutávek 1 Tabarnaše 1 s prasaty 1 Treuenfest 1 Taranovovou 3 Substitut 66 suvenýru 1 Ulujul 163 stejnosmerné 312 težkými 1 uzavretá 1 Tigermännchen 1 Tulostomataceae 3 tipologio 1 totalitárnímu 17 Turkutu 1 Supyne 4 Ulicu 4 Storžice 1 vetroplacha 4 Užkalniai 2 Terény 196 statcích 3 Štetinové 1 tillity 1 velkovojvody 2 Talete 2 Stošicová 1 tripettrojky 12 stredopravicová 1 temnejší 1 Udalcovová 1 Timeslip 16 Temelkov 1 trináctibodové 1 štítkách 1 Srovnávám 7 titanovým 1 vekslácký 10 strídána 1 tetrakalcium 2 tríštnatý 3 Subsidiary 18 Testudo 2 Válí 1 Vallombrosaner 1 UWI 2 uranonosné 2 Stahlovi 1 Tricercomitidae 1 Štávnicí 3 Speyr 17 Surovec 1 Starplex 2 útechy 1 Stavroginové 1 teles 3 Trifázická 6 úchylkomer 1 téde 3 udržovatelem 90 Tristana 2 ušlehané 7 Vaillanta 5 Sporýšovité 1 spoluradnímu 1 Tahiat 13 Tiff 6 Šupák 2 Turriviridae 11 uvádejících 1 Uldora 1 Starhona 1 stredobavorské 2 tisknuté 4 Tenebrouse 36 špagety 1 stips 1 upasampadá 1 Sumbaviopsis 1 terminologiceskoj 1 Turcianky 1 Tapolylippó 1 Turtoi 1 Tourenvorschlägen 21 tahovou 1 unewsid 1 Tenury 3 tabaci 1 Strózi 5 Technoplast 1 úderove 1 Tutr 59 sverených 1 squattingu 4 tehotnými 14 Tachmasib 1 Supercolpo 1 Valty 1 Valky 1 Uloa 4 spínaným 1 Šubnikovit 3 symbolizovaném 1 tunélkové 1 teori 1 SportovniAreal 9 tonometru 3 úterku 3 Tosek 1 tejje 2 Velesvatyni 2 strížku 1 úryvok 15 Vejprnic 2 Tumatangas 1 vešinou 1 Totani 4 tarifech 2 vétalu 4 Užívány 1 Táborových 10 tribuí 1 Svacice 1 trnkami 1 Stotriadvacátým 1 trojtvárné 1 Tsirimokosem 19 tvarovek 1 Tomcsányiovci 699 sousedního 3 Téver 1 Štrosem 6 Úhoštanech 2 Spinku 1 Velocidade 6 tourmente 13 utváreného 1 versatilis 3 úlového 247 technickými 1 versologickými 14 soupravám 1 stamets 4 Vanovská 4 Trachom 7 telcský 3 Tecné 1 sycomlócawa 1 vetvicka 1 Ultraleve 1 Stromovou 1 triplu 5 šrafami 1 Sulislavic 21 stereotypum 173 Tajné 1 thiotepa 1 Spitamen 6 vallis 49 staromódní 20 strojovnami 15 taxistanovište 4 Vasilakos 2 Venofarmakon 2 Stamatovic 1 sretezené 1 Usmanovi 1 steinheimským 13 Starostín 1 Topotek 6 thessalský 1 transaminázou 1 Ulfhamrem 2 Tádžuddín 7 sprašovém 1 Sporožirový 1 Türki 3 šterlinku 1 Velniai 6 Turbové 11 trofické 3 Vasylkiv 1 upevníní 1 uretan 1 StormOS 1 uprosted 1 Triviera 1 tigin 2 Starker 3 Vertimas 1 Vasavere 2 speciálnejšími 7 varchar 3 úchyla 17 syntetizéry 3 Štúrovým 3 Suchard 1 teraristických 6 Tartan 97 TNA 13 úchytu 1 Šterbovu 1 velká cást 4 sternbergii 1 Svetlocivná 1 Suttem 1 suvéren 19 šúnjata 1 Verhofstadtova 1 Svatova 2 Surowiecki 3 Velyckovskyj 1 Stammersdorfské 25 Stožár 1 Tavisuplebis 22 tvarovaného 1 Stallupönenu 8 Valonské 5 Veligradem 27 SST 6 stulíky 2 universitaet 111 úlevy 2 usvedcujícími 2 Ungerer 4 Teratosaurus 2 stvoritelum 15 Syr 3 stavitelných 1 swoopo 1 Tchongjongský 1 Trojnásobní 1 Uždil 1 tuberkulózními 3 Ulany 9 U 1 Sváry 1 Uctíval 4 Stallard 20 Spartivento 1 trimethylbenzenu 1 Timurtašovu 2 surbaharem 622 útocníka 4 tesána 1 stezovat 5 Verecká 1 VDARE 2 Vallante 7 tvorivém 45 tvrdky 2 strambergensis 1 strižního 1 ulova 3 Vejonis 1 Takanis 279 Spring 8 Tonks 3 Terwielová 2 únikovému 4 Urschitz 2 štváci 2 Traktornij 1 Stredolevá 37 Tamary 2 Umorne 1 tocnogo 1 typovosti 1 tulcik 113 teropod 1 stupají 4 Tallaght 25 Streak 1 Tabayamaová 1 Vecvagars 1 surfovaní 1 Trinitatii 3 vejmutovkovitou 3 Székelyek 1 Temelínské 1 Ultrakevyt 9 Srbech 5 telátko 1 Tokaisky 1 Tefnachtovi 1 Svetimi 1 Teraurou 2 UCPS 1 Trage 1 Transexualismus 1 textappeal 1 Tolkkim 3 Tuscarorou 24 universitaires 8 tradicionalistická 19 sultánka 11 Upomínka 1 sudac 53 statistickém 4 Tuckerovy 5 Trhovém 1 Studentenbewegung 2 váhavejší 6 usilovný 13 túto 5 Tironu 1 terakotárství 1 Swernovy 4 tancov 12 tabuizovaných 1 tleskaci 2 užaslí 19 spojujícími 1 strmostmi 1 Theologiqam 1 szkrab 3 Trindon 95 takovýmto 2 Tokena 2 Stroustrupa 1 tajmyrské 1 úkrytové 2 spoluvydavatelkou 1 Stonawských 2 Vectivuse 1 Tettauer 1 supposto 5 velárními 1 Talková 1 Ustilaginomycetidae 4 útocníku 1 tejd 3 Ulrichse 1 Uterlo 3 Subiaca 654 Spider 1 Újpésti 23 Straßburg 6 trijodthyroninu 1 tuberózu 93 SVG 1 tatarká 2 századaiból 4 travertinového 1 Tatcu 2 tahitští 1 tomoteur 1 Timbaci 1 Tellerovi 1 ustalenému 6 Szubert 22 tridentská 2 Upouští 22 Štohl 1127 Sovetském 2 Stojou 37 spotrebním 1 velkostroju 1 Terracinim 1 Tyllich 2 Švecovou 1 Trakle 1 valtros 2 VAQUERO 1 TEXTPACK 75 testované 1 tedd 1 staropleistocenního 1 Swear 2 Stehla 44 urbanistická 1 ?umha 7 Velvyslankyne 1 Tajhte 2 Spiššák 121 trochou 2 trempink 2 Úholickám 7 upije 1 TCMDb 1 Švihálka 1 Štrasburgském 2 Spoluvykupitelka 1 suworovii 10 stereoskopického 35 Tošio 1 spatneho 51 uzavírali 7 Tencin 1 Tenc 8 trískového 2 Taitu 109 uparrow 2 Terorizování 2 Tört 2 verbeelding 2 Tuny 1 Stotisíc 1 Tkachov 1 Springbock 16 TFBOYS 1 Ucimurova 141 Suzuka 1 Sympamin 87 Vaughn 1 Subsistences 1 travelbugu 1 Tackie 1 Tostigovi 2 velkodustojnicí 1 Tetrakyanát 1 Sphaeronostoc 9 Technopolis 1 upuštené 33 sultáni 6 Trávníka 3 Tatuldu 3 vánockou 2 vaišju 1 turgorovou 2 Tilburn 1 tulpe 1 thymomamy 4 suspendováno 1 tan 3 Strzeniówka 1 Valsiner 1 Stehlícku 15 Stratocruiser 1 Tyflopedický 2 Tarragončs 5 varšavsko 13 usoudilo 1 Udokanit 1 veterem 3 Valaamského 1 Soupeaze 11 subalpínská 1 stredvém 2 Subtraxx 1 Unšó 36 topná 2 Stomme 157 spektroskopie 1 Utruš 1 SummerJam 2 Trigonometrické 1 svear 1 upravenci 1 Tribunovo 6 stahován 3 s Josefem 3 utužila 2 spoved 4 spalinový 4 strednej 2 stejnostranou 1 Turnblada 1 Teramnus 2 spolcnosti 1 Tust 1 Štítkovský 1 Ulza 2 trímístnou 8 Syenitové 42 Spacey 70 ustálených 9 unionisté 1 staroružové 2 Tobiáškuv 8 špýrské 3 Spectinomycin 2 templbloky 2 transilem 1 Stromkovicích 18 Stríbrníky 1 Vahklas 1 vaixell 133 Tešínská 1 tasarajské 4 Uvadlá 1 Tritónis 1 velmistrovském 1 Strabel 1 svetoekonomiky 64 Střrmer 1 Svatovácslavské 1 Stryver 1 Tughluqa 3 Tauej 1 Vácslave… 1 Trubickovou 1 Verdiende 3 trídimenzionálního 1 Tangenty 136 stolcem 1 umeršich 1 Verdichtung 3 Translatio 95 Squadron 105 telefonie 2 uridintrifosfát 1 Thewaldt 1 Tierneyho 1 starechovském 20 ventre 2 trojbunecnými 15 Tabgacové 2 taviva 1 útvarov 2 Tytulár 1 Uur 38 tschechischen 3 Tréal 3 Trévilly 1 ténébreuse 6 Tomšicová 94 ústupem 2 Thama 1 Tumaperk 4 trencínská 1 Usogine 5 Trcka 8 sušenka 1 staroveselské 2 svetáci 1 Statocné 80 Spectru 1 Vaivarta 1 Vápnením 2 Ulzana 3 Vestermanis 5 Strunovci 1 Threnon 1 urážlivost 1 ujímací 2 Štolní 3 Svatebního 1 Useknutý 3 Tanius 1 Trachyphrynium 2 Theydon 2 Totenberg 3 Svitková 1 stertens 8 Stýskaly 3 Vestonovicích 1 trísetletou 1 Terps 1 Vaquié 2 tocícími 1 Urbairu 1 termogeninem 1 stafylokové 2 Tarnobrežského 137 švédštiny 1 Ullreich 1 Tugarinovia 2 TopCashBack 14 Stríbrno 8 sympodiálne 1 thorakolumbálních 3 Tânar 7 Tnuvot 1 uschlém 2 TDDi 1 swieci 6 tuningové 1 strukturovým 81 tkané 1 udeliti 6 Teslovy 1 Traisenu 4 ulcerací 2 spinká 173 Stálé 2 termofor 1 topela 1 tímpádem 1 ubydlením 1 Unicycle 2 talentech 1 Šuvarská 36 uhlír 4 Švermovou 3 Togdheeru 1 Urserental 23 Venerabilis 4 stehovky 3 Urgichtenbuch 23 triclosan 28 srážkových 1 Versiho 1 verliert 1 Unsigned 4 ÚRM 4 Tavíl 5 Strategikon 2 umdlení 147 Švéd 36 venkovskému 4 Starycha 1 STOCEK 2 strijd 1 Švihácká 3 UR 1 Timkin 1 vavg 59 usazena 5 Tetreva 229 subset 3 šumava 14 terpinen 6 tla 3 STRÍBRNÝ 3 Torontský 2 Sulpicianus 1 synchrofázotronem 2 ubytovávaly 14 Stehlovice 1 Torpille 336 spp 1 uhorelé 1 Takže… 1 Ticin 33 šplhavé 5792 starosta 1 Varno 1 Tybaltova 28 Susja 1 Tradición 1 unterer 3 stilben 307 Štestí 1 Tírny 3 subatlantské 1 Tympán 3 Stütz 1 Tegelman 1 vendula 1 twintip 1 tornensis 37 úrednického 10 Štrosová 101 Synkopy 17 utrhnout 2 TIEFENBACH 107 ting 32 usnou 235 trávit 4 Subotin 5 Suverén 1 Tatuaje 5 Tvarovým 1 verdienen 1 Stuttgarteschwelle 1 Sychamberlin 95 telefonech 1109 trestního 107 Spišský 3 spojovým 1 Urpflanze 2 uschopnování 1 Venetiancrete 1 triennem 1 Tarasevskij 1 Turisini 2 Tezcatlipocou 19 Torinese 1 Tachijatos 1 tagliot 2 s médii 1 Temudžajští 1 trýznive 1 stošestý 1 Ttrevisa 5 spálily 2 trichomonádami 1 VARTY 5 Statutárními 2 studivé 1 Tržního 1 Uvarenou 1 trvanatá 10 sprátelení 4 Vanniusovi 1 Ukazovacím 10 tegmentum 53 tetanu 1 Uilenhoed 1 vedecky 5 Taroucou 1 teeter 1 Tingo 1 Uhanalaisuusluokitus 1 Timegazer 1 Taeniopsetta 1 s Mohegány 4 Verwoerd 1 speran?e 8 Ustopirijan 1 Stigmatisace 69 toxicity 3 umletá 1 umeleckoteoretického 16 steampunk 14 testovanou 1 Tabletová 252 spocítat 1 Städtmuseum 2 Styrman 287 templáru 17 surfaru 168 Ust 1 Tironiek 1 Tolgojn 26 Verny 1 Theistická 1 Štefanií 1 SYTEX 1 Tuharovu 2 VELA 1 SŽVJ 13 Varzim 2 ulomeny 40 task 1 triPodu 1 ušlapat 1 štítosemenka 1 vedomích 1 Technicolour 11 Štágr 1 Staroanglicky 3 Spekulanti 2 Sudol 1 Tritonalia 36 Study 1 Útocil 4 teutschen 2 soupers 2 Tyrcha 3 sylvatické 1 Velelibské 1 titbit 112 uhájil 5 Starohorského 1 tortuguerae 4 Turkmeny 1 Starodávní 593 stín 13 talks 2 Syneilesis 2 vdv 5 Sparafucila 120 spasení 1 Springfieldkém 1 Trebujena 1 s otazníkem 1 Tigranina 118 tažnou 70 Úbocí 1 vedoucím 3 Tygyn 17 spatha 4 tancírne 2 Tulákuv 11 Troisičme 2 sukénka 1 SuperSPARC 1 Thraxe 1 Sumvitg 1 Spitznerové 6 státnický 6 Timbers 2 Stachlovic 1 Trikupisuv 1 Tinnea 3 Vasquéze 11 Thell 1 Stackinterchange 4 Specchi 6 Šunkoflek 1 Stupoj 1 Tschuppik 2 Trilj 1 Štepánovickému 3 urraského 1 tetraaquakobaltnatého 2 syroveji 1 Validátor 1 Verhavert 7 Universo 11 Trictenotoma 1 Vaterlandsverräter 133 Tatarstánu 10 veritŕ 1 srostli 1 Špára 1 Veracuzu 4 Trifoni 2 ulevení 102 unikat 46 Uvolnete 2 tarca 1 tarentaiská 4 startupy 1 tergocellatoides 3 úhloprícnou 3 Stenus 3 Strážcích 4 Troickosavsk 2 uchyceného 94 turectine 1 tlachanými 2 Taví 27 ucenost 1 Velkobítešsko 17 STATUS 1 Vallisneriaceae 1 Telefónica Czech 1 Vemdalen 2 Stiel 1 subPropertyOf 5 Ujkovický 1 Velociraptori 1 tvrdozrnna 1 Tenni 8 vcelonosný 5 unora 137 tuhého 1 továrenským 1 Sproste 1 syrakuzský 2 štokavštinu 2 trubicovými 1 tercᚠ6 usporádávány 83 úspore 1 spišskopodhradští 2 trháme 3 társaság 1 trebešickou 3 STIMUL 1 Ulicnici 3 Tumara 1 Spezianovu 3 testudineus 32 spánkový 2 Varvažovem 1 TAFTA 1 Verwandelung 6 stvurám 36 sufixu 3 teniska 1 Tessitura 5 termínový 137 Soupisky 1 valtellinští 1 Sychotínský 1 Stipecic 1 Swainsonova 2 Timucua 6 Trtíka 1 urk 24 UTair 337 tištené 1 Usomcik 22 surbahar 1 Trásnenkovití 2 stinnejším 1 Truristický 2 Steinbrugg 1 thymovou 1 spinosissimum 3 torpédovitý 2 Tenebrioninae 1 sturpnu 1 ŠÚKL 7 šumivý 1 Vergleiche 1 ssaje 4 UDBy 1 Studitského 1 tenorsaxofonu 1 Ubývalo 4 tabulovou 1 Varketili 1 Teugn 2 Vaceu 4 uslyšení 11 Urbanove 1 Tailora 1 Swyngedouw 15 superoxid 1 Synystrem 2 Svinomaz 420 Svá 1 Taejon 1 Tyrhény 2 Vandervella 130 Václavského 1 thutlwa 4 Tatarolu 3 Spuckler 1 Torreforte 74 Verejnoprávní 1 strážské 1 toranj 1 Terribilis 1 ulehceny 1 Superdirettissima 1 Úvozy 197 Take 1 Szyttler 1 translatológie 1 subglandulifera 104 trvajícího 1 Southernuv 1 Svájambhú 10 Transfagarasan 1 Titas 2 Šumadijského 549 umelého 2 StaraChalupa 1 Tošijo 30 unikala 1 Stomaniški 1 Strojvodca 2 Tríprstá 1 starokladrubští 1 tetrachloroethylen 4 spiaggia 1 Steiningerem 1 Stambulská 1 sudnjeg 10 Tuora 1 spolecenstmi 4 spolknou 1 TENS 2 VdG 1 Standardizovany 3 štourat 46 sumci 1 tyrhenské 1 timida 1 ŠTEPANÍK 1 Ulbert 1255 srst 2 urgentná 3 supervulkánem 4 Urien 1 sulo 6 úpadkovou 1 Valtického 2 ujímáme 28 spisovne 1 Stupínky 1 túránského 23 Stezku 1 strhanými 2 Verold 1 Stockholmsbörsen 7 Stromoví 47 veselého 8 Stredomorský 1 Stranova 1 tigrovi 1 Triumphzug 4 Suchbátar 1 Tarondoruv 1 ukrajinskaja 2 šruchou 4 TIPC 1 Tavridskou 1 Stignat 12 Thaléta 3 stažitelným 1 stamfordské 10 Vermirovská 2 StudentMag 6 Útvine 5 Vedkyne 3 Vereny 2 théodicée 1 TianSqRRStation 2 Trevesova 275 Spiš 36 Špelec 2 velkokríži 1 stredofranských 1 vernérovického 2 Tekand 1 Tchajwanskou 12 sugesci 13 Šprongl 3 Uhýbá 6 Turnerovým 4 Sukových 1 ukrajinskej 1 Tumpen 2 syntetizujících 1 strafapel 1 tuzných 2 ukrižováným 4 Starking 6 Tumory 1 Tunks 1 velkokuchyní 3 sustainu 1 Szegvár 4 UUEE 1 spermiogenezí 5 Tyristorová 2 Stienburg 1 squeal 1 tunbergella 1 veleštíry 4 Šujanová 1 tónovaném 6 uzdickou 8 ulpí 1 vanilie 4 Tamga 4 SOUTH 2 srocovaly 36 Václavícek 1 Tamazi 1 TheHighStreetPenrhyndeudraeth 5 troufalá 1 Teatrului 1 Ultramaratonci 5 triskelionu 2 udržovaní 2 Transfinite 13 Tichooceánské 3 Tumbi 1 Szanowny 2 Spojily 1 Telescope-European 8 Teteks 1 Špicáku 1 Sulgau 1 Stažen 1 strýcovství 1 srbskojazycné 1 uspechanénež 2 unitifu 46 Svazarm 3 Trevíza 4 tulipánovník 1 temptaris 4 Teigen 1 TundraDraw 5 tenáza 2 upresnená 1 theologicć 6 upil 1 speckle 1 usoužily 1 UMmu 1 TEMPORA 1 Tecková 1 TELEM 1 sterlingové 2 Studeny 1 Tavrijsku 1 UniversalStudiosEntertainment 3 svátostný 6 staplovou 2 Toporek 1 Üle 2 Vcelnicky 1 Tomatito 2 usmevavých 1 Thachuparambil 5 tulenum 2 Vaterlandspartei 1 soutiskne 1 Ueharou 2 uco 72 taktická 2 Spekulaci 1 StarBlade 1 trojstežnové 2 trigenerace 90 Szávayová 92 stanu 4 Teyly 1 Suspendování 1 sudkovské 1 tegmentálních 1 soupecrky 1 sovetskaja 1 Tafer 1 Tetraodontidae 3 terranského 1 Speedmintonové 4 Unescoceratops 1 uctíváte 1 Tierreno 1 Urcován 27 stranky 1 Vartmann 1 velour 3 vášnivejší 42 uznanou 17 strhával 1 Stirska 1 Várhosszúrét 6 vente 1 Subdodavatel 2 Spulkou 505 Súdán 11 Stoupal 2 Vaklua 5 Tarasovs 1 Vehove 1 Textilwerke 2 Verwaltungstruppen 12 Vadilo 268 válcovitý 1 strávce 2 TAKES 2 svoite 4 Trpimíra 1 süväll 239 Švamberka 1 Szeretök 4 Sultanate 5 Sutivan 11 trepka 2 Verkstad 2 trípólová 2 Trumpets 3 spermatická 1 tišen 29 trojnou 1 tiebreakum 1 tablasensis 6 úspornejším 1 TRATI 1 Stagarta 1 Vandost 2 stratopauzou 1 SYNové 10 Tunja 6 Valdimarsson 1 Swein 7 Ukon 2 Spanisch 1 Sulcpach 1 Sukhumit 58 univerza 1 Versammlung 5 Vauclin 1 Talravin 1 sygyzyine 1 tonážní 1 Teodiceu 51 Stalinismus 6 uprchlická 1 trasplantován 1 Sunseri 2 Trjamkin 8 Taverna 2 substruktury 6 Timogenes 1 tribadismu 1 Töltschach 9 SRW 1 Twina 3 Stothers 2 tanci 1 Sutborzicz 1 Vägev 1 strankarstva 482 štáb 3 tofy 4 svobodomyslní 2 Vallana 1 URÁ 30 utilitarismu 3 vbocením 1 Umajovské 1 Teboil 27 troposfére 49 vadil 1 Trachycladidae 1 tungarové 5 svatojirských 1 tajnostem 1 tvrzického 8 Súkenník 7 Sumu 2 Vatopedi 1 Sprengerovo 18 tuhnou 4 usvedceny 1 Splitgerber 1 uroš 31 stredostavovská 3 Týrovském 1 vaišnavského 2 s kruhovými 1 Uelsmannuv 3 uverily 1 Stamkosem 5 ustavicným 2 tkadlenám 1 Throsvinensko 1 suppanus 1 Tschandala 1 téglu 26 Ther 22 vdovství 5 telos 34 tuli 153 tab 2 Stolpce 2 Subsecretaría 1 trizómii 1 Taurosta 11 Tárika 1 steriliních 2 utah 2 Tschilda 8 úpravce 10 šoupátková 5 trnuchy 1 Veientona 1 stísnen 1 Trastamara 4 svezeni 2 televisiosarjan 2 Tauetzien 1 strednicové 1 vegetárství 12 Vaanholt 1 Tarsií 2 Tacumou 1 Stadelbreiten 1 Travelled 2 Staricná 3221 struktury 10 Tracht 2 Trianón 2 Thabituv 4 t??? 1 tereskenem 2 s právy 4 Textgeschichte 1 tovských 1 Vajdovsky 2 végétation 1 Tajisi 1 Tullgren 1 Toroteru 1 uveriti 3 stacionári 1 trojpruhou 2 úctenkami 6 Suleymanov 1 TeraFlops 3 Vazulovi 1 tetrakoncha 1 Strasskow 4 Uthman 1 Teriku 1 udren 3 Sutterová 33 tuf 2 štejner 2 Tetkik 14 TIG 1 Varhaníkem 5 uchycování 4 Vešeta 21 uc 11 stranicko 1 Spilberg 1 Tokésújfalu 3 Undekan 43 Southwark 7 tso 1 Suldowa 5 specificteji 1 ?ura 2 stucku 1 Úspešne 2 Sunfire 128 Svinná 1 spiev 3 those 1 tmavomodra 1 uainn 1 Tóthfalu 4 srotil 7 TGR 143 studentky 5 tulipani 1 Vaidasu 25 telavivského 1 Sudislavy 9 stylusem 15 stochastický 2 Thorning 2 starostupavských 5 urbanisty 232 stereo 188 terorismus 6 teplárenský 1 striatopunctatus 1 Sovynazu 41 sysel 1 stagnacního 21 ústeckých 2 s?posláním 1 StaryDomek 1 Temeswarum 1 ucesaném 3 Thöny 2 trásníckovití 1 Suskeho 1 Tsugiharu 1 Tenpo 1 Speváckem 24 uctívající 3 stahované 1 Terentiovi 1 Tegelhoffem 1 Täubera 1 Teneguia 15 synchronizacním 8 uzrává 2 štukovaných 1 Swarzedzkie 1 tüdorákot 4 Transsaharská 1 Tomcíkovci 9 Terespol 382 sovetskými 1 Strmini 650 Stromy 1 Šunychleská 1 ussfranklin 3 Ungrové 1 spectroscopyonline 16 veledílo 4 taricha 3 toroidního 4 sršnu 1 Strassenmusik 1 Tetnuldi 5 Taschachferner 1 spolupracovapla 32 trísel 1 tvrdacky 353 vetvemi 1 Úhelnými 1 Teogonie 1 urachi 2 s veškerými 3 Sunyer 1 tuvanských 1 univerzitra 3 Vegaském 5 Struszkiewicz 1 Strumjen 1 souvisí—toto 1 trojpatrovou 81 uir 1 Temepramento 26 Tegartová 1 tohoto plemene jsou 1 sovesti 1 ukojením 1 Valtruda 3 ventilku 1 Tessaigy 3 teoretizujícím 1 ugandae 7 Soustružnický 4 sporám 1 Verbiž 78 spojovaných 1 Tilmitt 1 težkomyslností 1 Urangwe 1 toporným 1 Sparnecku 1 supervojáky 1 strumenském 36 uspávací 1 Špedko 13 takovýmito 2 Todeskarawane 4 uhríneveského 1127 válecný 1 velkolepejších 2 Temmer 1 strašínským 171 strihu 1 Stropníku 2 tyrosinkinázami 1 Verhuella 1 sysku 4 únii 9 subprostoru 4 stanie 23 TEU 1 Vadžirunhis 1 tweedy 1 Teschnnowitz 3 Sourwood 2 Tachelet 1 torrei 1 stehni 1 Valentinský 1 subpixelov 1 Valterovi 1 táhlici 1 tempry 1 Stangeland 1 strecholistý 54 Triumfální 1 uvárí 3 Válejšovití 2 úsušku 12 Unwritten 2 Vejci 1 tázaným 1 Spiritforms 2 UDELAT 1 topper 1 UNSMIS 1 théravádovými 24 Travcice 1 Uroksa 3 splendor 3 Spezielle 2 s nízkým 2 splavovat 1 tesaurový 2 switchingu 1 Szerednye 1 Streichquartettspieler 1 strašilkovcu 1 Tolvanenová 1 Tyrrhenis 1 Teplínek 1 Ternopilský 1 Tangeova 3 Szep 1 Terretektorh 1 teplovozobudivnyj 1 UrbEx 1 Taduchippy 177 týkal 16 tingu 1 Streicherove 1 stachovské 1 Spurt 1 Teutonische 3 stínovište 1 Urbinský 1 Stadlmayr 2 translokovány 2 Szögedi 6 Torgils 134 spolkovém 1 stredopravým 6 Twohy 2 tkáno 495 trídení 1 userweb 1 turrony 7 Stanic 67 urcovaly 4 uzlíckem 1 tvarujeme 7 splazu 2 uvereno 2 Trckovy 1 Úzkému 1 Steady… 1 Stedjebergem 8 spontaneitu 1 vetšiny vládních 2 Tersa 1 Urtyp 1 vazech 178 transparentní 7 strusce 2 tyrkysovo 7 Stroopova 1 upevnete 31 Tiberios 2 Spelthorne 4 urbanistice 198 Strucný 3 tíživém 1 vertit 2 uczonych 1 Ultraterrestre 1 Stylizuje 6 Teufelsbergu 1 termoláhev 1 Vercingetorixova 3 sutor 3 Trigrad 1 TECHNOPLYN 1 Uqair 1 uspenije 5 trimerní 9 TEDu 3 Tresova 1 Thesiaceae 6 Typographia 1 thymomamu 107 toxicita 1 Valdeiglesias 2 ujasní 1 unanimous 5 spytihnevskému 2 s témer 157 Stavitelé 104 Vápenice 1 Vesicherungsgesetze 1154 spánku 4 ustašovských 2 Štvrtna 8 spolufinancoval 1 välgĺng 1 Thyóné 5 tufech 14 Špicková 25 ukazovákem 1 Umarových 2 tvrdek 2 VÁŽANSKÝ 1 Szalmatercs 84 ÚOHS 1 upeceným 5 úmorném 1 starousedlá 1 Subjekl 1 Sybiliných 10 uhlíkovém 4 velitelskému 1 TEJCEK 5 úrovnovému 1 Szymanów 5 umarlych 1 tchnace 45 Sura 1 televzdelávání 2 Ulano 1 Thilanu 16 uchované 11 Strahovským 3 Stmívace 3 Strhávání 48 Tullio 1 Tawwil 2 VERO 1 Trakavice 1 Turvalda 1 Théodratou 20 sporí 1 Tolkowsky 1 synekdoch 1 tešinity 1 Tentyž 10 strašném 1 Ulfelda 1 tetivovém 1 userbar 1 TRAVIVAJOJ 1 Tuite 1 temperamentnost 6 traktury 5 Sulston 2 Tourn 6 teatroložka 1 teloské 1 Udelily 463 striktne 1 ukování 4 svetlovodivé 1 Toubiho 3 vanno 2 spráhne 2 Törst 4 Tojohara 3 úplatná 2 vaiduryaprabharajaya 1 sporýšem 1 spásonosné 5 sporogenes 49 trampských 2 Taubeho 2 tugriku 7 TOPtrendy 10 utkvelé 2 Tallienová 12 Suvajda 1 tirannie 9 Spectabilis 1 Treash 1 Spojene 2 Švelnupys 10 svolávají 1 svodnicemi 52 Susana 1 Trentuno 13 tlustoocasá 8 Valašskému 1 Taynaq 1 Vedrine 3 vepsky 1 Tütüncüler 1 Spiritmaster 1 Šušorová 1 Tešnovicemi 2 Toplitzském 1 Tournafulla 1 Tejinesh 1 ssakoksztaltnych 19 Theofylaktos 2 Tolupe 1 usmírené 1 unipolárnímu 3 Taillis 3 urogenitálním 9 superhrdinské 55 Václavove 1 strdecní 21 Srbovi 1 Titelanu 1 šuhajícko 5 Verbal 138 vatikánský 14 Veleštír 7 Telekomu 1 TWINPORT 1 teatralizované 4 Vadkakasok 1 Trichen 3 veríc 2 strašek 13 uvádeném 8 streetwork 1 Stonorova 1 Tereziini 2 Trojek 1 tyttanthum 1 vasokonstriktor 4 uskromnit 108 Valentová 8 Trialeurodes 1 Tachós 1 Svinihlavská 2 Tomorrows 29 Surg 1 sporilovský 7 Vespidae 1 švestkovými 1 stoctyricátýosmý 4 symbolum 7 svodech 1 Trélex 5 trubko 3 Stampfli 11 Vendeuvre 1 uvedomíš 2 súvekom 1 Typische 1 svádivé 2 Théničres 4 Svetskou 1 Torrenticola 2 SURA 1 Vancouverovou 13 Tarnov 3 Táborová 1 Špackovo 1 Urwin 1 tereftalát 2 Tolçu 36 Tua 1 Stilleove 2 submediteránním 1 Turócszentpéter 6 Vašíckem 12 ústícího 1 Trebestovicím 4 uplne 1 Stritchovou 2 Stodolovo 1 Strelu 7 Supergrass 2 Thallo 1 Terezah 2 usmáli 1 strakatejší 2 Su 1 Stegobium 1 staroutrakvistictí 1 TriIcelon 1 Verchére 2 Srenja 1 Svážení 2 unášecem 1 Trené 1 Tvaružkem 1 Üleoja 1 sumbel 1 Susskinda 15 Tycka 51 Štechovic 6 Túfaranka 2 UkrAVTO 2 svatojirskými 1 sudweeks 1 Sweapem 4 vegankou 1 TremesekZamek 2 Umelcu 1 syrakuské 1 Suolanen 1 Tyrala 1 Spolecenští 31 stébly 1 Southovou 3 Teplokrevnost 1 uplinku 1 šupinkovými 2 UOO 1 Tanzlehrerin 2 Vespičre 2 Thonsberg 1 tetrapterus 10 SUP 2 Ukrižované 2 Thoresena 2 Termixes 1 Sreet 1 tencóna 2 Syllan 2 Univerzalismus 1 starcinema 32 Tinker 2 Uprchli 1 Toeloopomem 8 Štocký 5 Sztankovics 1 Syntynt 1 Úgy 6 šurek 1 tenta 4 Velkomezirícsku 527 uloženo 3 talossa 1 stlóct 1 stradacích 1 Teagle 4 štaufskému 14 subterranea 4 Trollskau 1 tiskarovu 2 Vertumne 1 torcy 1 stabilizujeme 1 teplanský 6 tesali 1 Üürike 708 Velkém 3 Sozialdokumentarische 1 Telesfora 1 stríbrenkovými 3 uruckém 1 tyton 1 štverka 2 stene 3214 telesa 87 stisk 574 vektoru 1 s meštanstvem 2 tripartitae 1 Stotisícová 1 stráženských 23 Trebel 1 velkonocní 3 težarského 1 tetraphyllum 7 Umožnovalo 1 svétla 1 Toxie 1 StiđjafjalI 5 Tinský 2 suya 1 Staromestsky 1 Tom McGrath 5 Ubikace 1 Totenfackel 1 Sycheva 1 trkni 1 Teysllerová 43 Spodnje 1 Vérandža 1 tvym 6 Tarnovski 3 Teodolity 4 uig 1 ustavuj 2 Srníckovi 1 Srilankamys 1 stoploj 1 Vacata 1 természeti 1 TwinTurbo 1 s teamem 1 Sturmmösser 1 Vacarescu 6 Tanaku 1 Tessuto 30 tipu 2 Vasilcikov 1 Tápiószolos 8 Thorsson 3 Tupaiide 1 špickováním 11 Switching 4 Suey 36 vajíckách 2 Uložili 1 Timaiovu 4 Údlické 23 Tei 2 Unwertu 20 ungarischen 2 Vahlberg 1 Šuková 3 Urahara 2 Venexia 36 Syntaktická 1 Uherku 2 Velemínu 1 Újezdech 2 Šui 1 terckách 97 uderit 2 utý 6 svetili 1 trilingvních 2 Thonerde 1 Tantalusu 1 Usebraná 1 Šunkoflekem 63 tea 1 s kapitálovými 1 Teganissorensuv 2 spoofovaní 1 Tomboro 1 Tremate 1 Trebiaska 1 uspechanosti 4 VÁHALA 1 Steinpilz 1 utniczy 3 timiryazevskaya 5 Stodolou 4 Tuvji 1 sportbar 3 Tatrovické 2 Telemarcané 4 tobažský 1 Sudebnyj 1 surrounded 2 Truchlivá 3 úplate 40 Syrdarja 75 Szegedu 1 Topaloglu 1 Turbu 1 Tepeyacu 17 Toucan 3 Suwalkách 2 Teddyno 1 Stunder 1 triatlonklubmb 2 Tephrocybe 87 Valerianus 1 taicó 1 Štucky 34 tuš 2 superstring 1 Unionistum 1 Traytlar 1 stvárnovaní 1 Unitasovo 1 Udiveni 3 Toledská 1 Tuulo 1 tenko 1 tetradekanové 202 Tisa 1 Tiplera 3 touchpady 2 Sumur 2 Thipoa 1 Splatters 23 trávove 1 Šusová 1 Strahlender 2 Úsporný 11 úsmevný 1 SVÁREC 1 travelguide 4 Styllex 24 uspíšit 2 Trinia 2 Tilsitu 2 Splavování 5 tycícím 1 stanných 1 Terhely 2 tupoúhlý 6 Teresitas 3 Tímaios 2 Takvorian 2 Szelpakow 1 Sudetengeschichten 10 Ulric 7 Útechovický 7 Veterná 1 Texasští 1 szegedi 1 vangár 2 Stenomax 5 Valori 1 Tramkupplungen 1 sowietskogo 2 triviu 1 urbinských 31 stupnový 2 subdurálnímu 1 Spondylos 2 Tastil 2 Štefanides 2 Tattenbach 2 Tesársky 15 Strehom 1 Széchenyihegy 10 Temelínec 1 Tramicinol 1 TaiGJBreak 149 úklid 2 Ucitelu 1 Suanov 27 Taurageský 1 tundrovité 1 Uitvinding 1 Tchoutang 1 stredoveku byla 1 THI 2 Vallčgue 1 Tešnovská 3 Turuchansku 2 Venedská 1 ujišteno 1 Sulamericana 1 Tríhlavému 2 trojuhelnik 1 Ukvaldská 50 Svatojánské 4 suchohriby 5 Tvárecí 5 Verunsicherung 1 spujuje 1 topeništ 3 uvítáno 11 Tiskarský 1 Upevnovalo 2 utraceným 1 Ternobum 1 statnejšími 2518 urcitou 1 Toulose 2 vetováno 2 unbinilia 1 Ujav 1 susanne 28 Transkripcní 1 Tomšovicovou 1 trojnohým 2 Tonetto 201 vcera 1 Verbrande 6 SRE 1 Vatatzese 3 Tourcelles 1 Strophantus 2 Transl 1 Thaugsubana 1 Steinu 1 tatínkovského 179 štábní 3 Thomanerchor 2 stafordšírskému 37 utrakvisty 1 startIndex 47 Tschida 6 usazenému 2 utmp 2 Sunži 37 Svobodové 120 stávek 6 Stonková 1 SYMBIOTIKA 5 Stebne 2 Tenz 12 svépomocne 2 Spath 1 Stephaniewarte 2 terminologickému 1 Srednevo 1 Šumperskem 1 Toeppen 19 sponzorum 3 Vaseline 4 Trpanje 1 stenografkou 1 Steverin 3 Temelin 1 Valdšejna 3 Sušilových 6 Terdžola 1 tamworth 1 Swindonem 2 umbarskou 8 topografa 1 Ušackas 1 Torilu 3 Teté 1 spolujízde 1 vejcíté 5 svíralo 1 Stamets 1 Streckeisena 1 Titanitý 7 vejdi 3 sympatickými 1 uzenáruv 1 Suadiye 1 tun 10 Spielbox 2 Trebkovem 1 Souradny 1 statitisícové 1 Terril 1 Umit 3 Taciana 1 Spiriferina 1 Twits 1 súkromné 1 Thomazem 1 Varaneho 1 Tomojo 1 Thored 1 versálky 1 Thatha 1 turkifikaci 5 tenellum 2 uvozovat 17 vampýr 1 Svedou 7 spontánními 2 Spodyriev 1 Stuttgartských 4 Tombak 1 Termogeneze 1 tofuo 31 Turkovskij 15 tetum 99 Úredníci 24 traceroute 1 speckles 18 Syrsko 1 trní 8 usmernovaci 1 ufologa 3 Symfonií 2 tortillová 1 striopallidalis 1 varvání 22 Turais 387 spojenou 1 Suetoniove 1 veršom 1 Varuh 2 Troppem 3 Szczecinie 7 Tanuki 1 Traiánem 3 tríletí 58 Švecov 3 tesetice 6 Týmal 1 Thiiran 8 varnothing 6 Ukrytý 9 Tonic 1 spolufinancovaná 2 struháku 1 Tadaakimu 1 Tilkeho 1 Strunová 1 texovou 9 svt 1 Szafrance 4 Tendenci 1 Vardamirovi 1 titracemi 1 Teding 2 Torello 1 ulívka 1 Stejnopisy 9 špás 2 Twichellová 3088 Ukrajina 22 Stowarzyszenie 4 Tammik 1 stredomorsko 2 Telithromycin 1 Teódulo 1 Toxieho 1 tisícemístného 371 urcující 5 staletém 1 Stilsonem 1 Toperic 1 TERCOM 1 Sueurova 4 Turnage 270 Turkmenistánu 1 Tatarskit 1 UKNOWBIGSEAN 1 ÚBMI 4 Swamiho 19 stripu 1 tekijat 1 Tardosová 2 Tiervâ 1 Tarcila 5 Vasut 1 Sukuby 3 Veselku 10 Stárkova 10 spirálovitým 116 Sumatre 36 Špicákem 2 Thoss 23 Theofil 1794 ulicí 1 Tarbot 1 vaniaka 1 Toatenmongakkai 5 uzákonený 1 upani?ada? 1 Trevorrowem 1 Sterpulem 2 Terrorizer 2 Typographiae 7 Trebýcina 1 Sphaerocyperus 1 Suaréze 20 ulovili 30 Štítina 1 Ulawa 5 ustanovovány 1 Stensens 67 Stavy 3 Veprsko 2 trammera 2 Talleyová 4 veitchiana 1 Vavrysová 2 s?pati 1 Vergneovi 23 Uhlírskojanovicko 1 TotalTV 72 Vasyl 4 Stredooceánský 1 Tingstads 1 totalitne 5 Südharz 6 úhybných 37 Václavkova 1 torbida 12 Titrace 1 Tarantem 1 Stružskému 1 sporilovským 4 Thomayerovou 1 Tevye 6 Spencerovou 5 Turovová 2 Uvažovaný 10 Sprout 1 Steeghs 1 Thorském 1 Thorstvedt 3 tessellation 3 Tunari 3 Tulenin 1 vardi 1 Sultzer 10 úžlabích 1 trpasliku 2 Splutí 4 úzkokolejek 2 Techiju 1 UVEE 161 venovaly 6 Starly 1 uršulínském 1 SPML 1 Stopou 3 tosafistu 2 Szpilmanovi 1 Uje 915 tramvajová 4 TAJNÉ 1 starochorvatské 9 sturio 3 ÚCNK 3 Transhumanisté 1 tadida 1 spoluprožívání 12 ukotvením 64 Trastevere 1 topickou 1 SPLC 9 srbochorvatštinu 1 trícelistová 1 területe 1 Venofarmaka 12 velevruba 3 transylvánská 2 UNGERMAN 4 trípokojový 1 Suslinová 1 vešebta 7 Svobodnaja 1 Steimerová 1 Stöllner 8 Tošanovic 1 tencícím 36 trubci 1 stastnym 1 spros 1 Špionážny 1 Traumkristalle 6 splavnit 6 Vermelles 1 súkien 191 starostka 10 Sticks 114 Tyrolský 3 Tithóna 1 Stantonuv 1 theofaneias 1 thirteen 8 Stielike 1 tužínského 1 Stypulkowski 3 Tenukupara 1 Steinschneidekunst 41 Tarot 1 tristissima 1 Sütterli 4 vetevnaté 1 Tjabe 3 Tatenický 33 upomínkové 1 s elektrospotrebici 63 toaletu 1 Tarland 61 vecerního 19 Traxx 2 Uelsmannovy 1 taželoj 1 Sylenka 1 telurická 1 Usandizagovým 1 triheptakontan 1 thiochlorid 4 trachyandezit 1 Trojanska 1 Syrakúských 1 Thaddag 1 Trevere 1 suknic 39 systematických 20 Vasili 3 starohornonemecky 6 švestkou 15 third 245 tkví 1 Thjodhildou 1 Štepán† 1 Szobor 1 studentska 6 Valnícek 1 Úlehlích 7 Verrius 62 Staatsoper 1 Stabileye 1 velitelského 76 ústních 1 Spirella 1 uhorský 1 Trochej 3 svarovna 1 Svilengradu 1 terminované 1 Strambim 1 Vahibremu 1 Stimulující 27 Taigei 1 Uilliam 1 tegmenta 53 spisovatelskou 1 transkódován 1 Tamže 5 Taake 1 Stefky 1 Sulamitis 3 Tiaa 5 transgenderovou 2 Taďr 1 Trencséntölgyes 1 tibetsku 1 unterhalb 9 Stádla 1 Uvolneny 1 urmiriensis 4 undefined 1 TAGE 399 ústave 3 suffrí 27 Stredohorí 2 Tiranských 132 správnému 1 trínulovými 4 uplatníme 1 Udusí 17 SSI 1 terciárne 3 Umora 5 Stelian 47 vestibulem 2 sovineckém 10 spojidlo 1 Tyropoeonské 2 úri 1 ubohými 19 Tý 1 tenkozobci 1 Städlisches 1 teralogie 1 Thermos 1 Tjupský 1 Stilesouvou 4 surreal 1 sumárními 1 syromalabarští 3 vakcinovat 26 Trebarov 2 Vandoeuvres 1 Tartati 4 Synaxár 31 spontánnímu 296 Trnka 2 Umele 2 suspensio 3 Strutz 1 Tachmasibem 1 Tokésisziget 1 Uchovsky 3 Tagul 1 Trademarc 1 stríbronosná 1 Thevot 41 Stropní 1 tamilsko 1 trumpetfagot 1 Stolzenhain 2 Varovanie 3 trachyticko 2 srážel 3 štvanec 3 syng 3 Trosecnice 8 Únosu 1 Stauroteuthidae 1 Sustrans 1 Suillius 1 Svitovských 1 tranzitu 1 velkolepejšího 4 Triviálním 1 theofil 1 také pravdepodobne 19 synovo 3 tresoucího 1 Szmeruk 2 strašne 11 svítivých 1 Tribonematales 1 Tadlewski 1 stróbo 1 veleznámé 1 Tresamini 118 uranové 1 usmírenými 1 Trojlistok 1 upasa?pada 2 stopan 1 vešované 2 statkárská 1 vážitelné 2 Talonuv 17 transcendenci 1 SURface 4 SXF 6 tankují 75 Vachon 1 Tuncovec 1 Unterart 1 Tarnopolskij 1 Velkovišnovští 73 Strukturální 1 stihaci 1 tachografuŠpanelská 1 Tomcíkuv 5 tmavezelené 40 Tichému 63 Umgebung 11 supluje 1 stometrových 2 VEKTRA 1 Vailele 2 tavgijská 1 subdita 42 Vejprnice 1 ssrn 4 Taxidiinae 4 Verešcaginuv 1 Velehradským 2 stromatitového 1 Texnikum 65 uzpusobený 1 supervoltu 2 spoutáno 1 Spelaeornis 3 uskocí 1 turbínkové 1 stjernes 100 Trhová 1 úctovaná 2 Tokugawuv 1 timeových 1 Urubek 3 Stachybotryotoxikóza 9 Tahmáspa 9 Staatkundig 1 triPodum 2 stickmanu 10 Titlis 1 veristum 1 TLX 5 splývajících 1 šouráckem 1 Tarrutenius 1 struthio 6 Thaliacea 11 užitkoví 1 Tra 1 swing 1 subhorizontální 1 starofinštine 6 Sverila 1 Ultimul 1 Vamberské 1 s žákovými 2 ubbidito 24 Trnité 2 ukutecnil 1 ujištil 6 Spravované 1 svedcíme 3 UNTAET 1 szeretni 1 tortilloviu 3 tutsijskou 1 Urvill 104 soutežilo 12 TNEF 1 Tekulovci 1 triumphu 14 Unsern 1 undergroundovému 125 Sterna 1 spurred 2 Storrse 2 tetramethylbutan 1 telopea 1 stereoscopia 3 Staglieno 1 staroperský 6 trium 1 Südwandbahn 1 Taylrovou 1 Štochluv 1 Toilettenanlagen 1 Velibská 14 uvarená 3 Tammaro 1 UNIxových 1 Uprchlíka 2 útesovém 1 vadyvytelství 2 Štarman 2 tofalarsky 1 štepování 1 úradováni 1 Stahovica 40 SuperElit 1 tlacenice 1 Uilleam 1 Telamónových 1 vereinten 94 Velázquez 5 tríkrálovou 1 trojvrcholu 1 Titina 9 SpongeBoba 1 tabelovaná 1 Tsuguyoshi 1 Ulenbachovi 28 Tonymu 3 stop˛ 1 Stroner 1 Sylvichadsia 6 svatoušek 6 Titovými 1 Subvulkanickou 1 tocnám 1 sunitinib 42 Turce 7 Sremská 4 s aktivní 1 Tauricevský 5 Torpédová 4 Tenzinga 1 srovnávaním 4 typical 3 Tajenky 96 SpVgg 2 ustalují 64 varhanice 3 TBWA 1 Vennyinou 19 Spiritu 1 spilopleura 8 transformování 4 Teutoburger 1 Srdécka 1 tenkojehlová 1 suluský 4 Valentinianuv 11 vavrínovou 5 toniku 1 trikyslík 1 svate 1 Venzettiová 1 Taušlova 1 Tetrikem 27 symptomatických 2 sundávali 4143 Tábor 1 Stavrem 16 strelnicí 1 Vasyna 7 Teneriffa 1 Tachtulec 3 Tobymu 1 uslechtily 1 Vegetárského 216 stránkou 7 Teiskonen 4 Svitkový 1 Vermauchampt 1 Taftartarat 1 tensona 9 Tapejara 1 Usámovy 1 TramDepot 6 Vcelák 6 ujišteni 45 velikonoce 1 Turmair 27 Vendetta 1 Ugljen 1 tabkhandi 66 státoprávním 1 tensit 5 Tuvancu 1 tentata 1 Varanops 2 uprchlic 2 s korunou 1 Tamaška 2 Vasúti 90 Vestfálska 6 Trebešín 2 svlékaná 1 Thorramatur 6 ÚVN 3 Telepathe 1 Trencianském 1 Vetrenyj 5 Trencianskou 1223 stylem 1 Tuppman 1 spany 1 Urunbayev 1 trompé 140 tý 3 teenagerovském 1 Trojté 1 Tibbittsem 30 Veturius 6 trpelivým 1 totalitách 11 úcinnejšími 2 Ungher 4 Towerem 48 Verl 1 Unametsa 1 tragacantha 24 Uxbridge 58 Tkác 52 Tomlinson 1 Tilneyová 3 trojtrný 4 stamen 6 Udacnyj 1 Taveau 1 úhorovcovitých 1 tasila 3 Systolický 1 staraboleslav 1 Tankou 2 terská 1 Tinna 1 Velškou 1 tšk 4 ujezdy 1 TENO 1 Targosz 6 telem 3 Švonavská 36 Spojnice 9 Sylván 590 veceri 1 stoloniferum 12 steaku 1 susurro 7 ušatým 1 tejhle 9 unbekannte 2 turrr 1 Suddské 3 trivago 2 Tadini 6 Vardanés 1 Turóctótfalu 5 Událo 1 Túránšáhovi 87 Touré 10 Spitzmüller 1 Stohelitskou 3 StaticColor 1 thránítai 1 székesegyház 789 Stephan 4 terpenových 1 vboceným 1 Tramplerem 1 Vchynského 47 ústupových 25 Süß 2 Tweekaz 3 usmívaj 2 Vartholomeos 1 tabuisovanými 5 úvazu 8 tlumících 1 uzkost 49 takzvanými 1 Stichotrichia 1 Tasqueńa 3 Velichova 6 stanoveni 76 úboru 1 Stredovekém 3 Taraconta 3714 Svet 4 uceni 4 Valcour 11 válcovnách 11 Tauron 21 tichomorský 1 tréyes 3 Triumphans 2 tahající 4 urostlí 1 strander 12 Spiesse 1 Starhemberkum 183 spoušte 39 SUB 1 stoják 3 terciárkou 2 Spoonera 1 Trebánka 1 stratovulklány 3429 trvá 1 Tagungsthema 7 svetcove 8 Tunney 11 Ukrývá 10 Velehradská 1 stemmatographiam 2 vánicím 13 transkriptázy 93 Syndikátu 1 vasconice 27 srnce 1 transhorizontovej 3 Unseld 1 velkobrezenského 11 Tote 3 Spiderwick 2 Taagepera 1 spolukrálov 11 Vestal 7 srážecího 1 vakíl 2 sverige 1 strková 5 SourceSafe 7 Uschlý 1 Trabenreith 2 transpondérech 1 Ubližuje 2 Stínave 62 Ungarn 1 toulku 1 trumscheit 4 Terenia 1 Verberanty 2 trustem 1 spires 2 ucpávaly 1 veleúspechu 1 unavují 193 teologický 1 srabárnou 5 Svinesundský 19 tezaurus 1 Veivirženech 1 teratogenne 9 Umba 4 Usodimare 1 Theophrastovým 1 TouringMachine 1 Tabeiová 1 Theofylin 1 Thajky 676 tréninku 1 Tepljakovová 1 Sušynského 2 trojvrstvý 1 soutstredení 3 Tulloh 5 syntaktickými 3 Veste 2 Teofanie 48 Tegel 1 verohodnejším 3 timesloty 1 sutherlandii 3 Szmidt 1 Talliera 2 Turó 1 Úhercích 3 s Hitlerem 1 Trulzsch 1 tam… 1 Touristik 4 Sovové 2 textual 6 ušla 3 Steubena 1 sunsetském 9 Torrijos 1 Stríbrnácek 42 Valmy 2 Symmachos 8 svedomité 6 Takšašíly 2 švarcvaldský 1 Theatina 5 Stomatologové 1 Timoftimu 1 stranme 2 Symphoremataceae 8 Velbloudy 3 Undangan 3 Theotokopoula 1 SPITBOL 1 Tržepschin 7 Uhurou 2 Tihipka 20 stíní 1 Tabarnašem 1 Svejkovského 3 Vcelního 2 ušlapou 4 umlaut 1 Svarna 1 ultratisícovky 3 Vćrlřse 1 tuberkulinací 35 symptomatická 1 Trappem 1 Teichstätt 6 Spelly 3 s továrním 5 Turlychanov 8 Tacikaze 1 tuluk 1 Vaittijatingam 1 Thay 2 tantalum 4 Švenek 15 Suhlu 1 Tabanovcích 315 Tatiana 1 Szaybo 2 VANOC 7 úponem 196 Vargas 534 Timothy 1 štepováním 13 stroboskopický 1 Trasírky 1 trĺ 3 stelo 3 uplývajícím 4 VERS 6 Steeler 1 Sysifa 1 Tujamunit 126 Svatosti 1 Techlovicích 3 Staalplaat 1 Uranského 3 suboxidy 1 Tukum 1 UnOpened 3 utahovat 4 trpytkami 11 Tiky 21 Velitelské 1 Stroupínovský 1 Turcico 6 Takelot 34 tomentosum 263 Úprava 1 Triandafillov 373 svalové 1 Terriss 5 ttiin 9 Svatorecen 1 Tabuizování 550 Trojskok 1 urzoní 3 Unsoeld 1 Southornští 124 tešit 6 Tailfeather 1 Uppsalou 1 Vaitiekupis 1 Vaiatoa 2 úcinkováni 3 univerbizací 1 umat 4 Svéborická 6 souperivé 2 Udav 4 svídnickým 2 Strojnictví 13 trieda 2 spektrofotometrické 2 Theofilus 3 s dáblem 2 Thronstreit 4 ukoncíme 1 validizáciu 10 TIPA 1 Trojekurovem 8 veletržního 320 staroceské 5 Tzi 1 štítských 2 tlamovcová 4 udusilo 1 triumfeme 2 Treschenu 6 Trothy 21 vegetabilním 1 svuj… 7 Sporu 1 synchrotronní 1 uvolnene 1 trocheju 7 Strukturne 5 spiritosa 1 udajne 3 Tušovicky 1 Uladzislau 1 Štolveku 1 Toltén 4 Suvasvesi 8 spunbond 36 stricto 1 varoázu 1 Tamaški 1 Udusil 2 Southamptona 3 trnožní 1 Strážkem 7 urovnával 3 Verenu 1 Tožicové 2 Varanem 1 Spitzäcker 4 Vergleichung 1 Tigalalu 5 spelling 1 typizacníc 2 Undergroundové 1 Tjärnkvist 22 stríbritého 6 tancený 5 transurany 1 tatanakucharova 5 Veci 1 Valgerđur 1 Udža 1 stríbrneodený 1 s majákem 1 stredofrekvencních 1 STELIT 2 Stilburyho 1 Stoumontem 28 štekot 15 tmavnoucí 3 Surcamps 1 Strachwic 17 Vaillancourt 1 underOATH 4 Tacmas 16 spatrujeme 5 Stradova 11 Spirituály 1 Trilaterálního 4 urgalové 11 Trmalova 10 Trinityho 1 TravelTime 2 Švejks 3 trpená 1 TUKLEKY 1 trombo?ebitidu 1 standfesten 2 Varkales 2 Vavreckovi 2 Valino 3 Ultsche 6 Tribolium 2 Sultánšáh 20 SURF 1 Tuuliöinä 1 vartenberským 1 šupinkovitých 1 symbiotismus 1 testedző 1 StVS 1 Tka 1 Vandeplancke 6 Stolzenberg 16 Velšanu 1 Thorichthys 1 stodesítce 209 tržeb 1 spolocenské 524 tmavší 6 Šporcla 31 Špitálka 2 Tenshin 4 vcerejšek 1 Správcovské 1 udegejské 1 tádžikistánský 2 Válovický 1 Tripody 24 Teplomilná 1 Špachmann 1 stepamy 1 triadvacetiletým 1 Supermusic 1 Tarapur 1 ušandas 2 strawweight 1 translokacním 16 Taihó 2 syrman 1 Ternavskij 6 Velenovy 2 Tschermich 1 squalens 5 uchopitelná 3 Tompaládony 2 upíráním 1 Supinski 1 Tvardavy 1 tímúrovskou 6 SRDCE 2 Stosuroou 17 Tejeda 1 svecena 8 svinování 1 SYLVIA 238 usporádali 2 stigmatica 3 uhranut 1 vápnem… 13 Teutul 1 Udeleny 1 úponové 1 uvádecem 1 šroubovkami 1 svodou 2 Tachyony 2 teleshoppingova 1 texturovaný 3 suchotinka 1 týto 3 Tensy 2 Veleby 1 Vate 144 Vážany 20 syndikát 1 velikaja 2 Spammeri 1 utický 1 Underbar 1 Spauldin 1 stríbrské 5 Šumisen 2 Veranneman 1 Usírea 1 Szastarka 2 Strídavka 4 triliovité 1 Uttenweiler 6 Taginae 5 Svazijská 1 Velové 1 Subakovu 1 strukturalistische 2 Supercupen 8 vetknutý 2 švejkovství 11 Trojanowski 151 uslyší 1 útulna 3 TLI 1 trhanic 28 Thovta 4 Suzémont 2 Šumavští 6 thymolu 1 tloustneme 1 Turovskij 3 Vecci 1 Stanukovic 11 Turnová 5 Thugga 9 Steer 1 Stredoslovenských 1 Strorchem 4 Verreries 2 Uludag 1 ucenka 2 Vaqueiro 18 Šustala 2 Tromboflebitida 1 Trigeneracní 1 vähennät 16 Tarzanovi 1 Vaserman 1 Vejdelkem 3 Tanum 2 Strašínskem 1 Vangiones 551 Verdasco 391 Vašek 6 teosofické 1 Stredovekých 1 Uint 1 TopicConnectionFactory 1 Urverahu 2 vetrníkem 1 spasava 1 steduje 1 testuj 1 uhorívají 1 vérüd 1 thudothlon 2 Tupinamba 4 taru 3 subetnickou 1473 Velikého 13 uchváceni 1 Svendem 1 texasanku 2 upravím 7 Topeky 2 staveném 1 Teallit 1 útrobami 6 sousedili 1 Tarnicu 1 systray 44 Stout 1 systémysmíšené 3 Tlapa 1 Tourbilon 2 ultrabooku 19 sudicka 1 Štáhlavum 1 transfúzním 1 Tchyna 2 u 6 tvrdíme 2 Užpelkiai 2 Thespijcu 4 Taklon 1 Vereniana 1 venerabilem 43 Valeriána 1 Turákunu 1 SWIR 1 s emocionálním 3 Utajovaná 1 spalnicková 2 Tasmuratov 63 splavování 1 Trébizonde 2 svalku 3 Tresco 4 Verschiedene 1 svoj? 1 Stiftsgrün 1 Staatenbildung 28 Takaudži 1 Štíhlým 2 Sueina 1 stepový 1 Tichákuv 1 Tapírí 2 Vecova 6 Väinämöinena 13 Unbekannte 1 utajovaní 1 Tealing 3 Vecného 1 Tatzelovou 4 Velásqueze 6 Sweaty 1 s legendou 1 Todtenwolfovi 4 Tedesca 1 Storkyrkanu 1 vandervaal 1 unichar 1 venerunt 1 tetrev 1 Stená 1 Thermococcaceae 1 uzovskepeklany 17 Velocity 1 termohygroskopem 1 Svanilda 1 upanišadami 1 SSND 1 Tschechoslovakei 3 Tilmant 52 Tumen 9 spolupusobit 992 Tichý 1 spocetnost 4 Teplotnímu 1 trichinelózou 1 Taxales 8 Trmac 1 Veleský 1 súba 4 Spinozove 9 Verunku 1 Uchagantu 4 Trebele 3 stredoamerickým 3 Truchlý 1 Udžiie 1 staít 9 stredolevicové 62 svrchovaností 3 unmóglichkeit 1 teve're 12 typo 16 teleobjektiv 2 Trojnová 1 tratove 1 technis 1 Veltheimia 1 Vargacem 7 trávníkových 1 Vankavesi 1 sovvagnskonduktören 1 Spanic 1 TRAXION 101 upevnuje 1 Svítiplynové 5 Toidze 2 Thalus 1 Southwicka 49 VEN 1 ténis 1 Ukrajinizace 23 trutnovský 1 Spastonyx 1 špendlíkovou 2 Tendler 2 Tenebrousovy 1 spontaneous 1 Szabakiewicz 1 Terakki 1 Štetinovými 2 Uuencoding 5 Suonenjoki 1 svorníkovými 2 Tlacítky 1 ústupech 1 Staroboleslavským 3 Tešík 3 Utratil 1 úpit 1 TROP 1 Stogru 23 spolecnosti 4868 ucení 1 Thackeraynu 1 Tornez 1 spolehlive 1 Stephaniacumu 1 varikokélu 107 veskrze 4 ustašovce 3 vencum 1 tancícím 2 Vahlanda 3 Szumowska 1 tetradekanoáty 5 termodynamickým 6 tundrových 1 trakarovou 1 utišíme 1 Strafkolonie 16 ukotvený 4 Thunderscreech 1 Ulkus 1 undergrounding 2 Thiemendorf 1 STUVA 1 telefotickému 70 UR 2 Tatua 3 Tarabas 1 Surmanem 1 Strašidlový 1 Tumbalong 2 Tomomici 2 sugnu 1 Tuannes 1 Speedracer 8 uvezly 11 sumecek 1 Triumfovaly 2 Svetycia 27 teatrolog 1 Stupidi 1 Strouhalove 2 Torreal 1 subatomových 5 upecena 1 Strakatinka 2 spatrováni 1 Trittina 1 stavákem 1 Strotbeck 4 Szamoty 12 Šourka 1 Staghomme 4 supresivní 1 Svitákovou 21 Standardizace 4 Štetcem 1 Vĺgř 1 symptomatického 1 vášneprosté 4 Suzaka 2 Šranecké 61 tišší 1 Surrat 1 Valleywagu 1 Úteše 2 Undermountain 2765 Svetové 4 Stachybotrys 4 Traceyho 1 Vadný 1 tracty 2 Tranqueville 1 usermode 2 údech 1 Staropruská 1 Tarkö 4 Stríže 3 Tichaja 1 Tieh 3 ubouráno 5 sulfoxidy 1 Timbalandovo 79 Šuhaj 1 Strhli 1 Tortold 343 Valdemar 5 Upemba 1 Thmuis 2 stmelování 7 Sthenela 11 Strzelecki 1 Ustrelí 1 tríslovinka 1 synteticnosti 19 Štastie 22 Treboutice 1 strecnianským 2 Szinyér 2 Stepz 5 Táhni 3 uzpusobovány 55 Umelý 2 Tenisovými 38 spoušten 1 Talcahuanu 1 vedieste 1 Trumpešovu 39 velkokrále 1 superpérová 1 Udotea 3 tmavocerveným 2 Twynholm 2 trely 2 sugerují 1 Takeshisato 9 Svorkovnice 45 teropodem 1 Urdome 1 tikz 1 Tonzily 1 subconjugatus 13 úhloprícku 11 Tajmyrský 1 Takoradský 2 Surdické 1 terremoto 1 veldkornetu 25 ښovice 35 uruguayské 1 Teamsystem 3438 umelcu 1 Stafylokokový 133 úcinkovali 3 strávíme 16 Urbis 2 VERDUN 1 Teleprezentace 2 uvabnou 2 teheránští 3 stmelené 1 Transuretrální 2 superbeat 1 Srnícka 1 ‚Svobodného 7 vakovlku 1 Spiza 1 Velelibskou 4 Supi 2 Strakonickému 4 Sponheimové 1 strazie 1 stranga 1 Unforbidden 2 Thataguš 1 Systrom 6 Vešli 4 subsekce 1 toi 1 Supannové 71 uverili 1 Tešíkova 6 Úbocím 1 TRANPS 1 Tromenteau 2 TOTEMPO 1 Športova 1 štepícím 1 Templars 1 ulmula 30 suchozemským 2 tyranizují 1 Strežte 1 uskupovány 3 Vaumoise 2 Šúecu 6 Vana 7 Stanycja 2 teženou 2 Velžys 4 Squatters 3 synergista 325 Tipsarevic 1 Sulfatací 1 Ulicuv 7 Tobolský 1 uo 1 tématizováno 5 Toen 1 Spiraculum 3 Spotsylvanie 5 Udelena 3 Ujezdy 2 vápnomilným 1 Sungwu 1 spektrometrum 11 Tümmler 1 štucel 1 Šúraséne 1 struskotvorného 2 Uhorcíkovi 2 stodvacítek 8 splach 216 soused 5 Thalassiosira 1 Uranotheria 13 TOR 1 Velkomyslnost 1 Strezhnev 1 strelhbite 1 toluenamin 2 ukostrení 1 Ultraphobic 2 tisových 4 Süssnera 1 Turnitz 1 vábnému 1 Spectranet 1 stejnojmennu 6 Vally 23 Štítu 48 Straits 3 triptanu 2 strídnictví 3 syndikované 2 s reditelem 5 spocetnosti 107 Tigres 1 tmelíme 7 systematicteji 1 Spritzen 2 ultrasonografií 2 úhlý 2 Španelovy 1 tigridia 3 Sucia 59 srazu 1 tyroxinem 1 tél 2 Steinitzuv 1 upevnovaný 1 Vejdovou 7 uprímnými 1 Tomjana 10 topografickém 1 taganrožský 4 Sourcebook 2 sundám 2 Sudweeks 1 tracimy 72 tmou 2 Štyrském 1 tercovcem 1 trpkosmiešneho 3 Stanhopeho 1 Theologicis 1 ÚMJL 2 Unhappy 61 souradné 1 Tilok 1 Sumei 2 Urumi 4 úzkozobých 6 turnajovém 1 Tagišové 1 Torvall 1 Verensininen 2 Strašryby 2 Tanneur 1 vambery 41 Tardini 1 Strániavský 1 tongansky 2 tamtra 1 Vedenskij 1 Tacaks 67 trojvrší 115 specialitou 1 tevas 5 Városkapu 1 šumot 1 unisg 11 spádovým 2 spolutvorení 1 Stodtmeier 10 SsangYong 1 Surchamp 1 ušpinila 2 Újezdsku 1 Stolováním 10 Vcasná 1 u blesku 1 synóv 1 Steinseifen 1 Tavishe 1 Velanidi 1 Sprib 1 Strictifolia 1 Szenic 1 Swofforda 1 Vetex 1 vergrabene 1 Stefanucci 1 truchlivé… 62 Tyršovy 25 useknout 6 Úhorovec 1 Valkovne 1 tursio 1 Sumijuki 50 uhrála 11 srubový 119 vedoma 3 strizích 28 Sziget 1 Tocatins 1 thewlis 4 Vesaignes 6 Stoji 7 Strouhalová 87 Švandy 1 Takashimizuno 1 s podpisem 1 Veškrnové 6 Vedmina 1 udrrželi 1 Šuti 1 terizinosauroid 2 Supervillain 92 útrobách 1 Tzuri 2 Stalmanová 18 transaminace 1 Tsyganova 47 tepu 1 tytulu 1 Strunseeho 33 Špici 10 Umgangssprache 2 Szlachecka 1 Varronuv 1 SwingNode 2 vernis 1 útlocit 1 s geniem 1 tíživými 1 sympatáci… 9 trema 1 Uchú 1 Sulex 7 Squares 1 Trowitz 1 Truroská 1 transhumanistické 2 Tréglonou 1 substituovanými 2 Sphinga 12 Vecerem 223 t 1 Statisícum 2 sžíváním 3 Trautenauer 1 thánatos 5 úklony 29 Ústecku 2 STUDÉNKA 3 upletený 1 Tharovi 2 ukolu 1 Triunfante 1 štíhlohlavcovití 1 vadžrájánových 1 Štachlovice 1 težebnách 1 Vĺlerengu 3 tekutejší 1 Steblik 1 sponu 2 sumarizacních 1 trafoplechem 4 Šúsaje 1 Terlického 1 tolazolinu 8 Tunika 5 ucelení 2 suppressed 2 Stems 5 typovými 1 symbolologie 1 submitted 2 sunutím 13 Tololo 2 suchozemce 1 terminalie 1 Starkovské 1 Tonika 2 Suchoju 1 tinitem 1 syfilických 1 Száparayovský 19 svéprávná 7 springerlink 2 unešení 1 Velkoozubenosti 2 Titkoniai 53 sponzorství 1 ukázaném 7 variantním 5 stony 4 Vagaceratops 1 Stríbským 20 testovacími 3 Ujhelyi 1 triangulorum… 6 tugiů 1 stanovištěch 1 Tervasaari 1 Sutomském 1 tapolca 1 Thistlewit 3 tylový 369 Štít 161 strukturami 52 strednímu 11 vaznou 8 taktový 1 Vážnejšími 1 vaginellatus 6 Ujguristán 1 speleoalpinistická 25 tipu 6 Talafúse 1 Tacius 2 streptokoková 1 terizinosauridum 42 Vail 3 tancených 11 Težkého 1 trachínského 1 Timsah 26 theguardian 2 Támovice 3 Vetrným 1 Ušackého 15 válcované 1 stative 2 tunklovského 1 Stankovicím 1 Tarkaleané 7 transformátorovny 1 Štolfové 56 Toru 2 Tullo 1 Takamäki 1 trojkombinací 1 úrcen 1 Todiers 11 Vachata 1 trebestovických 1 Unreinigkeit 1 staen 1 takonským 751 týž 1 sporofyl 2 sýkavkovití 7 Thorselius 106 útvarech 2 Urgulanillou 1 spliceozomy 1 vertelu 1 sulfonylurea 1 vedérko 2 Vasova 1 Tusiit 1 televizia 9 Stežen 3 Thermidoru 1 Talmudic 1 Telestic 1 Tríhlasá 2 Vauxbons 41 Tragická 4 stramín 1 Trachytová 2 ulomením 2 Vdovkovití 1 Sufražetky 1 Telšským 1 Túžba 1 Spirady 1 Utopía 9 trachomu 1 Sozialfrage 110 spechá 2 Sychrovu 1 szobák 2776 tisíce 85 Uta 3 trojlodních 1 Tulit 60 utonul 2 spodnojurského 1 Teplicensis 1 UBMI 19 Ukoncila 11 veštilo 2 tvojeho 1 Summerakademie 1 tritéme 2 velájat 7 Tykocin 5 Stenkilssona 1 Uchuu 1 TOES 7 trámcu 2 Veiel 1 vavrinovité 1 Srivikrama 2 Tyrimnas 2 †Therizinosaurus 1 Verriegelte 1 stálopružnými 9 Tupíri 1 Sperfógel 1 Toolanová 1 Steintor 1 tenofovir 4 Studenecká 6 Vavray 1 Turnfestu 4 valový 2 Técou 1 Varaždínské 22 Tyrannus 1 Uzijahovo 1 Valentý 1 tourainský 1 uzemnovace 1 unifikovala 6 Trifolio 15 Trvalým 2 technologizaci 31 Svinibrodu 1 Trojetážová 1 spolknuté 1 Tchintabaraden 3 Udrželi 20 sphondylium 19 úcinkovaly 2 Ústavneprávního 6 Vatetická 2 Vendeé 5 Thenon 4 spoutala 1 vectoru 3 ustanovované 1 valvaku 1 Ukanme 1 starozagorském 11 úchvatnou 1 Valleronem 6 VAVROUŠKOVÁ 1 vetší špicáky 28 Útocící 38 Traviata 1 Trene 2 tichon 1 spoluzaložit 3 Tiberiovou 33 taoistických 7 utíkajících 12 Tanzania 5 Turetschek 1 Úbl 23 starozákonním 1 uwija 1 Trebonínského 2 Turkotataru 7 toulám 2 s úmyslem 2 svatoviktorských 114 ucinily 1 Užhorodensis 1 údivu 117 vany 1 szakálhátská 1 tetracantha 3 TAMIL 1 vetë 1 Typhlogobius 60 Susie 6 Veteránský 1 Uhliarikem 8 titanitý 11 s Markem 1 Turridae 10 usedlostem 1 tinosporová 7 Strug 2 Subkutánní 6 Ustav 2 Spuria 1 Telefericouio 1 Subterraneus 2665 tzn 1 SWRPwPost 20 Trebia 121 Strahovského 15 úpolín 1 Straußova 2 Tsvetana 1 Urgošík 30 Tudman 1 Svinenští 1 tfuj 7 sqvinnor 1 srílanskými 1 Thissio 1 úradujcího 4 táborita 2 stredonizozemského 21 uvolnene 2 stmívac 4 špitálský 1 ušijí 1 transposici 1 Tímúrovcu 1 TELEX 13 usedlá 47 úvrati 1 Staletou 8 tapetu 1 TrueFFS 1 Spui 2 Trabandem 1 Strojitel 2 Vasselay 1 Suis 1 Ubikvitin 9 trestajícího 12 velkovévodkyni 1 Utlacují 8 Synaptic 1 Tuncqem 4 tvrdolisté 3 Tribou 2 spolusprávci 12 transplantacních 32 Tabríz 28 Útes 1374 umele 4 ubíjejí 5 spalitelné 8 Tomasen 10 subtropickými 1 tabalet 1 spolupracovati 1 Steynem 2 venusi 2 Stojcevská 1 vaišnavismem 1 uhrovské 23 úcinkovalo 5 uzamcenou 1 Trechmannit 1 src? 1 Stdout 128 Tizian 668 Stuttgartu 94 Theodorem 1 Svalave 1 vazacovým 3 Swedbank 2 starohrabenka 1 Tuscsonu 11 spermatocyt 28 Uluru 1 Sutaška 162 Štorch 1 temperách 43 vegetativních 20 stavidlo 8 TIBA 1 Speleologická 1 sutaškou 1 Štáhle 26 Stredový 1 tufitových 2 Superdruh 6 TETRA 6 subalpinum 4 stannému 1 švandovské 1 SuperNaturalBreakdancer 22 Stecherová 6 tremolit 4 Tavan 2 Swatek 1 Staatsministerium 31 uschován 4 Stáhala 1 verdung 1 Taní 1 Ussita 26 strelkyní 4 tiko 75 uprchlých 4 Teleskopy 11 Úrodný 1 Typographie 2074 svedcí 1 Švédované 1 valencijsky 5 umrzlých 1 Vahrize 5 Turkovic 1 svrchníky 44 uletel 8 tetanospasmin 1 Stounding 2 SPRINX 1 starocechem 1 Vaccinieć 1 SÜDOST 2 upírce 1 sulfonyl 1 trencínskému 1 Trickettlová 1 Teživec 1 spoluobjevitelum 5 svecený 1 subsidiárního 5 suplujícího 1 SPCK 1 tancenou 23 Terc 2 Soziallehre 6 Sutilem 1 Tonuela 1 SuperLigy 1 vesillja 15 Verifikace 1 Strusu 1 Trauzlova 1 spongiozní 24 svedomitý 3 subverzi 55 Steiermark 12 Ud 1 Toubridge 1 Taravai 4 Toufarová 1 staroestonštine 4 Tuscie 1 valencijsko 1 Trezorová 3 Vassellová 2 s cernými 27 tapisérií 2 s otcem 1 sucks 1 Tampskou 2 s?tvorite 1 Suchorková 1 stromeckovitými 1 úcas 3 VECI 117 ukotvení 1 Sparacia 1 Vermittels 108 strhl 2 studuju 1 Unbegrifflichkeit 1 Supernoc 1 Špremové 23 Thicke 1 urajiro 1 Swierz 1 Vangem 115 Témata 1 uau 1 Thubigen 1 Symmeria 50 varhanáre 1 Trauchburského 1400 tradicních 1 Steyemark 1 S okolím 1 Thunamn 16 Šuk 1 usporádní 5 tylakoidech 5 trírozmernou 1 tufitovém 99 Vcelka 2 trívežový 1 Tschingelfeld 1 Steensen 1 táWIt 1 trifaria 1 Váženým 2 Templeove 1 Urizielu 1 temoj 1 stríbrnomodré 2 Tajgonos 1 TRhJ 3 tázáni 2 stk 1 Valdštena 1 Tugenhat 1 s castellerskou 4 Sqele 15 Vesti 4 Tinnitus 1 Sulaca 2 Sysoev 1 upracovaném 1 tretrigintilión 1 veluru 4 Staakenu 1 Trzescianka 1 triratny 1 Urlichem 583 trvalý 1 Svperstar 1 Tkácovej 1 Vandreier 1 Sverdrupem 1 Svetocáry 1 Sussy 1 Tolcinský 4 spegazzinii 2 Valentinovou 1 Törös 1 Va?cau?i 3 Turjak 9 varhanech 5 trojplošníku 495 teší 1 stojíren 3 Timošenkem 83 spešný 1 Uhlar 1 Technocracy 2 torické 2 Tamurt 2 Uzejir 2 tuva 2 SunbulbZ 1 Thyngowe 2 ustupuji 2 Turtschina 2 Velínská 1 Unkertonovi 2 Velovou 1 užíti 1 Szybowce 1 stassfurtské 1 ultraštruktúrnej 23 Tantalus 15 Valáška 1 Telkiyski 1 Sousatzkou 3 variogramem 2 Torgavu 2 staniolovými 1 tasmannica 1 útesú 1 Sympsona 1 Stohwasser 1 Vandenbergu 1 Sternberku 34 symbiózu 2 Svátostina 48 Stružná 1 Trémolo 1 udále 117 tre 1 Strojtransgazem 4 Torcuato 1 Usmanovem 2 Tasking 18 štát 1 Tellyho 25 Stretch 2 Stoof 23 udidlo 1 Superstrunová 4 trískami 1 venulosa 2 Sueno 1 stanco 1 tomentosiformis 1 Swarzewem 1 uchopitelnými 1 Teamstery 8 Tayot 1 Tribl 4 Thámove 1 suchdolském 1 stopková 1 tesselatum 1 strevíckem 3 Tharparkar 4 unciálu 1 Ufnukanec 1 tractiunii 1 Teharjští 1 Transalbigen 8 Syrov 4 tvrdidlo 14 Stavedlo 2 Tapti 3 Sredici 3 Stet 1 Valchárem 1 statej 1 Tartaczny 243 svobodní 7 Ukuru 143 tempa 117 tely 28 Tišina 412 újezd 1 Stejky 1 štetinu 3 Totemu 7 Ulba 17 velkorysého 1 Ssporitze 23 uhelnými 1 Stoppen 1 udroj 1 Sunessona 1 Theologo 22 velrybárská 3 Taviru 1 Vannay 2 ušlém 1 stredomadarská 1 Szaranowicz 4 Tracky 1 Togni 9 spinifer 1 svarováno 1 Veleticemi 1 stejnítek 49 sprátelili 15 tessellata 1 Thórsmörk 12 Syk 1 thiopurinu 1 Trustul 1 Velocipédy 1 Valaama 52 spinu 7 štaflích 1 Tachtadžjanova 1 Togašim 1 Telecomix 3 svem 15 Surat 1 tepových 1 Verschraegena 1 Successive 2 sulevická 3 Timorský 1 svetlopásku 1 Tlustoocaskovití 6 tiebreaku 2 Stolzinga 2 Sparrowovi 3 Veršininem 2 Ubinskoje 30 Studebaker 2 šviháky 1 Stewartby 1 sultánští 2 Upustilo 1 Tómate 1 s principy 3 Taskovka 1 tarnovské 1 uhašením 3 Urusov 5 stiženi 1 trojhonná 3 Textilácká 1 trenového 37 Tichák 1 ‚Ufo 2 Strachwitzthal 1 Tetajev 1 Vaudémontuv 19 tygrovi 1 Sylwiusze 1 stilizace 5 Tecumsehova 6 USFWS 1 Tavakoli 1 Stalkerovi 34 vápnomilná 1 Vanphilos 1 Tofalvi 1 Vescovile 1 Sparf 1 TextilEco 6 surfaces 2 TIRGO 2 trojveršové 56 ustupoval 2 triapadesátiletého 24 vagónech 1 suffolkská 1 Upu 15 Šticí 3 Svidovský 230 užitecná 1 Tešubovi 1 Supplex 3 šovinistu 2 Treffieux 1 Sry 6 Vesjegonský 1 Tugumíruv 1 umyvadlové 1 Svrcekl 1 Tyburcjusz 1 Tristárským 3 Topí 1 tehlicky 1 Tjolöholms 1 uzavreninou 2 theblackstallion 2 taktnímu 44 uposlechl 34 trestanecké 1 szczeka 1 Vaune 1 Umingmak 1 šprickou 1 trojnápravové 1 upra 33 TfL 24 Thunders 2 uzunoglu 5 Tetou 9 usídlovali 3 Trénovací 1 theologynetwork 1 varovny 1 uspalo 4 Squalodon 55 Systema 1 šumare 1 Väliová 12 Trotiny 2 udahárana 9 tavná 1 stadardu 1 Tookem 4 vázajícími 1 Vetvoví 8 turkmenského 1 Tapparone 1676 uvedených 1 u zalamování 1 tresavek 1 Sprisahanie 7 Stopare 7 Tambroni 7 Starhembergu 1 Varaždine 10 stocena 1 Uńa 1 Tshaikovski 1 spankera 1 stejnoocasý 1 Thimbu 1 Unprompted 1 Stakleni 12 Tomanovou 1 Templeglantine 1 topografic 1 tinyblob 4 Vermeeruv 1 supertibreak 1 Trutenowa 1 sthána 1 Tripúra 2 Strezislavy 13 utváreli 1 tympanonen 12 Unisono 5 Stredomoravskými 1 svítkem 2 swingove 4 ÚSO 1 stáhnutelné 1 Tylmanem 2 Später 1 Štátném 2 THEISA 1 Tectia 1 uzdeckou 12 titr 1 Uvítáme 1 Thurama 1 Tabúk 1 státocentrický 3 Svetry 1 Táp 9 stredotónového 28 Uppsaly 1 Treplevovy 1 sphingo 1 spoluregentská 2 Veldt 2 Taillte 6 Trogiru 1 triérarchos 1 Tienová 1 Torla 1 Staubiger 1 Tenzanii 1 Tanainaové 14 tlacného 2 Tušla 2 vepsati 1 Štemberková 1 Tísíc 1 Stourtonu 1 uciení 1 Stromeyerem 78 Stepanovic 4 travelátor 19 Trientalis 1 troujúhelníkovité 6 sredniowiecznej 1 svanetské 1 Sturmfedrová 12 TUV 3 spradatelného 1 Uttero 1 Stlacené 1 Umweltbuch 1 subverzní 128 Székesfehérvár 1 Švenajs 1 verfhren 1 Stahují 1 timezone 7 Thomaskirche 1 Starocínští 2 Spouštené 5 Stroupínského 2 Svaryšovského 1 Úchylák 1 súkte 1 URTICACEĆ 13 Ullevalseter 1 turkeys 2 Thiazol 1 umhausen 22 turnerský 4 Suchodolské 189 stoka 4 sportplus 1 Superlifter 2 subjunkce 1 Uhlím 3 titus 1 Tiffem 202 Stéphanie 8 uhlících 1 Trinácticlenná 1 Tárajka 4 Stavitelská 1 umbjärv 19 Stankovský 1 Strauus 10 symphonique 1 Tluckova 1 úkladnosti 69 Ut 1 vazhod 1 Szczotami 3 tatštiny 1 tydenudrzitelnosti 6 Stoniš 1 Tkibulské 1 UNIMACS 32 studentskými 1 Terryschmidt 1 urtika 1 Trma 1 velmistrových 1 Superioara 2 Stibara 1 TurkovecKaráskuv 1 Vejrova 1 špulír 2 Sponová 1 s Cechy 3 theopoiésis 1 Subotová 3 Vencelia 34 štafetového 1 Vastgoedfraude 2 svetovou 4 tmavovlasý 7 Študáci 1 Torimirem 1 vaikenija 37 Tackle 1 Tonuv 2 Stuckenschmidta 2 Strakách 1 stribrnyi 2 stare 12 spolehlivém 11 supset 1 Tomašovského 3 Vecerí 3 Svetoslava 2 Šumvalde 1 údržbárka 3 velkepopovice 1 toskánštinou 2 Talaa 13 Stóra 1 tajamu 2 studova 4 Stácecí 5 strelau 1 TCHIBO 1 Thermidorská 1 Vajdovského 4 STES 13 svetecké 1 Unmodified 1 toho… 7 tachovské 1 velk 160 ubytovacích 1 šúlance 2 Tiszu 2 Uncool 1 SuperBASICu 1 svetluškového 2 udmurtském 10 Vacherot 1 Treboce 1 Triagelnem 2 Stadtluft 2 spleen 1 tetricella 1 TAVEL 4 Tenrikjó 2 Sudupis 5 válcovanými 1 Várdomb 43 Sungu 1 Tautu 10 úkazech 1 Vallova 6 ulpívají 3 Uebigau 1 Spirillium 1 s ovládáním 54 strahovského 1 ultranacionalismu 2 Stiftsgĺrden 1 Triumvirátem 1 Trollio 4 Tríkolová 1 Tobikage 7 unicovský 1 telekanálu 1 strazile 1 Thábit 1 ucinenému 1 Tutela 1 stochastische 14 tetraedru 2 Szpiglasowe 3 stínomilnou 1 Trojanovský 1 Tikalove 1 Stadtmusik 102 Tyrolského 1 teretoscapus 1 Varpolje 2 velkouchého 1 strárne 2 talen 1 ufocasebook 2 spermicidních 2961 Stavba 1 Thiébaultove 6 uzbeckou 1 Surfeit 6 suterény 80 substituci 2 UNIBUS 3 Szoka 3 Steichenovi 1 Telofosy 14 Tsu 4 tranen 1 UNHZ 1 Strebre 2 Turres 17 Úpská 2 Stadelheimer 1 Stoudsburg 6 Verifikacní 6 truhlou 4 tetrandra 3 Veldeho 1 Unterägeri 3 Stilleben 1 triakem 5 Torcellan 7 velociraptory 21 Syco 1 telmaranské 7 Vašinek 4 utecenecké 1 Špicníkem 9 Stander 12 stupackami 1 vejírky 4 Telomery 2 Teinostachyum 1 Tangeum 21 ubehnout 1 stoletíLeontiosTiberios 2 vejicky 10 Usíreva 15 Stanislavs 1 Sudoverf 1 Tetourovská 1 TrackManie 1 UNITEL 1 Stampi 2190 vedoucím 1 svlažovali 1 usurijského 2 Ušiširské 3 uvolnenie 2 Vettisfossen 6 VESELÁ 1 Topino 1 sychravém 14 Trubec 1 veporického 2 uvádeji 1 temporálu 3 Vagonky 2 turmalínové 2 tragicno 6 Utajované 3 Vergnügen 1 suwaru 1 Thierolf 1 Thornasit 1 thewho 1 SPTŠ 1 Vanišova 27 spríznenosti 1 umož 5 Staríci 1 Thosernu 20 sverencu 540 sprint 3 Stolaci 4 uvadecem 2 timeoutem 1 tríjádrový 4 sportovninoviny 1 Suebi 1 theologové 1 Torber 2 svraštelou 1 sudbách 1 Turonu 1 udeslíku 2 Utraria 1 vemena 3 streetballová 2 strelmistra 10 stvrzené 12 Ulriken 13 spinus 6 uvozovacího 2 Staatsschauspiel 3 Tituš 5 Veno 5 Štuly 5 tityrus 1 s dárci 67 Tajcnár 9 Sverákuv 1 telesový 3 Tika 11 sulfáty 5 Suchardu 2 Tognum 2 Termis 1 Thorstenson 1 Suffitus 9 SteamOS 1 tucha 1 superpadouchum 2 sulfolipidy 1 superagent 1 Sphninx 1 Stearovu 31 sušicko 1 urbárskou 6 Stardance 1 SVKM 1 Sphaerobacteria 3 Tympány 24 Sunflower 4 Vdara 4 unikáním 10 Tykal 20 transatlantický 2 Sylvany 1 Strednic 2 tetrami 1 TRIMování 7 strízlivostí 2 Südukraine 1 Šubírovi 2 Spezialeinheiten 1 subwooferové 6 Thajce 1 Tuvincum 1 strboulene 1 USADíky 1 vecno 5 UIAGM 1 Thaici 2 trapi 1 varicose 13 Šuej 18 sverenec 8 tsonga 1 subboure 27 štenecím 2 Sparxxx 1 Tammas 1 Strébluv 1 Udomlja 1 Tíhai 1 teóriu 1 tombaku 6 THelloWorld 21 Steklého 1 Uglovka 1 Verabschiedung 1 Tzofit 2 stravitelnejším 2 syslem 1 Trittrollerwettrennen 1 systolickým 1 tricholog 1 usýchat 8 Studenceskaja 19 Sportif 1 Thavab 2 Torssonena 1 tanahnya 7 Strongyloides 1 subangulární 2 Úhorovcovití 1 Tangelwood 550 Vesnické 243 Vasco 2 Transilvanie 19 Teodosic 15 spalo 8 Uca 3 tuta 1 Torsteinson 1 sulfonovat 2 tlumenou 1 stakatové 1 utriusq 2 Urdd 55 Sušené 23 Theer 3 Stejnonožci 11 Verdugo 1 trnad 1 Tyuratam 9 VÁC 46 Vettela 1 vácovském 1 studiów 1 Stealt 6 Tancreda 7 Tapani 1 trichophora 3 syncitiotrofoblastu 36 talentovaná 91 Ucho 6 Valchovský 2 trihalomethany 2 stavákum 1 ÚTR 2 Veterinárská 1 Temény 1 teisticky 6 usitatissimum 520 strelce 1 Tschimischl 5 SZSP 108 ušlechtilých 53 Tanacetum 4 Tremešku 3 tympánistou 4 Sulin 1 spolecenstvi 26 tp 3 Valentinovna 1 Ucua 22 synchronizovaného 16 Šrumová 1 Sukaová 4 Strezivojické 1 Techanove 2 Vdechoval 1 Sphudžidhvadža 8 úslužný 6 Tamaricales 1 Tuglase 13 tresou 183 Težké 1 stopári 2 Toporninském 1 Tetramerium 2 Spartidium 2 sprašového 1 tortuosita 1 Svetlograd 3 Tereschenko 3 Talpaš 2 treboradický 1 s body 1 staroverí 1 Syly 1 uhelnatení 4 velkorážné 1 Strení 1 uškoditi 20 Tachovské 2 Velichová 3 stydkého 2 Tutum 1 vekach 1 Ukládám 1 Vandewal 23 SWOT 21 sprosté 1 Streuber 1 Tempestiho 10 Tande 1 suberifolius 3 vajda 3 spoluviníkem 16 uzpusobených 4 Uosupelis 2 Tuklatský 29 TTIP 7 traverza 4 Stauton 87 vecná 1 TREBORADICE 31 Teiresiás 1 Tuckoo 1 tanden 1 Trompeta 1 vazoaktivních 2 teenagerskému 1 Spolubratrství 1 Spartiatu 5 srolovat 8 TRE 1 Stereofonním 1 tomšarkovky 1 teritoriale 12 Thorén 1 Tenktonézané 2 vcítením 7 Sprüngli 7 staveništní 1 tlumích 1 Udeme 5 uchovávaní 1 topsi 1 usporádené 10 substituentu 1 Spiritualisté 2 Teretická 10 špunty 4 Ullielem 1 státotvorná 1 Straußnitz 1 Tammetaguse 1 Spiz 2 Vachová 1 Vasylivky 1 superregionu 1 Sternberguv 2 Tęche 3 Ústavních 1 tčqu 1 Tzan 1 Tunkinsky 1 Tennona 3 Strnadova 1 Tartárie 2 Strömstedtová 1 staplerová 1 Velkorážná 4 Stahlberg 1 Synechanthus 2 Spropitné 1 Thelemu 1 Tahoun 1 Tgantieni 3 struttura 12 Synchro 1 spoluobdržel 2 tollánských 1 Utwory 53 touchdownu 3 tyrantského 1 Stredoafghánskými 61 sourozencum 1 Vanamoisa 2 Twen 4 vestfálská 1 Teutschmanna 2 uloupením 1 tytus 6 Stasium 5 stranickosti 5 Vánu 6 Starožitník 3 veritelská 1 tharva?girasa 1 Stasiewski 2 Tarasi 3 Streptokokóza 14 tremolem 15 Tahri 1 trifenylfosfát 1 Stöhrova 2 Tunkel 1 theravádové 30 Szabadság 3 stratovulkanické 1 VENDORS 1 sympathetic 1 Syzza 6 speleologického 1 Tafleruv 1 Torpedocomics 1 vakové 1 Sucherle 43 symbiont 3 Tarasovna 35 Vašatý 2 Suchogo 1 svatonepomucké 1 stáhnuvší 2705 španelské 8 Trilogii 4 Symphonique 135 velmoži 17 Verrazzano 2 utetím 80 ukoristených 14 Štenkov 1 Verlobte 1 Tibga 6 Tarsiger 1 Ssonwerd 77 substrátech 1 UTS 4 Szabadcsapatok 1 ULou 1 ukulelové 1 VenusWillendorf 2 svedivou 1 Ulmana 8 stefan 3 styani 12 Striktní 2 Turbay 2 vejíti 4 svaritelnost 1 ucházecu 2 Vedenejev 1 ulovitelnou 30 uchedet 3 ukazovacími 1 uchystání 1 Stjřrdalshalsen 34 suplentem 15 Trappes 1 stejnojmennný 1 Tandžóbi 2 tollánského 1 Steblina 21 stisknuto 3 stradatelu 10 Spolecných 2 venomous 65 Spooner 1 verrücktes 1 TERNSTROEMIACEĆ 1 terrigenního 2 Tyronovi 8 uschovala 9 topicu 1 Tabuuu 1 Strřmme 117 ustavila 2 Stadtbus 17 Tenký 1 Tarpana 7 Vernadského 20 Ternate 1 valecnych 1 Streuli 4 upalováním 3266 Své 1 Steingringpriel 1 Varioprop 1 spokesman 10 variicolor 2 Swensonovi 1 štítkovaný 28 subkulturu 1 vcelojedy 14 sourozenecký 3 Stufels 2 Spylo 10 Strachovicky 1 Troia 1 trebešickému 3 stotricátý 5 Suckever 2 Syntonickým 2 Trúdgelmira 1 Uhasíná 2 Tölösština 5 Trauttmannsdorff 102 tmavohnedé 2 Templar 250 tématech 2 tetragrammicus 1 suchoprd 1 Stadegge 4 Suetoniem 2 timide 5 Táborníci 1 Syrakúského 1 Spynie 68 tlacil 1 strumicníkovití 5 Trell 3 Venglošem 2 TURRA 2 Thaumantias 30 superlativ 3 Tschernitz 2 Tvrzenovité 17 Venkrbec 1 s Nemeckem 1 stevensonovské 1 Spenglininkai 1 ŠPUREK 3 subdistrikty 1 Šromovou 2 thiomocovina 1 Traganová 3 Váhanka 77 umistování 3 stárkou 2 Usworthu 2 Valkhoff 21 Summits 1 s olejovými 1 Upuna 1 Veniaminov 6 swf 2 Uttenhoffen 2 Tzaar 1 stanwagon 4 s hlavní 1 Udagawa 1 temenos 17 STR 1 Varjoista 31 vedním 16 úživnosti 1 Tibatrochus 14 traumatických 1 spiritofalbania 2 Tithonia 20 Úmrtní 1 tajjáru 37 Verná 1 staroveku 3 Thielova 99 úrodných 2 Thaumaturga 18 tridentském 2 tafocenózy 2 únavném 1 Tameru 1 sporitelna 40 Švandrlík 1 Steropa 6 tancím 1 Unerfoschte 9 Theodorichovi 1 TEXTILNÍCH 1 verikální 1 stydlivejšími 1 Suwajda 1 Starojické 365 trosky 6 Summaga 13 termostatem 1 tomhletom 1 totalitarnymi 5 stmelujícím 6 Succčs 1 tichúcko 3 Vanags 1 Tumbakovice 1 typici 1 uarnak 2 Spinov 207 tribunál 35 Stakory 2 Thompsonových 1 Trojanské 27 švem 1 Telekie 1 Svintsová 1 Stratcheym 1 Syllabica 1 Trenodija 2 Svederníku 2 Supová 11 vertu 1 Stöhrhaus 1 Starcasterem 2 Spaltem 3 TiMidity 1 Tochar 1 Thierie 1 submetallicus 6 tmavohrbetý 1 Vairócanovy 1 väcšinou 3 Suerig 2 Štarnberském 41 trutnovské 1 Unbending 40 Swietlana 1 Valentinovými 4 Triggerfinger 3 Tuae 1 UAProf 1 Štepánu… 1 Süssmayrova 1 ustaraným 1 tmaváci 1 svetelkujících 3 tangalunga 1 srodkowo 1 staphylaeoides 1 Stigmatizující 1 Stopa 75 spása 2 stepokuri 1 Stringhamit 1 Sphaeromeria 1 Tirinove 1 Touletova 1 úpadkovém 1 Veverce 51 Stockport 1 Splachovadlo 1 tenerezza 1 Typografických 4 Tojamského 1 surrogates 1 Stretche 46 Splav 2 UBI 1 SunSay 52 Species 18 Tsun 2 topstory 13 Stagnov 7 štukatérství 1 VENDOR 4 Takruny 1 trimethyllysin 1 Vesperinae 60 stékající 1 UPWARD 322 vedlejším 1 Tašunko 3 sumarizoval 1 Syntetizované 2 trazada 2 Tetrascroll 2 uveritelne 3 Sulakvelidze 1 Václavknoll 1 trojdohodu 1 trifidích 1 upoutávajícím 6 Šperkotne 2 techstep 55 supravodivosti 26 Tennengebirge 2 Tetmajerovým 1 s ISDS 1 Susiestevens 1 Sturman 1 Tradingu 2 uplácané 1 toreadoruv 6 tesselatus 1 Vaea 19 Tepesi 1 Ubesiukas 1 Syllogismi 1 spalnému 2 stoja 2 teistickou 6 TECHNOLEN 1 Velickovskyj 1 Tillomys 1 vaelnou 2 sverná 1 Strížkách 3 thromboplastin 18 torzovite 1 Valtínovského 8 Šteflícková 13 Trebomyslice 2 submarinních 2 Turkyni 1 Terjuchskij 2 sporitelnictví 1 superpumy 1 Telegio 2 s Jozefom 32 todo 1 Tyrrhenského 2 uglov 1 teent 1 Tallinfilm 12 Talca 7 štukami 1 Tonaudio 1 stravenkové 1 Varovo 1 tomasvokrouhlik 22 Úcinkování 27 uvázání 1 Tetranthus 4 Taieb 1 Springkraut 4 ujištuji 1 ThreadWeaver 3 Transcendentalisté 4 tlejícími 16 Tranquillity 1 štirih 13 tantiémy 1 vajehij 46 Topographie 668 Tábore 1 Svéživotopis 18 težního 1 transpermethrin 2 Strízka 1 tádžickém 1 spišském 311 svobodným 3 uranicito 2 Thoiria 1 subventrikulární 11 Tronchet 3 Vedeckému 23 trojitou 1 SUPR 10 uvízlé 2 Vaye 1 Tercios 8 vestibulárních 1 Telereflex 11 Verhagenová 1 Turšte 1 Tkuilkotriašviliho 2 Tlslikevirus 1 Šupinkovitý 1 specjalne 1 Trebosztó 1100 uskutecnila 20 Sudetendeutsches 1 Sprechoperationsräume 1 Šuanglin 1 Trapería 106 uzpusobené 1 Strednedobe 1 Thielisch 2 Sujdy 1 tabasalského 5 velekur 2 Tematickou 2 transneptunickým 1 Szelków 13 svítivý 1 Szacon 2 soupodstatnosti 2 Úveruschopnost 4 Vänersborg 2 Sourrieu 1 Tuneluje 25 ultrakonzervativní 2 stínomilka 2 Velkomezirícskému 3 Tielemans 1 TESSFACTOR 22 usmrcování 7 sumarizují 5 Torreho 3 Urra 2 Tsehaye 1 vautlhunter 714 soutežní 1 Tusuros 1 Taipeda 1 Ultrafán 5 Starcí 1 vedkynemi 51 Togu 1 Tecúna 35 subjektivita 1 Troella 585 Tilia 1 Tatíceka 1 totalitario 62 Tarantino 1 spoluzávislé 26 težcí 1 uwag 1 vernalizace 10 Stance 1 Torrefranca 1 Špalkovi 1 Steyl 1 Správovne 1 Tortikolis 1 Sřvćrnet 4 stefano 2 Strížovického 12 Uloupený 4 ukrajinskojazycné 1 Sula 1 Tarnat 1 Steveovo 1 Ubytovávání 1 Tichonenkovit 3 UMNH 6 Verstehen 1 Stuardus 6 †Tapirus 2 Tiébissou 7 suchum 8 Trubejov 3 Toolkitu 1 Straßham 4 Stopkovýtrusé 13 thomas 1 Vedralka 1 Surit 1 subepiteliálne 1 tufobetony 1 spredeného 1 Usteĺne 2 Tlustokožec 2 spolužijícím 1 Subclaviopulmonální 1 termovizorem 1 Velbín 1 Trzanowice 1 tni 37 spekulovala 2 Verguts 30 Tekly 1 Surreyi 41 tiao 1 stichos 1 Toriny 48 strukturovaná 1 Štirovniku 4 Uslaja 1 Termoplastický 1 Srážkomerná 4 Ungolu 1 Urumovem 1 Sudzionas 21 Úhrnem 2 Ubinský 12 Upside 1 Specialstatistik 2 Spongioformní 141 urovnání 1 Toxygene 1 starešinum 3 ÚTVS 2 Verunu 1 Ukryjí 1 tohotže 1 Streinovi 2 transiens 6 Vachrušev 2 Tacci 34 vážená 4 Stanoje 5 usídlenými 4 Towey 1 Theophilea 1 tolkienovského 1 Šušenského 3 Tvojej 1 soupri 6 Vanuatské 7 Veldová 1 treníí 2 umorovací 2 stehlíky 1 spolocnici 33 ustavilo 1 Tankisty 1 stockmanni 6 veštbami 2 Tournans 99 teplotním 4 Trnavskou 19 šuo 1 splouval 1 Styrienne 1 suera 9 Veronský 1 toastuje 2 Sverná 9 trumfová 45 svatyn 1 spoluporucník 1 vegnem 1 váboru 1 Teineit 3 ústavodárnou 1 Steeljaws 1 théatre 2 Stébelnaté 1 Taišl 1 Tulnitz 2 Trachtovi 1 Turbinatky 1 Takvamová 2 úvalovitými 224 Topolánka 1 utešujícího 1 stát strហ17 velkomestské 1 thromboxany 14 vavrínotvaré 2 Verson 7128 téhož 2 Tušinského 1 Trincinensis 2 thermidorem 124 svatostánek 3 transzendentalen 1 tertiam 1 Stojaspalová 1 superprodejce 6 tämä 1 Terciáru 1 Valentonském 1 Sushkov 1 Sturowitz 3 tilo 1 Tiglietto 3 Tangram 4 süana 2 Spotrebovaná 1 univision 2 SRBIJA 1 teocinta 1 Stellingovi 1 úmrí 1 S telesy 10 Taus 1 Toppell 1 Spotting 12 tataria 1 sudoriferae 55 stipendista 1 substechiometrický 1 Stlace 6 Taov 14 Úhloprícka 1 toušenský 231 stoupal 1 tiarelloides 123 ustala 16 Tamera 2 usaid 3 Trcala 1 Sphaerocardamum 1 trebíce 1 Štefel 2 strednú 2 Tojma 3 Tenmon 1 Tralaland 5 teplonosného 3 veršový 1 ultraradikálních 2 spektakulárne 1 Studiomega 2 Stratusová 1 Steinbo 1 ubuntulooks 1 tervingskou 1 tuje 1 unaccredited 2 TEPLÁRNY 1 ventiuna 3 stírce 1 Transferencia 4 uhrazené 1 Tolcsva 2 vetrosnubná 2 Szczakowej 433 telu 3 šroubovém 8 Tokicukaze 30 Threonin 3 Vettore 1 Temas 1 Valalický 1 Tracondorff 27 Trovati 44 Usacov 1 s komtesou 1 Syrgiannes 1 Syphila 2 Trégastel 19 uh 73 uplatnena 1 Spravním 6 Tatuma 6 Úvalu 3 Sturer 1 ultraširokým 2 úkrytum 14 svatostánky 875 State 85 tomhle 6 STROP 2 Steinmaslera 1 tesneným 3 Tatari 2 sumcovití 1 Teevra 4 tuláku 1 Tanecky 2 stropove 3 Tanacross 1 Thabór 2 ukocírovat 1 Vellano 1 štípatelnosti 2 Széleskút 2 Usteria 2 Triumphatus 1 superelastické 1 Veteránklub 5 Sunsoft 124 témuž 1 Usmrcovat 1 Stewartovo 2 spiritualibis 1 Vanhalovy 1 Tramline 3 Terumasy 150 venkovním 1 spisoatelka 2 Stájový 4 trináctipalcová 1 Úpohlav 38 tlapy 22 Sovetu 5 Togtem 1 subarachnoidealní 2 Tvedestrand 2 supportedlock 2 vecnosti… 1 stredoplošné 1 supertajného 1 Spermanuv 1 torquesy 2 uchovávaného 1 Tunbear 161 Tatary 1 tyratronu 1 Theofilovy 1 ušti 1 telectí 1 Suweid 2 Štástkou 1 tablesg 12 Štastní 484 válecným 2 štenetem 1 Vadla 2 Srodowisko 2 taidemuse 2 Teküder 1 ungeon 1 taxiku 2 Tadousse 1 Valko 2 svraskalými 460 UV 1 Vartox 2 Sulfuric 1 spantecŕ 1 tadžictina 3 Spinocelulární 2 Toropec 1 Štúrovho 1 Valentinianovo 1 Tartagliou 1 Thwardens 1 Spiru 10 Ventotene 1 tichounce 1 sthira 2 tandúr 30 Supersport 4 Tunnelling 15 Tendencies 3 Valvoline 3 stolístkem 38 Tacomy 1 Thymaterionem 3 Swayvill 1 vandyckovskou 33 vcasným 5 Tonegawy 1 Uplácející 1 spálovského 1 veloz 3 Superiori 3 Upozorní 1 Spoluprezidenti 4 taca 2 suhrkamp 11 supervizi 1 trvanie 5 ukrajinske 1 svitecka 7 trejfe 15 Störig 33 transmembránové 2 transponují 357 uvolnování 1 stehovat 4 treet 1 stenovalentní 1 Tainaros 2 Titao 1 Tashpulatava 1 Thiollier 1 Velkovýkrmna 73 ŠS 2 sytícího 1 TELEKONTO 1 stanet 2 Tulešický 1 uhovodíky 2 Spittlerová 2 trahit 8 spejte 1 temptant 5 Trácie 2 Tamaricineae 1 Taoangi 3 spektrogramu 2 Verzegnassi 1 ultramarínove 7 tidé 1 tenne 22 SpeccyWiki 4 surovostí 3 Termoluminiscence 75 ústecký 4 TESS 1 SpaceShips 3 Vatanenem 23 svežím 1 svetoplochu 1 Tomicovou 3 trestaným 1 Tsongase 1 Tošicuna 2 stehe 16 Veruela 7 Utherem 5 Sveráková 4643 Spolecnost 1 Svíravá 5 Spiroudome 2 spermaticus 5 Umbelliferae 1 strukturam 3 spraženo 1 vcasností 1 Veško 15 vazokonstrikce 1 Tibek 1 Šterzelová 2 Venezze 4 Tętes 20 terezínských 1 VAKALON 1 tecovat 13 taki 1 Triebold 2 velkomoravskej 1 Teqo 3 Spojující 1 ULPIUS 1 sovremennika 9 Stavropolským 2 Stredocs 1 Spokojili 1 tomck 5 Ujejski 5 Tejovití 2 systematizován 5 tríštily 1 turské 1 Tokhtung 1 uploadnout 1 splavovacích 1 Trípatrové 1 Üksi 1 Swenssonová 96 stržení 18 spícím 811 Uhersko 206 sýry 14 sprch 1 Streamers 34 teropodi 1 Vanákové 1 Vegetující 2 Sylvains 1 Sušského 1 teplosmenná 1 Trudu 1 táátáakujtv 74 Tilden 1 svalována 1 tanglový 1 VACLÍK 1 torce 2 Veresk 1 Vachovjak 2 svešování 1 Teurnia 2 trypetes 4 typizacním 4 Ulic 1 Táriq 3 Stands 3 trajo 1 spoluprodkoval 2720 technika 1 TEOCUICATL 1184 úredníci 6 Ulmenion 12 Srdjan 1 Trestnictví 1 Valmaggini 1 Urizielem 2 Unschuldig 3 switchportu 1 uy 5 trubkovitým 1 starPause 1 Theodmarem 179 syrové 1 Trehan 2 Vestou 20 Tricátá 24 soustavná 1 Utou 1 spoluredaktorkou 4 stínidlo 4 Thumeritzbach 7 Uudmäe 5 SPICE 24 stavebníci 5 statutárnímu 1 troodontidní 1 trifyli 1 tromboangiitis 5 stojánku 1 UTCBs 24 uctili 101 udála 1 Sprangra 209 útekem 7 Thyestem 54 Theodoru 62 stárne 1 Tabio 1 Tournez 4 veslonos 1 Tarabasovi 1 Ucitelkou 1 telovýchovou 1 Švancemberk 1 Sturnarase 5 tarzálních 2 Thurisinda 4 Svitacové 2715 užívá 4 ukrajinizaci 1 úsmevném 2 Tousey 5 Stárnutím 1 Sumskou 1 ténébres 1 velkokuchynská 1 Vasconcelo 1 thickness 1 tidálními 1 Unterschichtenprotest 1 tracený 15 Vercák 2 Taleva 1 Syrorum 1 Ultrazvukových 4 Tassadarovi 1 TAYA 1 trouchem 1 s turisty 5 Stadtwerke 1 Valgarisse 1 švihacka 1 Ulrichsreut 4 Vejcoživorodost 1 spätosti 2 Trenový 1 UNIAPT 2 vajíccích 3 Tarwater 4 tríclánkovou 72 Trani 1 tcltk 1 suzerén 1 Unigum 6 stratovulkanického 2 Stacym 1 transatlantic 1 Tobza 1 Tetraphyllum 1 Sunderm 1 Stepwgn 7 Vema 1 Tramvajnoje 2 Tekesu 2 Tammetsőőr 5 Topli 2 Superius 1 Šteinerovi 6 Stepanovyc 1 ulicou 1 Truchlozpevy 4 svetaznalý 1 Vettlovo 10 Tysmenicja 1 sunin 1 Tierno 2 Tresbœuf 47 spolocnosti 1 Váceslave 1 stoyan 2 sulfatidu 5 ultrabazickými 1 Turawa 1 Strassenjungs 2 Thurial 1 Ställe 1 Sprosto 63 vápencová 1 ulohy 7 Toužení 10 Utíkal 1 tricetipeti 1 varđveitir 1 Swynycze 9 Trifidu 1 Tenfa 2 uciwa 1 tsegee 12 Tešitel 1 Transarctica 1 šumarem 5 Toltécká 5 Timofti 82 trestal 2 Tomsem 1 straattaalem 2 tributylcín 385 Sutil 1 VDNK 1 Únosný 14 Spielbergem 3 TREJTNAR 1 tahqíqát 1 Stoßweier 1 Tsangarolon 1 tarnovského 4 Undrentide 1 Topolu 1 uitvoerende 1 Turksu 1 Tanik 3 Varúj… 11 vápenkou 320 trav 1 Tavsan 1 Tottiho 9 Valenzuela 16 Tejada 1 štarvického 2 uzavíraným 3 Spaluje 1 Taihoovým 118 Ulrike 7 únetickou 150 Talmud 4 Tanzanský 1 tokových 1 Urracu 2 svatohavelském 1 Stehlícek 4 Terl 2 tallinnskému 1 úzkozobé 1281 technického 1 Stoloff 18 úctoval 4 vepríny 8 tyckami 11 trockismus 1 Terita 25 Vervins 5 Ullevaal 1 Veserkafuv 6 Tollet 1 Trauriges 3 Tuczek 2 Ünye 5 Thalassoica 6 strašidle 6 Šrejbera 1 Tyleropappus 1 spikulem 11 Vanorného 1 Tsereteliho 10 úzkostne 1 Trmicím 3 süvepi 4 Stoickovem 1 uitslagen 5 trojklonné 10 Strassmannem 1 ütleme 3 Vadnoucí 1 Trávniku 1 splachují 1 ubija 23 Tiberiovy 6 trpím 1 ssužují 1 Thiamfenikol 1 SVETKOVSKÝ 6 Valentinianovu 2 Toletinského 1 s rozvinutými 8 tatebana 7 Starohrabecí 2 Tourla 1 spurtujícího 6 trichální 1 Suišó 1 Tají 4 umrlcích 7 tovaryšum 8 sporitelního 2 Souradnicové 41 Trybunalski 1 Texaca 1 Stogyli 1 Travelocity 6 stearoyl 1 Turkotatarský 487 spotrební 8 Steinmanem 2 tvrzeni 1 upozornovadly 1 studentkinja 1 Ulvoo 1 Troszyni 1 Vänortsparken 1 Turcanová 4 Thord 1 stavitelova 2 tpi 1 vasutall 36 Velkej 1 Stanislav 26 tlamovec 6 Starzynski 123 Stretnutí 1 tudium 1 Velikolukská 5 Tachi 1 Talvera 1 Valdovští 1 Tacuary 15 Strážmistr 62 stavením 3 veprovými 1 vedve 1 teritoriala 1 spanilost 4 Vangeru 1 Valsalice 3 tušovou 5 spolumoderovala 9 sýrovitý 2 Terciérní 1 Strnádka 1 Stauberová 3 Veloqx 11 ucenlivého 3 Ukitake 2 Suoni 10 Udi 1 Thamizh 1 Triquetra 1 Tmkabertu 2 Trevos 1 Transgresivní 40 tesnící 2 Ucel 3 Suraž 1 Tchaja 7 Vĺrt 67 Soundtracky 1 Tuchacevském 1 Verbanie 8 usporádáme 318 sterilní 1 Švédska a 1 Streptokokem 52 verouky 12 umrete 26 Straussem 45 Vernérovice 1 Svámímu 2 Srocení 1 spinorovou 210 Trebenice 1 Verlla 2 Travnicki 1 Srugackij 1 tartesského 1 Stugarttu 1 Turnfahrten 4 Umlaufoviny 2 veceri 1 vazopresorické 38 Tibenský 1 Verhaag 1 Tálské 1 splení 1 tropolizinu 1 trifluoramin 12 transparence 1 Štochlova 1 tabel 2 Thonan 5 TGD 1 Techies 5 václavské 10 úvazky 1 Ulfilou 50 Vecerka 2 Taglioniová 1 Stanuliškes 30 vacant 1 vclenenými 6 štetinkaté 1 spraženi 6 tadorna 9 Undo 2 Taškov 1 subdomain 1 týmol 5 spir 4 taverníkem 11 urcitelná 1 Strelivinami 5 Timaia 2 Vejpálického 1 šturmskoveského 1 Steaky 10 Uesugim 8 spanking 1 Vertébrés 4 TOLERANCE 2 Troupers 2 spolene 3 svárkovou 41 spotu 1 Spiritu 1 trídverovým 1 Triratnam 3 Sviet 1 tegto 1 SZSDZ 4 theósis 1 Tsuguhara 1 tríkrídlé 1 Stankowským 7 subsidiarita 1 Trons 1 srjedovjecnoj 11 špalky 35 Thinking 1 Subcomitee 100 turectiny 1 traqué 48 Tauber 4 Verdonk 1 VALAŠSKÁ 18 uchopením 8 totožném 1 Tasliçay 1 Takadžiho 9 trojlistým 2 Ulmasovová 2 Tsákonas 1 sujetové 1 Verwaltungsmäßige 41 Upravuje 31 toulá 25 Stredopolské 1 Unstillbare 1 Svarogova 2 tyckové 10 unitárských 14 trypanozomy 10 Strezivojický 1 statuario 1 Tišícím 1 Takeuciovou 8 ster 119 Tonight 11 Stairway 24 Verdes 1269 Šumave 2 Tetovaní 1 Stietkova 1 SuperSpeed 5 Uelzecht 1 thermidorský 2 Úspech 63 transliterace 2 variancní 1 svojem 2 theToRank 5 ulití 2 Strozzim 1 triangulacemi 6 Vantoux 2 Vescovana 1 Urvikiai 9 Trtici 1 Strushanov 1 trínohým 1 syžetový 6 ucících 13 uvažovaným 1 Starcenkov 1 sporophytes 1 Sultanem 3 stáci 1 ukolébání 2 Turkménska 1 transkriberade 2 Strízlíkovec 2 Stránovských 3 Stygijská 1 úvodníkár 15 varhanárské 1 Týrou 1 tepajícími 2 upoutávali 1 tsarines 78 textbf 1 vacah 1 takouvou 17 Szepesi 5 Tyrkysové 2 Unikají 47 tematiky 2 Utvoril 4 vecer 1 ulhaný 527 Šumavy 2 svatoaugustinské 28 Varadín 2 tchaji 1 Šušanjan 1 tíženou 1 Stonehall 1 Tequilový 1 tumuliferus 19 Suehiro 14 tlatoani 1 trojsedadlové 1 tentaculaires 5 Strapaté 61 SRAM 1 Utcák 1316 trvalé 87 sulfidu 1 Vaban 25 trenérská 1 Tykadélka 9 špehoval 1 Storstockholms 10 Tapiovaara 5 Theun 3 Velššpringršpanel 1 Spheneria 16 Valcíky 1 Valdsas 2 Stannah 1 unbegreiflicher 1 vaginární 5 Verným 1 Tavángarzamín 1 Spálenej 1 Uranopoli 21 úciníku 1 Sportful 4 Sterlitamaku 1 Talen 1 STLOUKAL 1 Svetimíra 2 tepala 23 Tik 1 tyken 1 Vetroplachmagazin 3 tanaity 3 Tidone 1 terminacním 5 triceticlenné 18 Tietjen 28 trístupnové 1 Unvanquished 1 Tommyknockeri 1 Vänge 1 theorém 280 Tobiᚠ7 studentuv 4 Sugarlandský 1 Sprovieriová 1 Tisom 1 Tolmaci 1 Strenitze 102 štetce 2 Uzapanyit 7 Tonti 294 úcelové 1 Surfaces 1 tepelneizolacních 1 veledíra 17 tisknutelné 445 souprav 1 Ukpeagvik 3 Tencí 2 Tinák 1 Spríznete 40 Svatojakubská 1 Tomilinu 1 Vejtmile 1 spatulatus 1 uzdravené 6 taháním 4 SPECTRUM 1 ujecenou 2 toboj 1 Szersznikovo 1 Tchuluo 1 spoluobvinených 1 spermiové 4 Vajcner 1 Sysolsk 1 súfistickou 478 spolupracovníky 6 tortura 1 Varsói 1 Täterbiographien 1 Sphindocis 41 Starenka 4 Tkadlecka 34 tester 1 teckován 1 Telésforo 13 Thudén 8 Vackova 71 tuhle 3 Varesnes 2 Uklízím 4 Šoupe 1 Ustanovenému 1 Timdong 1 Tract 1 stomatochirurg 265 souplodí 1 udangan 12 trapnosti 4 Taberyho 9 Valovice 12 ukrytému 1 Teologa 1 Suocasnými 3 Trckovský 9 tensor 94 tresk 1 Vallisoleto 11 Sübetej 1 Stockholmsutställning 2 verolomne 1 Stadelfeldschneid 1 Trömso 1 templatu 1 špatnot 12 Subotice 1 Tugemir 25 taekwondo 1 subdodávku 1 uwedenj 1 Torrepadula 1 tajajný 388 toxické 4 Stefán 2 strháváno 1 Verrzano 8 Tele 1 subjunktiva 5 Twaddle 1 unemployment 2 Tourgueniev 23 Steina 2 strzích 1 úpadková 1 Sporolactobacillaceae 2 steheního 3 Stárne 1 Triburu 4 Tallemant 2 Veneer 19 Trvanlivost 1 sugandhikam 4 trillského 1 Tápióbicske 1 Steviemu 1 Ulanenoberst 1 Tenggeri 3 SPEKTRA 1 Ursoni 6 Transportovala 40 Todorov 1 Tenadzeho 1 struction 3 terminologickými 1 Úprková 2 stárkovi 1 sylabickému 1 Sydneyc 2 Theillement 2 Trojanow 2 Tlalokovi 1 Starleye 2 štavnatkovité 100 tyrana 15 Uena 3 Ulehcuje 6 SPOLU 1 trzyniecka 2 Stoneyová 1 Speners 1 Spirillum 5 VAG 4 superstars 40 udici 18 taninu 1 Velemira 21 standardizovaným 2 Starejte 4 Tyrants 3 tufitu 1 Terciální 1 témož 1 utišovali 1 Steinmeissel 5 strašnejší 1 s abstraktní 3 Strangler 1 vbitá 5 Tureckým 3 synácku 1 Tlamsu 25 udelovali 1 Toropjev 4 Utherovi 2 Vašeliteratura 6 triptychu 1 Susumuimoto 6 starofrancouzsky 1 Tfiloh 1 trhan 2 s bratry 1 Tiszatelek 1 tschermakit 3 ungarn 1 torcitoio 4 Swarowsky 2 Suhra 5 Toolem 1 Suvorovými 2 Sternbergia 1 Taeniopygia 1 šplhadla 1 Turkutskými 2 Uttwiller 1 Verdeyaco 15 Tichánková 2 Themistoklovým 1 triacylglyceridu 1 TAED 3 süßer 1 turnéch 144 Valentýna 5 titiové 2 trávová 1 Trebolou 1203 tvrdé 31 Upsaliae 163 Urszula 3 transglutamináza 1 tremendć 47 tradicionalismus 2 Tauson 4 Southamptonské 3 Testacealobosia 2 Stowa 6 Svetlíkem 12 Spadal 1 starogréckeho 2 Tympanony 3 subjektivistická 7 Sovak 1 sternohyoideus 1 Vesnicce 30 thráckých 1 Štrosmajerák 1 tiwaz 2 Szebb 1 úmyslom 27 tetralogii 1 Vetenskap 1 Tigoianu 14 Titanu 29 Tiefland 1 Stöven 2 Starkillers 2 thaler 3 toledském 3 Targovishte 1 teplaku 3 Tumnuse 3 Urvillers 7 Tyrolean 2 Soussan 8 Tvashtar 1 Verbanskému 1 svetloplachý 13 trubadúri 2 vejcoživorodostí 4 tragica 1 Supernaturals 4 Štindla 5 Türkan 1 Tangjungu 24 unikátnímu 2 Územnesprávní 1 Trkavicí 5 stockholmský 1 testum 1 ukazetelem 2 Sydowiellaceae 1 velkofaru 1 Tyrrhénským 1 Szendzielarzova 7 specializováno 24 stouplo 36 Teschen 30 stredovekem 3 vdechnutého 1 ustavenu 3 svojom 14 svatokrádež 1 tutun 1 Tribbly 18 stabilizacními 77 verícího 1 Vahlenem 1 Staufene 1 Specialy 4 Troisfontaines 1 šroubovicovitý 2 Taburet 1 Strymonského 3 Tantáví 1 Toyotomi 2 Válim 19 Švédským 34 tm 2 spine 1 Talismanu 25 Stávají 2 Svahilská 1 teliospor 2 vaporetta 2 uvonení 5 Thordarsen 1 Vajnorskej 3 Tektoságové 12 vešákem 1 †Vasseuriina 1 stácecích 2 Tangieru 2 Vertolaye 1 Ústavného 1 Szamáka 1 spocitatelná 1 Squirmers 50 strežili 7 trockistu 1 spolecenskohospodárský 1 Tribola 1 Tetrathylacium 58 tratovou 8 spolurežíroval 1 stredojihu 3 Strejnové 4 subnormalitu 5 Troublemakers 3 štípá 1 Una 2 Tomaszówa 1 Starohradištní 1 Tuládú 264 tablety 1 ujarmený 1 století casto 1 ukladání 2 Untermeierhof 1 transpersonality 11 Uherských 3 Venusiho 1 Toohita 12 Swéerts 1 trempír 24 Titano 120 Taiwanu 13 Syne 1 Vénitien 11 tepe 2 Tegetthoffem 1 translokonem 8 úseková 1 Tostedtu 30 únosné 18693 vetšinou 2 Vaszaryho 1 Trítrubeckým 1 tütreke 1 TERINKA 1 Št 3 venatiory 5 varník 1 URNNBN 2 Vejklad 14 Strahl 1 Syrym 1 tanváná 1 statische 11 Triptis 4 Teplicke 2 tr?c 1 umom 1 trass 2 stalagmometru 2 tisovcovité 2 triviale 21 subtropický 1 tlít 7 Teniers 1 Tsanghinchi 1 svujprivátní 8 Suu 9 usmyslel 1 Vachdžir 2 Thanatephorus 2 TeenNick 1 svetku 1 Vanikuv 2 tholeiity 5 Sozialdemokrat 6 Trophime 1 Soupičre 5 Thorame 1 thulských 93 teroristická 1 útocicích 1 Trostnikov 2 terni 1 stopovkami 2 suchoadiabatický 1 staroizraelského 2 váhavec 5 ustroju 1 Šventežeris 1 Trocco 5 Suurlaht 2 Troeh 1 SUSS 6 Tödlicher 1 ulatus 10 tobogány 1 Telmana 1 uzavrli 6 Svatopluku 19 tyrkysove 1 Uršulinský 9 trapný 1 Surrealistických 1 vanská 1 treby 1 ulmeus 5 spínanými 1 Subame 3 Turanská 2 uracilových 2 Stojanový 10 strange 1 traskripci 10 Štítník 568 spoluautorem 5 svízelem 3 usmýkán 7 stejne 3 Urfahru 43 Varuna 1 Starostuv 1 Totomoširi 3 Turcs 23 Tenero 3 suvské 2 †Tylosaurus 6 Stratoniké 1 Stecenka 1 Vehiclar 2 ušen 91 Storia 2210 Strakonice 4 urbani 35 strávení 3 Svob 14 tomb 1 Subjektstheorie 1 Venezeula 1 Spretková 5 substriata 42 umocnen 174 Újezdu 1 spoluhostitelem 1 Surýnovití 3 suprafenestrou 2 Úderová 1 Vauxhallský 1 trápíc 1 subschéma 7 Synelnykove 3 Vannia 1 titanosauridním 1 ukjent 1 UCBova 5 spocinou 5 Trináctkrát 17 Ústrašín 14 Tassadar 1 Verkaufsargumente 1 spartiatum 1 Svetu 1 tübatulabal 9 Tatínku 4 UNISIG 13 veteránský 1 Superhumans 1 verecundus 24 Tání 1 Staunton jako 2 tradovaném 2 Umenia 40 vestaveného 2 spätantiken 1 uchazece 1 verejnokomunikativních 3645 studie 3 Ubiria 2 Teracový 5 utek 5 souvztažne 6 traveller 3 Urchan 1 Tikritíhose 1 ventrodorsálne 6 VCHK 1 velocipedistických 8 Trajánovo 1976 týkající 2 Tlachal 2 Tinggi 2 Spicheren 3 úcastná 16 útková 2 Tarbela 3 Váhový 4 Tiové 54 Sudamericana 1 uyup 317 Ultimate 3 špicatolebí 5 Šternberským 1 štetináci 13 Svatovítském 1 Treskoprsek 1 štetovnicovou 1 Strokosz 1 Ténos 4 Trpím 1 Stavitelku 26 ustát 1 Teirm 1 Uldum 33 sumi 1 Telewizje 19 TITE 6 Tóbijáše 2 suchopár 2 Töngi 3 svátostne 1 sznupac 4 Tzorvas 1 Theatermacher 2 stavítkem 16 stratigrafických 1 tríminutovými 1 Steniselma 10 veprovém 2 tinpots 5 truchlohru 1 Vecna 3 Vesaasová 1 tekuti 1 Vabresem 31 strhnul 1 sprchávávání 8 Vestmannaeyja 27 Spessart 1 spondylartróza 25 Tlukot 1 Tomŕs 7 Valihora 9 svetlehnedou 1 Tschachtlanchronik 1 symetrizacními 1 UOtex 1 Ullep 1 Tyechlowicz 1 Todsicher 2 Suitlande 2 striemi 1 Vaberák 40 velkoobchodu 1 Spirostachys 3 titoismu 1 Succat 1 Treixler 1 syndrom 1 umirali 1 Thizelin 1 Tichorecku 1 triterpen 1 Takkyu 1 Superforce 2 teplicka 8 Tahoeraa 1 Súlovej 2 telomeráze 1 taetrolens 1 symbolit 138 telefonicky 1 trenérskometodické 3 utužena 8 Tigranovi 21 ukazujících 1 Vanuccio 1 Tete 1 Spoluvlastnické 2 Transloy 11 uprchlému 5 Ugrin 18 Tauro 1 underpopcz 93 usmrtí 1 stipulacea 3 Teutscher 1 ‚umeleckých 2 Trauchburgu 1 Technogies 3 UserLand 2 s rozhraním 1 strasser 16 Šviha 9 Tiao 3 Tenderly 1 Tökölyiho 6 vegetacními 1 txtsoftsearch 1 Synaxarionu 22 Termodynamický 1 Urjanchajci 1 Vektorování 1 turnerskému 8 uchylovala 7 Valentinianovou 12 stovežatá 2 trítisícovými 2 Vedraluv 1 tabnabbing 34 Tió 1 Tristatrináctky 1 Tumbaga 138 Stolní 8 validite 45 utišit 4 Szemle 3 souzvukem 8 Sýkor 4 srdnatý 1 stauntonky 360 strategických 13 svlecen 1 tromeri 12 usvedcuje 4 Treslice 2 Vatertage 7 Soustredovala 6 UNLOCK 1 Toufa 4 Vanlioglu 2 Tetelestai 1 Strecen 2 szczesliwy 1 Takešim 1 Stepokurovití 2 tomizmu 5 Taď 1 Trebíci 6 Šucha 113 svítidla 1 Tverkta 1 vetrelcovi 1 továrníkuv 1 Takel 8 Trommeltauben 9 supratekuté 102 vekový 1 SSLL 1 taktyka 12 uctívacu 1 Vastapas 4 Topoizomerázy 1 subtalaris 1 Spede 1 vedením Morice 62 Trimekain 9 Thall 13 tlakovodním 9 vcelou 1 Stevovým 1 systematiki 1 TexC 2 Tanausu 5 Supertanker 1 venerina 120 trus 22 uhlovodíkový 14 spevy 1 Verchotinnoje 3 strážnímu 1 trnuch 24 Únikový 4 srdnatost 1 sovetologie 3 Tizard 4 svinka 1 strukturotvorný 26 Týce 1 týkajícímu 1 swahilského 365 stavitelem 1 Suonar 3 Tamako 2 Stylez 1 tenistovy 1 Taeniacara 1 Suzdil 17 Tiskarské 1 s ECC 4 Unsinkable 1 Tollarová 8 šustlo 1 u více 6 Vadehavet 1 Telegrafická 1 Sulinskiová 8 transsexuály 2 stejnobežným 21 Théorie 5 titinu 433 Valentino 6 Uranos 4 Thascius 1 Surralles 1 Sporových 1 svébytnejší 1 tullarensis 1 symplesiomorfie 7 Syfax 1 strojární 1 Tomezó 1 strelisti 10 starodávným 3 spletitejší 3 Stripping 1 tolikerý 11 štátna 15 štepky 1 Stracciari 1 VARTECKÁ 1 vedzu 1 úres 5 stereoskopickou 2 Verschickung 148 symetrický 1 Sturon 1 turcoinský 1 Tumedisco 1 Tamanaku 2 UDO 1 Tappoo 1 srstkou 10 tecce 2 vcitují 1 Torimodose 6 velkorád 1 vblízku 1 Tarkošová 1 Tetwán 5 specializováni 1 Talamcsi 2 Tnuctipuny 2 Vaquina 1 Tanaami 4 vagovými 29 Valka 2 Unibanco 2 stáru… 1 Streese 1 Trigano 5 Spinnerin 1 úzkoprofilovými 2 suplant 2 Subkontinentální 1 Szabovou 30 terminálním 1 Turczynek 1 Tvrdošíjnými 5 uspechaná 1 trihlavý 13 Stonawski 2 takyry 1 Tibbie 2 ukoncila 47 Tanasugarn 2 špindlerovském 2 Topps 1 temperamentneji 2 tabická 14 Strížovic 5 vápníkový 1 uváženému 14 spocte 6 Suncchon 1 Tsiamäe 14 Stankovic 1 Taxhamu 1 Thage 45 Versace 1 ÚKBP 433 Tichomorí 4 Tinbergena 3 strojopisy 1 Svinárkami 11 úživných 5 Tamaryšky 1 toolchainu 2 Ubodal 2 Tsybysheva 2 turnŕ 5 tete 8 Torkan 11 treti 9 transnacionální 1 strídati 2 Tubulifera 12 Türgešu 2 Tatroskou 316 truhlári 2 Tumucumaci 1 tuarežským 1 trentinská 1 Uchquduq 2 ujasnenou 1 sukcinová 1 Štemechami 2 vermi 1 spera 4 ujednáními 213 Symboly 5 strely 1 Vatard 1 vérünket 7 varixu 1 utáhnou 2 Tabankulu 1 torvum 1 svensonu 5355 strom 12 Stupárovice 1 ustawa 18 strýckem 2 stmartin 2 Telephonat 1 Treštska 2 Tasuievová 2 TORANA 2 Unitatem 1 Ústavoverní 1 Stilj 5 Sverdlovskou 1 Toužili 1 spojitelných 14 Urbanistická 1 truse 26 trvajícímu 1 Västerhaninge 1 steken 75 Šterboholy 1 ucimatu 1 sporžitelni 3 tavernu 1 Sponel 1 Telegrafisten 1 tritonem 19 trubickou 1 Tarch 1 Váženost 1 Venandi 11 Trichosanthes 1 Supchun 1 Theurerova 1 Válecném 1 Urvastské 3 Stawizny 1 stoparskými 1 Tausrety 2 Tichit 1 Stracín 628 Valencia 1 Tujle 1 vedušcij 16 Vedí 35 unární 1 svatokrádce 1 vegetování 1 Teolo 2 unia 2 stew 2 usie 526 Válecné 1 trpašlicího 2 tranquilo 1 Teplokrevník 19 štukatéra 2 vedeckého 1 Tatarkovic 1 Stigar 10 stratosférický 1 tyrannosauroidovi 18 Theobaldem 28 Späth 2 velkodustojnický 1 tabellata 1 Sprachgebiets 17 truchlících 9 Strapek 1 vastsverige 1 Szymiec 1 Toucheta 1 Tsabib 42 strojku 1 vampirologu 1 tntech 63 uhodil 1 spergularia 1 Vdechové 3 Tiegh 406 Stella 11 Teague 1 Speciell 1 unipunctata 4 Stillet 5 Svazijský 1 Starovickách 3 Straupitz 56 tutti 39 sousedské 1 štastnejších 29 Verchota 160 Spoluhrácka 52 spotrebují 1 Starosvetský 2 Terasách 1 Spirelja 6 Trapné 3 útulným 4 Varié 1 spájejíce 1 Svrhávaly 1 Svityce 26 svícnu 1 Tőőrakőrve 36 Špinavá 2 Spytihnevova 43 ujímají 18 Vesper 381 stráne 1 Valfenera 1 torchonský 1 Taschereau 1 supersectio 1 stafordširského 1 Valssasine 2 väd 1 Storjní 1 Spiethová 1 Tiene 1 Tsujitsuka 1 Udržíte 1 Stradivariano 1 Stephanidesových 1 Südnorwegenu 2 symfonika 1 Talentmánia 2 Uemacuovi 47 srbskému 12 tajícím 3 Tetraktys 1 Stubergera 8 Unicodu 1 svajba 2 Tunesi 1 Terciopelo 6 Tilford 1 tertiaria 1 Taney 14 synchronizacních 4 tuotantokausi 7 Tristramu 93 Ukládání 4 Toronado 43 Toxic 1 transvestitisty 1 übernationalen 15 Vc 2 Starostolci 77 Techonín 164 Úpice 3 terebinthus 9 Szigetváru 35 svetcum 1 Spínace 2 vepríkovi 3 ukáznenými 1 Touška 95 švýcarsko 2 Trichoon 1 Tenshaen 2 UAntrBiol 3 Svobodína 1 Tímúridu 3 valtírovského 1 Uglozera 3 vcerejškem 8 Trubkové 1 Ultraísta 1 Swienczyc 1 velectenou 6 váhovém 2 srozumitelnejšího 1 Toomyho 1 Trúdheim 12 Ungaro 4 Theodemirovi 28 tachykardii 222 ucilišti 2 Trondenes 2 Suboticka 3 támu 9 Suzette 1 spaltit 18 standardizací 1 Telescape 3 Trpaslicon 4 Tiffeny 4 trhový 1 Spilanthus 4 uzrálo 1 Tonicciny 2 Susperia 1 uhlokresbu 1 trojník 4 Tarahumara 8 Stereoskopie 1 Tetracme 3 Tauberbischofsheimu 8 Tiranská 1 Thoralda 2 Toddlewood 7 Uspokojení 2 vermikulární 1 Thermensis 24 Trojspolku 1 Uwajmir 1 Squeaker 4 Stredohrud 1 trojhlavému 6 Theuville 1 srábek 1 Šternovic 16 Vertus 3 trepení 1 utahickae 1 Tejmlová 26 uchová 1 Tko 1 Unterlixlau 1 Úložným 1 Tepanékové 1 unite 1 Sphoeroides 1 Tabarlyho 1 Syndabocken 1 vedeku 1 Stachovec 2 uint — 1 Troisgrosu 58 Suarez 1 Üchtelhausen 1 utlacitelem 31 Vaclík 1 stredoosé 1 tetrachlorplatnatanem 16 Vardanjan 1 Turovicích 2 Temminckove 1 stotvará 2 teletin 128 úvodem 1 Superiontové 11 spoluvlastníka 1 Szeifert 1 Uršunabim 75 úplatky 1 Stratellite 1 Stewartovým 1 Théma 1 Thit?u?wa? 9 Sulle 2 Spirina 4 svatotomášský 1 Stotricetiosmi 3 Varaždinsko 1 üheteistkümne 1 Tandaradei 1 Túpaka 1 uskladnovali 2 Tarbolton 8 várecným 1 spodobnených 1 ucimatou 3 Stitnik 23 TPLF 2 turnovery 1 Vaastem 12 Tylžského 2 STUTTGART 1 s Eliškou 301 tkáních 13 turkmenský 1 stabilizacja 8 starešinou 1 Tyessnowicz 3 Veha 52 ucenosti 3 topeništích 2 Trigonometria 88 ustanovili 1 Turcaninová 1 Tazové 3 taffeta 16 Stronghold 32 ukrižovaným 8 Svištov 2166 velením 1 UTEUŠA 1 Velkofinsko 182 Ursula 1 Veselyje 1 Submariner 52 tatarských 1 Ureterální 2 Vergons 1 uhlem 1 tecken 1 Šovcíková 1 Vestmannahavn 1 Talacovského 6 swapu 6 Susin 5 Tepuka 13 svatoštepánskou 1 územných 1 tristakilometrovou 2 Veolie 1 Staphylococcinum 28 stomatologické 9 turnus 1 trichloridem 59 spaním 1 sremský 2 tokáta 38 urychlování 1 Tetenhusen 1 vetonským 1 STÖKL 6 stets 1 telemedicínský 4 Stracheho 3 Taminen 1 Stitzer 2 tetramerické 1 telovedy 1 stlaceni 33 stéle 2435 vedomí 1 Teosofickém 1 Tandroy 2 Suđuroye 1 Synotligy 1 Soyluovou 1 taiku 1 TCSECem 5 Tomandl 1 spoleku 1 Tamago 1 Trasku 4 Stih 1 Souzaová 2 Šupinktka 6 tachografu 3 Šumšal 1 verbaque 15 utáhne 2 TROJHALÍ 1 Tegetthofuv 27 Špindler 151 Turka 1 Velx 1 uvadajícího 1 stabilizers 43 tužku 1 umiru 7 Štíta 10 Stockholmském 3 Stellen 4 sylabotónickým 1 szelet 72 ustanoveními 2 Svetislavuv 11 Tomaszewska 1 Toteil 1 s perím 1 telesnýma 2 Vecernij 2 Tvurcích 1 Trentmann 1 Soži 18 tektonice 5 symbolicko 152 Terénní 2 unvorsum 10 transparentností 1 superleggera 254 Trent 1 Vanisha 1 Vasilijova 1 urburér 16 uplatnené 1 Väntan 1 ÚSZKC 3 tónovanou 11 trigeminus 14 Sutomore 3 Strelcová 5 stopslova 1 trívrstevnaté 2 Vébrovky 5 Talleyrandovi 4 stykové 1 Ustrihla 3 ÚEM 2 stredoindické 29 Steely 2 Svobodce 9 stylistu 5 Stadttempel 1 Spolupracujícím 1 verđa 1 Tchila 1 Vaivodem 10 Statný 1 Tariz 33 Tereškovová 4 spurt 2 tunguské 4 Tratto 15 Strážovská 1 sporodermou 2 Trestenik 1 Tanatril 1 Uzbakó 1 unciálnímu 13 Spyta 1 typischen 1 srdžbu 2 Vaikem 1 SÚJCHBO 2 Údely 1 transavantgarde 1 Upilované 2 Vambera 9 utvrdí 17 Trojicko 1 trístránkových 2 suejského 7 spalitelných 1 vejt 21 Tio 2 Tailler 59 Vandeweghe 1 váznoucímu 1 spammerovi 1 Sriganganagar 25 Starty 1 Tugtup 1 Strojosvit 1 Törhönenem 28 Uvedla 3 Tevové 1 Togona 1 Twortlikevirus 1 težištový 7 Únia 1 Spisarových 256 suverenitu 1 Tserovene 1 Strejcu 1 stredoškolní 1 Tuckes 7279 ústí 1 urcba 1 Syringic 1 Švajcr 8 Upíra 1 tagný 1 Steppat 4 Vergelli 23 ucenou 4 vaibhášiku 3 Sturzkampfgeschwader 138 Špicberky 2 ssay 1 supervelké 1 Suchlica 4 Tsarukayeva 1 Sunqur 1 Torreonu 6 ušlechtilí 1 upevnovaných 6 thesálských 1 Suberitidae 2 tobiasova 1 transsaharská 2 Tabakgegner 2 Vaudremera 6 starosedelského 1 vápenského 2 Toddova 1 SuperCPU 2 Tríkrížového 1 Stenwinkela 87 ukrývání 8 Syntrichia 2 studijum 497 textové 17 Turceanu 1 Tusaayaksat 2 Suwariwaza 1 tvm 21 Ternopilu 3 Thornography 3 trubickový 1 strašínském 1 tenkohlavci 2 tripartite 10 Teleostei 1 SpySweeper 1 Teplomilnou 1 Ténakourou 1 Színházi 13 Tafea 1 tetrajodonikelnatany 76 spolupracovnice 104 velšská 5 venuji 6 Tiskla 2 tropári 4 Taurageským 1 Tritylodon 1 Urshacam 7 Swissmetro 8 vaišnavskou 1 veršováními 58 úzkostlive 1 Tamnava 2 Štenchlák 8 stríkaní 1 TRANSBUS 2 Táliban 6 Turopolje 4 Valgaudémar 7 Székelyu 1 špitálek 1 Tatiane 19 unesení 2 Straschitz 1 Tragödia 3 Spercheios 1 Verschuuren 1 Stereomyxidae 1 Tamasy 1 Transpeninské 4 stvrzenek 7 Štvanicí 6 troposféru 1 Taillebresta 1 Souvstažnosti 1 Ubouráním 1 Unglovasd 15 srdcitými 20 travicství 1 Tricrania 2 Vašeková 8 Vašatého 1 Topolciankách 1 Unikal 13 Thörnblad 1 váhonosné 4 Tširkova 2 Tovoli 2 Tayjetos 1 Svést 1 tarantuli 1 Tanegašimy 1 Vaníckové 1 Sturlu 2 Usacké 5 Vets 6 termoclánky 1 trebcínští 1 Tolšma 1 s renesancními 1 stupnovacími 1 Strihlý 2 Svatoštepánském 12 Strojne 1 staroneolitickým 1 Stamfordham 1 Störagéd 1 Urgonu 3 Urcujícími 5 Synnöve 12 Tallboy 224 velkokvetý 1 Stonov 2 Trest 12 usazenou 5 Tokovo 1 Veronek 34 vatikánským 540 tvrzi 1 Tadlow 1 Termálních 1 subsampling 1 symphoniae 22 uklonených 2 Subekumena 1 Texasanová 1 Ukradení 58 specifikovány 1 sustitutem 1 Sutých 15 Ursu 3 Úchyl 2 superúredníkem 1 Unported 1 Tanzlust 12 Toce 1 Vedelem 1 Theodotem 57 tlama 1 Trebonicemi 2 Suhardjono 2 triggers 4 Spiceworld 8 Stücker 2 SVTP 291 tenkrát 3 Statice 1 tropolonový 2 Spuriová 1 svedcícího 1 ühesäätőššőmőt 3 stalá 1 Strassenovi 409 tvrdou 3 spirochetám 1 užda 4 tížive 3 Sturmius 1 tailler 4 Takedovi 1 TROF 1 trebevicensis 1 Thajcích 1 Teramensis 3 spolykanou 1 usuriensis 6 Stobbe 4 Stepanovyce 3 Staffen 6 toco 2 Suisun 1 ultratrailmb 3 Unterbäch 1 toskáno 1 Stihavky 1 Uzemni 8 Tŕu 12 trampa 1 Stašaiciai 1 Stefanovicem 1 Trofimem 2 ultrazvuky 1 Tetrapodum 3 Telcsku 1 spolunocležníka 56 spokojí 1 Vepuauetem 1 SSKL 1 Tabouisovou 1 Tulisu 1 theistickém 1 Šulom 1 tocnicí 1 Staklena 1 Szeretlek 2 tríoddílová 1 Thepeugeotpartner 9 šrafovane 1 Swaythling 38 Spoluautorka 2 stereoskopy 1 Stanlein 4 UNITY 1 Stabwechsel 3 úcastných 2 veskrz 1 strednezobá 7 uzpusobil 35 Togon 6 SPŠT 2 umlcely 3 Tranter 4 subopposita 1 ‚Thora 1 Stebnický 4 Svýba 1 Tblisi 1 tunelari 73 vcelarský 1 Sunirem 1 ukojili 5 Souterliedekens 1 Tehlirjanova 1 Trojanum 20 SPOK 1 Timings 1 Tomografie 1 šourku 1 spásných 1 Tamajeq 2464 vedly 3 Stopford 50 Špála 3 špalíry 1 Velkovreštovický 78 Tokarev 3 Tabagva 1 Tournezy 1 Subduction 2 s jazykem 1 tenderizéry 7 transdukci 2 tretiho 17 válení 2 triazinan 6 Stadnicki 10 subalpínský 1 Starosloviensky 1 Srdínkové 5 Tardis 1 variétés 5 tisknutelný 2 taragot 2 Tolossa 27 subclassis 1 vardín 2 trpaslinky 1 Sugim 2 Tiitola 2 thiophanate 3 Varšavskij 1 Stroblu 1 trináctinásobný 1 velkoknížatech 1 Tratten 2 urvaly 1 trabaj 23 Spruce 4 Teresii 3 Spalanzaniho 3 Šugova 1 Teemalauantai 1 válce 1 Tetraplandra 9 SuperNova 15 teckování 17 stránkovacího 4 Speroni 1 Tiuliush 1 Tffanyho 1 Ssochkranaja 57 Turingovy 68 svorníky 1 Vaarjoki 15 tibetobarmské 9 ukáznené 1 Varnaite 1 tritóni 1 Varadínské 7 Spouštový 1 Uunisaari 22 spotrebitelském 1 Túje 2 Temnostní 2 Tajuria 6 Stormi 9 transitional 5 SPEDI 238 Újezde 1 szeretoje 1 úverními 1 tycovina 1 succubu 1 Telšajského 1 Tsalxaanu 1 trimchar 1 termoprádlo 1 swiming 5 Thorova 1 TOEODVEUG 27 tricítky 4 Suuwassea 9 Taek 1 tqala 1 traumatizoval 1 Uoaganská 1 uposatha 1 Vernanka 6 urbanistiky 25 sukulentních 4 spoluzakládající 12 Vavrínovité 5 vetovalo 2 utvrzený 1 Tacuko 5 thionová 707 úplný 2 torny 7 Statové 1 tingó 1 Švarcenbergu 13 torpédometem 13 staroegyptském 20 VarioLFR 3 spalovnu 3 Suminski 7 Veranda 10 Tunelem 1 Trezpazz 1 Údernícka 1 tomaru 1 Todorovic 1 stulpini 1 Timotens 1 Tvorbaloga 2 transkodér 4 Tungay 2 stavebnické 1 Titanosauri 2 Szepessym 19 Ústrice 3 strihacu 24 telefonum 9 trirémy 13 tryskovým 8 tatriku 2 toustovaci 1 Tlucenském 1 Systime 1 TRAKTORY 1 špäi 1 Svetlení 3579 spadá 1 Tetrabrachiidae 19 Starnberského 9 svazován 8 velkosklad 1 Ugarske 4 Uhynulá 1 Tumenaviatrans 3 tarantella 4 Sozialwissenschaften 17 šumivé 2 Torpédometu 3 synonymická 2 stern 19 Studnitz 2 Sysala 2 Spandaua 2 Thélin 3 TGOJ 1 Trilabit 1 Vertigans 1 svojou 1 Thalerem 1 trifosfátové 79 tagy 5 stýkajících 6 vestibulocochlearis 1 trogidae 7 uzlová 7 súhrn 4 trojtrnného 10 Vassilis 3 Takzim 3 Taspir 1 trela 3 úcesum 57 stolicí 2 ukocení 2 Staffelfelden 6 Svitel 1 Ursegor 2 uiowa 1 Thibautovým 1 tretího 1 s odbojovou 1 Štiftsko 1 Trible 17 Tamil 3 Vallašeka 1 Triteie 1 Tullinger 1 Turuwal 1 superobri 5 Trpasluj 2 Torocka 4 Urriello 1 Turnérská 1 Valsšsko 1 Stránovského 1 ujednaných 55 Tschechoslowakei 1 veksláci 3 Supe 6 stratifikacním 63 umírnenejší 2 Tambling 2 Tristium 1 supercisté 2 Uhlová 75 Taky 72 spekter 1 stigmátoru 2 stokilometrový 6 Trochtelfingen 2 stibarsenu 5 Strojnická 3 Thalla 64 svetitel 4 Teinturier 3 sovím 1 ullrichova 6 strašnými 34 Urachu 1 svazány 1 Teritorry 2 Tornami 1 TitanisPhoibe 1 StaatsTheater 22 Tuková 1 Tipler 1 Tizona 8 TPN 1 ugauli 2 Sree 1 Speakese 65 Thomsen 1 Tropowitz 2 Teatrologický 20 Taxonomický 1 Tonträger 1111 tématu 40 Türler 3 stangeriovité 1 vátu 22 Tezuka 1 treapta 1 transmiteru 1 Ungerovi 1 spálenoporícském 1 veelvraat 1 Tustela 1 Tricotronic 1 Tailúnovi 119 strýcek 1 universia 7 tloukl 1 Verdadeire 1 tlamickou 1 úzkoplodec 1 Vemeste 1 Tremills 1 toobad 1 szósta 6 úplatkum 16 Uhelném 1 Tamarii 1 Swetes 1 Tegoshi 8 Stuckelj 1 ulámání 15 Taverny 5 Vávrovy 1 trumfují 1 Štandarda 1 Vastas 1 Toscanelliho 171 ÚCL 1 Uriangpadaj 6 uctu 1 Stauden 7 Stupkova 156 startovalo 4 tápaní 1 tokajom 7 varany 1 Vejricha 17 Šubenkov 1 umlcoval 10 travertinový 1 vermivorous 1 vaclavce 3 TVÁRE 1 Valinorských 1 tarifitštinu 1 Tziavos 1 speficickou 5 vábila 1 studnitzfamhistory 5 tykadlové 5 tlumoceny 1 Svatošovka 1 urbárské 2 Touraina 3688 Tom 1 Suteu 21 trojcíslím 1 Susuman 1 Spisskej 1 tónovány 18 Tx 98 Tóru 1 Tartrazin 53 veškerými 3 Veslonos 3 umbarské 1 transput 1 Stredolotyšská 53 Tankista 1 Verebelyho 6 Terhi 1 Utleria 1 symbolizovaných 129 Tescoma 3 Stevanem 2 Stalgupis 290 Spearsová 4 Tacu 2 velkovýrobcu 1 Tudisi 26 syrština 1 Vedranou 7 Vemeník 3 Styrateg 10 Toshiro 3 Sriranga 81 Verdon 3 Veteläinen 1 Venoil 3 Trautmansdorfu 9 suborbitálního 4 staroegyptsky 2 spasitelky 1 tapiovaara 1 velkoformátovém 3 uštvání 1 TUGboat 45 Tudy 1 Špona 1 tolylamino 1 subspinosus 2 Universals 1 šustákovina 1 televízorcek 1 Swazilandu 1 Tokien 2 uruckým 1 VEST 1 tricátníkovi 5 stromálními 21 Stoka 1 Verolanuova 1 Truthem 1 taxonweb 1 Tilcoco 1 Treybalovým 1 Tikleška 37 svody 3 Tribádek 1 turistcké 4 Spárové 24 Vergiliovy 7 sypkou 1 Tamou 2 Strecita 14 Terraformace 12 trivia 3 veteší 1 Västerĺsu? 1 SZPB 1 unidad 1 undecimus 1 Syrrheonema 1 umlcovanou 16 Trofense 29 upravovaných 10 soustredovány 11 strašnické 1 upamšu 1 Uredinia 1 svudnickou 1 Uesslingen 6 streptokoka 1 syzigachne 1 Vasternuv 1 stutu 1 stredoúhlá 3 tragédi 1 stredonemcinou 1 Stanks 1 Terraršká 1 Thesdorf 5 Svätuše 5 Sperre 1 sprtovkyne 90 Titovi 2 Tolarovy 1 sprchá 1 Terrage 1 tonikové 1 Tremoulet 1 Stríbrnanka 2 Tresnay 1 Svetlemodrá 2 terapeutictí 2 ÚVR 1 stritez 3 spející 3 Teleginová 1 thynges 1 Tymotej 2 Taillepied 1 stoneballanceru 5 Strašicemi 1 Stunzi 1 Urbinovi 35 ŠVP 1 tuerto 1 spoluscenáristkou 1 Unhandsome 1 stigmatizovaly 1 Vánuša 1 ŠUVARSKÝ 1 s neprítelem 7 SZO 7 Trojovský 1 tablistou 2 trojpruhá 1 SubTV 1 Sprawozdania 1 Vavilovem 28 Tys 34 Spada 1 Stakal 1 Staedt 1 Taldor 6 Vestri 1 spodnickách 4 sypal 9 svarem 5 tymy 1 Stredoletní 1 trojruža 1 stromatální 27 Tumblr 2 tmužstev 6 Varolove 2 valivém 1 Trinitroresorcinát 21 totemy 1 Tadaie 33 upload 19 tecen 4 Šuntování 1 Spoliarium 32 Talbert 13 Velkopátecní 2 Tronboni 1 spodobneno 3 Suchopýrek 1 Suttomium 16 ústupkem 5 Urka 2 turkobijcu 1 Urioste 1 Spurrell 1 Varadeiro 1 surmy 2 Szonym 54 vdek 1 Spiromicrovirus 3 Trân 1 tubuloglomerulární 1 Tandovka 1 szivem 26 strojírne 3 spoluvládnout 1 Urdy 8 Tunka 1 Sternbergova 1 Udumbaru 1 šutnja 1 strongylé 2 tondu 1 téo 1 Superúterý 1 Thrive 1 Technogas 1 trojslabicných 1 Tambljevs 1 Spojemé 1 u digitálních 1 venerea 1 UPLNY 3 TRNLNM 1 subalpínskými 1 tkweb 1 Stadelem 1 telocvicných 1 Stückerové 1 symbioza 2 Steinsee 2 vatovanou 2 Tanida 1 Thuye 1 Vetosloví 2 †Tarbosaurus 4 Tanajev 11 Talapan 1 supermanštejších 3 Stradlinem 1 Vaalbara 1 Tarapotští 2 stevens 5 Stékají 436 Tešíne 1 Starostovic 4 štestí 2 Unschooling 1 Szurnyek 1 TEMNO 4 Vendsyssel 1 Traducerea 6 traktorovém 3 tratovému 2 Týdeova 141 Speciálne 9 správcová 1 Švédce 1 Trinaest 1 srííí 5 ucoz 3 turkanensis 1 Vaterrland 1 vázovitá 296 Teodor 35 Tatu 8 uvážením 1 tschechoslowak 19 Surikata 1 Stobera 1 Ubajdovo 3 Vasiliou 1 Turcismy 1 Tiškov 1 Sühnhaus 4 Turistu 97 Tešany 35 Träger 1 Tonttujen 1 Velvet 4 Vetrák 1 Sturmu 1 Tobianskiho 4 Stegnosperma 5 Spermatocyty 1429 srbské 885 tábory 30 tkaných 117 svalech 2 Usidlovali 8 Tomovová 2 stínidel 11 svetonázorem 1 švindlem 30 synagogální 7 Thir 26 Strugactí 2 spouštejících 1 Stosija 3 Sudovou 5 Tomoszek 2 Turským 1 Sülluste 1 úzení 2 trmických 1 szerelemnek 2 Tilesius 44 Terc 91 Velkomoravská 2 tahitském 165 textarka 14 stereotypem 1 turkologické 1 stánkuv 1 Stevovou 1 svorníkum 1 Spanglerovu 61 Ukmerge 1 suboceánická 5 Tudományos 1 ürttemberská 1 Triodoglossum 1 Varapajeva 1 Subsonic 5 tricyklických 1 Vercajk 1 Upomínkové 1 tvaružkáren 2 Tancig 1 Thymaináki 1 Thrár 185 techniku 3 submillimeter 1 švarecké 1 standarne 9 trojlalocným 10 ÚOP 2 Tortebesse 1 Stenostola 3 Vagabundi 1 Svetislavem 1 Temürovou 170 toalety 1 šrívidjové 3 Spasitelova 2 transcendentalis 1 Urvölgy 9 taktizovat 19 ustašovci 2 trístranná 3 Sprinzensteinu 3 turkestanica 6 Tywyn 2 spolupracím 2 Valands 2 uctivých 1 tyrnyx 1 úlisných 8 Veldhuis 1 Synandrae 1 Sylviecoyaud 1 Valeikupis 2 Uhrwiller 1 Valençy 2 Uvo 1 suiboku 1 Svent 429 ucila 10 USCG 1 suébského 1 Totgeburten 1 Stachanovcu 2 Turnauer 1 ullmann 1 Trasú 1 talmudistou 23 sporocysty 1 srecu 3 Štavnatku 1 Sternbachovy 1 stripové 1 starosloviencina 73 velšském 1 utišena 5 Sozina 2 thráctine 1 Takemotoza 2 Turbinellidae 2 tolštejnském 10 tlustorohé 2 Sysphincta 1 syntonie 79 Traxler 1 Streleckých 3 Timarioté 1 Šramu 1 Vetteseem 12 Tortona 6 vdi 4 Štedrence 6 taktovku 3 Štepána 1 THEFREEDICTIONARY 3 sterech 2 Sturlungu 1 Suylun 1 Trapizonyan 2 Strážovu 1 tsort 1 Strelovec 5 stotisíckrát 209 Tree 3 Velrybího 1 Sveltanou 1 ultrastrukturou 2 Veroniceae 4 tovarišstvo 1 študií 1 Špessartském 17 Tiskovým 3 stredoformátovou 8 Stiflerova 2 tatrováckým 4 Surreal 1 Treffurtu 6 Strankmüller 3 storu 6 šraml 2 Tatrovky 75 strediskové 1 Tagschmetterlinge 15 universel 1 spirochétami 83 srážkou 3 Ventas 13 Tham 2 Sporitelního 2 Stalderová 1 tutelarius 1 Šumavák 17 terrarum 2 tenatech 3 strihárna 1 Summertide 3 Troisieme 1 Suchojuv 1 ÚVZ 8 Trojdohodu 1 valitsus 25 supernovu 1 Újbars 9 spirálovitý 3 svetlocivný 2 Tímey 1 Sturniformes 3 stepanek 2 svraštelky 1 Taslicali 2 vetován 15 Stavebník 19 Vernérova 1 Spherus 2 stredokrídlý 8 szkoly 2 stultorum 1 Surnâme 401 Vedci 1 Väterlein 14 Strid 62 ventilátoru 4 Svojšický 1 TROCHTOVI 4 Veterník 1 tarpaka 2 Süleymanova 158 tvá 2 Telepatický 3 Starecku 152 spatrila 1 Súdán… 15 Turnier 1 Veggel 3 subredditu 8 Táborák 13 švabach 30 strašlivým 510 stihl 1 sulfanylovou 1 ulbarština 1 trimodální 8 Thorose 3 Trebarovský 3 tonneau 2 Tressé 57 süan 1 TheDiamondMinecart 2 Targetová 3 Vechtová 7 velmožské 5 uklonen 1 Trinksaifen 1 TWiiNS 3 Supercely 4 ukotvili 3 usouzeno 8 Stárka 1 spouštenému 1 vagonstrojitelnyj 1 Uniprocessor 8 stáhnut 1 Utmána 51 stavbyvedoucí 66 souradnicové 1 tipují 6 Vercingetoriga 3 tatícku 1 traktátového 1 TOBA 3 Tafolla 6 urtikárie 1 stipenda 1 uchváceno 1 UJAZ 1 sprejerské 2 Stergios 3 Töröka 1 Speckfeldská 1 Štulrajter 1 translatologem 12 uprednostnovaly 1 Traumkitsch 1 težkým 16 trávnicka 14 turovití 1 Usbourn 3 tribunská 79 temnote 1 Tayzíkové 3 Synthetica 1 StepMania 1 Tessenberger 1 uškození 1 tempii 1 Udržitelnosti 1 titmalau 92 stromová 302 tety 1 Trovarli 2 Ušetrené 1 tušící 1 Tarachidia 1 trckovo 3 stereofonne 1 Utenským 9 theodosiovské 5 Tušimicích 1 Tryvannstĺrnet 1 supraduodenalis 1 Ukrainsk 4 systematischen 10 Strakové 1 supplicationibus 1 Teresken 1 Vanahin 86 Umožnují 19 Suzukiho 1 sublimacních 1 Sulzheim 1 s Institutem 1 Tribalské 3 svolávané 1 tankietka 1 Toafot 2 svudkyni 28 tocitém 1 Svidercoschiho 16 upálených 6 Tahem 1 varivestis 46 udelovaly 6 Tuhnutí 121 Terrence 1 spachianus 426 usnadnuje 2 Valentimu 4 Uvedomit 1 Trešnovém 1 Sredkov 1 Störungen 1 Torteles 2 TNR 1 s britským 1 Tarvisina 2 Talmudický 1 usrkává 4 tolity 1 Stadeckské 2 Thonnelle 1 steracích 39 Úcinnou 1 Tainova 2 Trawniki 1 Taharkove 1 Štiblaríková 6 tín 1 Šporovnice 2 Urputne 8 Stivell 1 Tajisija 5 tulákum 1 staropol 1 Trackables 1 Šukan 27 spíná 1 Tirica 1 starlight 12 Strženka 3 vedúci 1 ulu 1 TRacker 4 Tarifne 2 SteepleChase 5 triréma 3 Tribalismus 13 Terzan 2 Uosinta 53 srážku 1 Tacumshane 8 syne 1 Tremmelhausenu 7 táboritum 1 Sulfurihydrogenibium 4 Tusset 12 tetivou 1 Šumská 1 Svjackou 1 StaraSilniceObec 45 údiv 1 Squalorových 1 Venjamina 16 transformovaný 2 vážeme 1 úmerným 1 Thermy 1 s astmatem 3 Versăo 1 Vereinsrechts 1 Subjekten 2 tréningy 8 Tušino 2 útrobním 6 suššími 1 Torriou 1 svítat… 499 udelala 1 Spaziergangs 1 Strojitelstvo 19 telovýchovné 1 Tutschek 4 ultracentrifugaci 1 Tussay 1 vendian 16 Težil 3 Sva 2 Vaucheriales 1 Számuzött 5 specifikovaným 1 Václavovský 122 trojúhelníkovité 2 Ujistit 1 tetí 1 TELDOR 29 uvolnována 130 užitecných 1 uvolnili 1 unárních 2 tancuju 2 svatohelenská 12 umeleckoremeslné 2 Storek 1 Veleslavin 1 Velkého 22 tretiligovém 3 VAJDA 1 Szélesmezo 1 Torresove 1 Trussardi 13 Stronsdorf 5 Strede 1 Spichiger 3 suspenduje 4 šúnja 2 Soutien 2 Ucihu 8 Varadínský 1 Šturskovy 1 Várad 22 sympatických 1 Tanderup 1 Udonóa 3 Šuterová 1 Thripshaw 6 ukin 4 Vermittlung 2 Svádela 1 Sustinet 42 Ungern 1 Tamma 1 Tintangel 7 uhlonosné 3 Urodynamis 1 Unpaid 1 Vavrincice 1 triadvacítky 1 timberské 1 strázni 4 Vaderovým 1 Tonovaná 2 težišt 3 Tchacos 21 trafikách 2 Thois 8 Sporka 19 vedeckotechnických 1 ubourala 6 Tretjakova 1 Stöberuv 1 Thaumatúrgos 1 Truecrypt 2 Tarasia 7 Štítinu 6 Stupnovitost 1 termotechnické 1 Šuci 6 Th?a 2 Stohlem 1 trichlorpropan 26 staplové 35 štítovou 1 Valachica 1 swp 1 techuaské 1 Temníková 1 Ulrichen 1 verlossing 1 Vallsasina 1 Tinternské 1 Štajgrova 3 Transformovna 1 Staatsarchives 2 Tanimbarské 1 Trompowském 1 tpev 4 tubulárních 1 trojlupenovití 6 turínem 1 Susne 6 vetvickám 5 Trásnenka 1 stisknutelné 1 Tyrolien 6 Švábenický 2 tenisti 1 Stext 1 veronskému 2 stornovala 1 Tetijiv 3 štukove 20 sporýšovité 3 uhloprícka 1 …Tyto 4 Sunitu 3 Troubadours 1 Tayalu 7 srocování 1 vedlajšou 1 udivili 1 Špehounové 1 symetické 3 ultranacionalistu 6 Spesivcev 1 Vercorskou 2 Thompkins 2 trojkolejným 2 Thulstrupová 11 ulovený 3 teokracií 1 sozuteží 1 Spinach 1 tmelených 1 tremšínem 1 transformovanému 4 Tomových 1 Teoh 1 tlustozobému 1 tetrachlór 1 táboruv 1 subjektivnejším 1 Vardin 1 Spott 1 vakotarbík 2 tabletovny 1 Tajmury 1 Suppliers 1 stateczného 13 Stanway 1 Šupitou 137 Vetrov 31 taxonomickou 1 tomic 24 steht 2 Tessaria 1 subdukcním 6 Verrill 1 thysbe 1 Tychonoff 1 Torgutu 3 Tertethi 1 umistitelná 7 számú 1 steganós 2 Standarde 2 vcerejšímu 1 Stetko 2 srdcovkovití 3 telah 2 Todorin 1 Toccatu 1 TVzone 2 tratmistra 1 Svobodnýho 28 transparentne 5 vábnicku 3 tulipánových 1 suplexu 700 Španelský 1 Tiefgraben 1 Taxandriamuseum 1 supercharged 1 Uživí 1 Tanquana 1 Tonel 1 uhm 3 Teckou 2 Timonova 4 umajjovském 2 transponování 2 squatter 60 Swings 35 studování 1 sterilizacím 3 Tempestu 3 trofickou 3 trapistické 1 stopkovitá 23 trvalost 1 Spč 28 trímetrové 1 Suttingera 1 Strítezského 1 velkooké 1 svetluškách 5 Statkevicová 1 traceurem 4 tecovaný 2 termochemická 1 transsibérien 15 universitního 1 vacc 1 spektrární 13 tunová 1 Thurio 1 s Benadikovou a Uhorskou 2 Troplowitze 1 vaja 1 Steinmauer 3 TRIS 3 Spiranthes 1 Tveria 1 Theodegotha 15 spoluveznum 1 Tidö 1 unimobunek 2 Svetm 1 teodiceii 1 Tápióság 1 Stefová 1 Tsuchi 2 trícipové 1 stripsy 1 Svetlocitlivým 1 ture 3 Ungersheim 1 Šušlin… 3 Vcelíne 1 Taceddin 1 Stiassini 3 Theisenová 1 tabletennis 4 Tientüe 1 Talentmánií 1 subnubilus 1 Sqrt 1 Terryfarrell 4 Špinky 1 stakeholderské 3 Teesdale 1 vechiul 2 šuamta 1 Vandoren 1 Speculativae 2 Sternkind 2 Vegarda 11 svetlovského 3 Tärendö 29 triviálním 4 Steevens 1 sTod 1 studANT 54 Sozanský 1 STRATEN 1 Terebintaceae 124 trímesícní 1 tanniny 2 Trene 4 Užij 62 Trubky 7 Tribeci 3 vastata 1 uhrické 1 Uzhin 1 Ucijamou 17 stolku 2 Venoma 2 Úny 3 Štoudek 1 Struga 2 Statocný 26 Universitet 1 txo 1 stube 4 Supermodel 2 Unheimlichkeit 22 uschnutí 1 titoisté 1 sublim 1 't? 1 Turteatern 1 Tiském 1 Vazovcem 133 umožnili 1 úvahovost 1 vanickách 105 vešly 1 vaket 40 Vavrín 2 Stanislavuv 3 Tostes 1 Tintamarre 2 uhloprícnu 1 Sponsl 4 Taďna 3 Stradovské 2 Tomistoma 1 Vetrovech 14 tokijský 36 tritia 16863 svém 5 Varnhemu 102 stežne 1 Uintasoricinae 1 Uzdravit 2 Svezozara 6 Stylodipus 6 úslovím 600 utéct 258 vášní 1 ttalattouri 1 Tockay 2 tsamiko 4 tolitu 4 transatlantickým 1 TurciTurku 1 tendencii 1 Teichstadiens 2 strakule 7 unašecem 3 Ufouni 3 Tunechod 546 vedom 2 trz 1 varying 1 Sverkersdotter 1 toreadorem 2 upomnialo 1 Sumners 3 Sturtevant 2 trylkování 3 uhlídá 1 telefoním 2 Tápiószentmárton 17 stužkami 945 Státního 3 stojíci 3 Treboci 1 Varašavy 1 Veic 4 Šumavským 3 Thannhausenové 1 Tormenta 8 Ursatz 1 tklivost 4 Tokarevem 1019 stoupla 1 Turupita 1 themových 2 umístitelné 14 Trenice 1 spirity 1 trezalkovite 1 Starmach 8 Sportovnímu 1 Spartané potrebovali 2 velsignede 42 tyhle 1 Syrotka 1 Uznávajúc 1 Šulej 82 újma 2 SOutež 1 Trencianskem 3 Tins 59 Stavel 1 swatýho 1 Speakmanovou 6355 St 1 tajovském 1 súkáše 2 Vérignon 72 Strip 23 Uherskohradištsku 4 tesarina 2 vetrnik 1 Tschernemblem 5 Stromanthe 1 s fluktuací 1 sršních 1 Tubificida 2 svetcovou 114 teroristický 15 Triumvirát 4 Trollhorn 10 translator 8 Svjetsko 221 Soustava 1 stínadelským 1 spektroheliografu 1 UCRL 1 Studnicku 2 Tallenberg 1 termometrickými 27 Spruance 1 VBSG 1 Vertumnit 1 TopGear 3 tenkohlavcem 10 Úsp 15 vekovému 1 Tredowata 2 SUF 3 Supplément 4 Tanyp 1 Thermopylami 3 Tarjiným 8 spouštených 3 Staropramene 1 Syahputra 2 taboparalýza 1 ubíjel 14 teatrálne 1 Surrealist 759 Turbo 1 uglunové 301 Szabo 47 tic 2 Svatojaním 8 Stahuje 3 strávníka 1 Thiénot 176 strelivo 5 spacím 1 valahilor 1 Tenochovo 1 spinoza 2 Suchonovu 1 Vdecnej 5 Terminátorem 1 Tahmasp 1 Stožecký 1 Sulióty 2 spamování 1 ukryte 1 vecerící 2 Suviste 20 typovém 4 Theú 2 Ucinily 1 Uvedomovali 2 Tralonca 1 Toyoba 1 Sulforhodit 2 tinamám 2 telomerázu 1 Vaccaiovy 1 Trutnované 1 svrhovanými 7 Stranovice 1 Sprachlebens 2 s vazbou 2 Talbotovou 10 transaminací 13 Trower 2 úrhn 6 velehorských 1 Steinboden 7 Tendera 1 Súrény 10 svetovládu 23 španela 2 Tokošová 2 superponován 22 šterbinovou 1 uzavíracími 10 Triunfo 1 Tangdy 3 stravovnou 4 Stupica 99 Trešnák 1 Šumly 3 tioua 2 Standfuss 31 unijních 2 Vassall 1 ښtek 1 travaríkovitých 1 Vallčes 1 staroíránského 1 tamaasa 1 velkodustojnické 1 Szedler 8 Stoikové 1 superbikem 1 vertikalni 14 Spurgeon 2 TaylorSwift 1 tardymo 3 svatojakubskými 1 Tsouriová 1 štáhlavská 1 Sulfatace 2 Trídicí 1 Theatervater 1 theophoricae 1 tahto 1 sportladen 2 staronove 1 Trecate 1 štírkem 1 spoluvládcerm 1 Toopkhaneh 1 Tjatur 3 Valdésovi 1 Umájjovce 1 Stenops 3 Velikim 5 Trebitsche 1 Težkoodencu 1 trojhlasá 5 sukcesivnost 1 Surey 35 Vážený 574 standardních 121 transformátory 1 supercrossu 2 Thomana 1 velenovskyanus 1 velicím 1 stalli 1 staropaleozoického 11 Šumšu 2 Trul 1 Termotechnika 22 Stona 2 Stevensové 28 tvrzeného 1 Trichotomie 2 Tudorovský 10 tatarskému 1 svištum 1 sugerované 1 svatopetrským 1 Tarthang 1 Téni 90 takticky 1 Veringenu 2 Telemarkové 1 Thaumatococcus 1 trigonometriclrých 1 Šprymberka 1 Sungkyunkwanovu 1 Tonguru 3 Streete 1 šughnánsko 1 Srdceboly 1 Taizaburo 3 Toropa 265 Vecerní 63 surove 1 tallinnskou 4 thunovského 1 Unbounding 3 Svébytným 1 spekrální 1 Uspechy 6 terciím 1 STRVXIT 1 Varanu 1 Tippin 2 Ulegin 5 subgenus 1 védismus 1 transfiguraci 1 Sulicemi 2 Tokcchon 1 Šumskému 14 splavuje 2 Veležralokovití 1 Strídace 3 srandista 6 sporulaci 2 tercbutyletheru 68 Vecernícku 1 Tregolls 2 SRISTI 6 Sztefek 18 trubkových 1 Stolicen 1 Svecnikov 8 Špoták 11 Tanzen 1 tmavomodo 17 svetru 1 Taganky 3 Varrick 1 szczególnym 1 torrentních 9 stvrzují 71 Thuna 2 Uyaniyor 1 Strachnovic 5 Václavický 3 ther 1 Uespi 9 Temp 1 tmavšíma 1 Szakacsitsem 1 Trichomycetes 1 unbinililnatý 1 Valecie 1 Súkenka 1 tremano 10 Uspeli 1 Stroboli 448 Stredozemním 2 tli 2 uštekané 1 Umbule 4 Tureckými 32 Tiepolo 1 staroskutecské 2 Šternberkovi 2 stlucených 2 štepánského 1 Szuszkiewiczová 1 Stavorenu 2 vendelin 30 Vecné 1 Šunkoin 1 spongiózy 4 tomar 42 Velicina 14 Spoutaný 1 Utilitate 2 Vaterovy 1 úru 3 Thibéry 17 Timok 1 spolecenstvev 5 Tolasz 1 Tarich 1 trívežové 1 vankomycinem 24 Twink 1 Tiliaceć 12 Statesman 3 Trilogium 1 triumpher 3 tlustolebý 1 trnkám 1 Sulfinizace 1 Táhlícek 8 spirálových 1 Uffholz 67 Šulcová 2 Tröndle 1 supergranulaci 1 Stourtonová 1 Valjalskou 1 Theophrasti 1 starohrabecím 1 tvrzíci 2 transsignifikace 15 svárecí 1 toulonském 31 strešními 4 strobilaceus 1 Vaguemestre 2 Umbraculida 11 Stedman 3 vehnáni 399 vetšími 34 Ulicní 1 Tishana 1 Umyvárna 1 stuny 29 Tuesday 3 stozrník 2 Spähpanzer 3 Syfon 5 Tulácká 2 Važi 3 tríhranný 16 Stavinoha 3 translucidus 1 Tikvicki 1 Tsagkarakis 2 toxoidy 17 spiritualismus 1 turgida 7 Suspense 1 stázovými 1 Unterrichtsmodelle 1 Tonischka 1 Spacehabem 8 sverenkyní 9 Truc 2 Takfarínas 1 Suceavu 1 SparrowHawk 9 Toalety 1 trojhraná 2 Tisonia 4 Verfassungs 5 trpytit 1 Trwyth 3 Tau 27 ÚCN 13 svírala 1 Trstenickou 1 Tinguv 1 sphaerion 102 ucebnicích 1 Štepinaová 19 Úcelová 7 Truckpark 1 spliceozomu 2 techhle 1 s nádrží 1 Špicberek 2 tanuganského 1 stredneziskové 1 ÚRŽD 1 útesotvornými 2 Straicher 6 Suntory 1 Verweil 1 Titanicitý 47 tašku 1 Šulda 2 Tovi 2 Valentane 1 uložitel 1 s konfiguracním 1 Suchohrdelské 3 Toshiharu 12 Tvurcum 2 valta 50 Tule 1 variantový 1 Tamošiunaite 3 stripes 1 Tenrecinae 1 steakhouse 1 sphynxu 1 TRÖGER 1 Szeuntezizna 2 Spagrud 1 Varadim 1 TAMADEX 1 Špicáckém 3 Ungnadové 20 swiata 1 uplácejícího 5 stredozobého 1 Tocenovová 1 TOBIÁŠ 1 Tegami 2 Stomu 1 Stojednadvacátým 1 Spitzerove 1 Taborim 1 spojujovala 2 Vchynického 7 strýckovi 1 Tierryho 1 tristriatus 3 trtinová 48 Valdštejnova 1 Tessieri 1 tucan 39 Vem 2 teréním 5 ulicový 1 turlo 2 Tawfika 2 Tsalkalamanidze 1 vestibulospinografie 5 tranzitorní 3 Uncínem 1 Varaška 3 Tijdemanova 1 Trailery 1 traperem 3 Steinfurth 21 špatnosti 1 Toxeovi 1 Strelcha 1 tuzrnajové 3 Vetrovských 1 srstnate 2 Taboăo 8 Valloires 1 Verrettes 2 stretol 1 Teszér 1 Torian 784 srdci 2 Utakata 1 strdimilovitými 6 Staphylococcaceae 2 Soyez 2 vertrauend 1 Thaller 1 tusculanae 1 Stephansturmes 5 tisícovkám 2 ultrakrátkým 47 válecku 3 Typhetum 4 Venéni 3 teplickými 64 triumfálne 2 trepanu 1 treauhänderem 2 Venzo 1 titulada 1 surinamensium 1 Taxíkár 7 Tyden 2 stiloj 80 subjektivního 23 Ukrajinsky 1 Toum 43 Tourcoing 1 Stearnsovi 2 ventaglio 1 Toaldo 22 vešteb 1 Spiegelhalter 1 Tasheva 1 Varieret 1 Stride 1 Šuky 2 textilákov 1 uhájená 5 Stricklandová 51 Uhlírský 1 talta 2 ukrivdený 1 Varhanik 13 tyfové 9 Sprcha 19 Uplatnování 13 standarte 1 Svámídžího 1 Tengize 1 upozadovali 1 Verchojanský 13 Tobiasem 1 Užitkových 1 Ulpenat 1 Terzijská 21 svetlocitlivé 1 stomilionu 2 Thera 2 Tónglíng 1 treskutém 3 Vaganové 1 Srandovná 2 urkunt 19 uctivé 3 ubocí 7 uveritelnou 7 usnulo 113 startují 4 termínovém 1 the Internet 3 Švermovem 2 URT 1 Thimarafushi 2 triologii 2 Symeonovy 1 Verbinum 3 Vecellinus 1 Vanness 1 Transferu 1 superkun 9 Tacivu 3 Taenarium 7 Taylorových 2 Theism 1 Timeberlakem 1 Štursovým 1 tanvaldskou 1 spoluúcastníci 2 troudnatci 1 uajt 39 Trockým 1 s predky 1 upádhi 1 Stroumsky 3 trískove 158 stream 7 starajících 1 Spevokolu 17 Ucnovské 6 ?aru? 1 symphomy 89 udáváno 1 trhaným 1 vcelovitého 5 Thézan 7 Stachel 2 veje 93 úplnost 1 Tuioti 1 Ukletnici 2 stredokornštiny 1 Vajnshtok 7 USADA 1 Triamifos 1 tricátýmctvrtým 1 streetpunková 1 Vasáková 1 Tesničre 9 Sternbergová 1 Vatellus 1 Vahlhausen 2 vectigal 1 svrhávána 1 temnonošským 10 Udmurtská 1 Stentu 13 úrocí 1 Turnseverin 2 Thawne 1 tredivu 1 tatraplán 10 Stierlitz 2 Syndykát 1 tírynthském 7 tklivé 2 Vaudevant 1 Vagaaru 2 Suvalkija 2 Trucuje 25 šumí 1 vegetavním 1 teplárenskou 2 Steelovou 5 utýrán 1 STYRACEĆ 18 Sušický 1 Tourtille 14 Tlapák 2 Vesterál 1 Úpický 1 Togans 2 Spezifa 57 Tykadla 1 Spražené 3 Specifications 301 vedecko 1 stretáním 3 tmavoskvrnáce 1 Staubcouský 1 Tiónské 1 vandrare 1 s tendrem 1 Straschnicium 131 Tivoli 1 Tuftonboro 1 Šugarová 1 Synagermos 1 themave 1 theiogalus 1 värvidest 1 Úhorné 1 Tesing 2 Tvrzová 28 Topolná 7 sprcháváním 3 trošce 1 Subjektivními 2 Trhákem 472 úcastnily 15 tasí 31 stator 3 tropus 2 uzamykatelným 2 veterinárská 1 velkoobci 88 Trochta 1 štálu 31 Vachala 1 Svájambhunáth 7 spolustraníci 60 strunné 1 Teafuone 1 Thuya 1 Tvrzný 7 successi 35 Tepelská 2 vainilla 1 Valurfossen 2 Únešove 2 taikomoci 1 Stössel 14 teodolitu 2 stronciová 1 velkosérioví 1 šupinkovitý 1 Vćggerlřse 2 Stromatopteris 1 Travinové 1 superiorního 1 Urlichkoppe 11 UAA 126 Stevem 1 terlipressinu 2 valdezii 1 Terborg 3 Traynorové 25 tlumením 9 transparentnejší 23 stum 1 Unifrance 1 variventris 1 Thorgersonových 2 Vanapagan 1 subprostorovým 1 ústavovacím 2 Suleticích 5 Toome 127 strojních 46 Vals 54 ucených 1 Syrence 1 Sylhetti 2 Spahiu 10 Uhrenholdt 5 Turkkilová 4 vanadové 2 staurotéky 5 Suhrada 2 Svezený 11 statistickému 2 Stourton 3 Strahwalde 1 vejírovek 1 subterminálního 1 SVETELSKO 1 Turového 4 ŠUM 16 tisknoucí 1 stacionaritu 1 Tšad 22 transakcemi 48 Terorismus 1 uvalenými 1 Szedlacseka 1 Teroristy 2 telenou 1 tambovským 2 spolecnostní 5 syntetáz 3 tarkan 8 stolicím 6 Thesiger 3 Syrianair 40 velekrál 1 spravdlnosti 1 Stollových 1 Thagaste 2 Thauron 1 Udáneckého 2 válem 1 Tuchomericím 1 TEOLOGIE 6 spolupracovnicemi 2 spartiaty 75 Stredomoravský 2 Tillenay 2 Sucuraje 1 Stydno 2 Varáhy 3 telefax 3 tantis 1 trídick 3 Stussy 133 splnen 6 spermatogonií 2 Tajnicka 1 Sukovem 2 tukat 1 Studioví 10 Superieure 1 teratogeneze 18 tisícinu 7 umiera 1 vesníce 4 Variables 1 Tvornica 1 Tippa 1 veltru 1 Ulbinský 60 Ugarte 126 Verve 19 Valtrovice 13 trezalkovité 1 Svištovke 3 Updikeovu 1 Vacínovy 4 superpadoucha 1 upražíte 10 Varnay 1 Taraj 23 tereziánských 2 tchajwanština 2 sycamore 3 Thijssen 2 STTV 5 Šuškarda 1 tryskomyšky 2 Strumice 1 UMBELLALES 2 Stasínovi 1 Verejnosti 1 tikatev 1 Választók 1998 uzlu 1 Svacica 2 Velechvínské 40 umu 2 thrix 1 válceným 5 spouštely 119 SYS 2 Tempes 1 tiebreaková 1 Umridgeové 1 strašecký 13 strnulý 1 telefónu 1 Urushihara 21 systemu 5 uplatili 1 vesikulárních 2 trnoješter 6 symbolizmu 3 tesnopisný 1 šoupák 12 Šuchevyc 3 Timoranu 1 Újezdských 20 strucnejší 1 unterricht 2 Sutherlandova 1 Trojvýchodné 1 stanleyville 1 Timi?oreana 1 verejnéjo 3 unionistictí 1 úrestanete 16 utichl 1 T… 3 Teplárenské 1 Tequma 1 Sunimoto 2 Talneem 5 tuos 1 syndikovaných 2 trávovitým 1 Šurdovi 3 Strunga 2 Valciuva 1 Springbots 3 Suslinuv 2 Vennecy 1 strojníkum 1 tristašedesáti 3 vertexy 3 Švihálková 1 trojprostorové 1 Swissarmy 1 taborjanovicky 14 uzlinami 6 TDRSS 2 Squads 2 stokorunách 1 spráhnout 23 Valdštejnem 3 Urgench 1 Taurien 3 Tiszalök 1 surbaharu 2 transaldolázy 31 utvorená 1 Spiegelmanovo 2 Vecnost 3 Vencla 6 steaku 1 troškových 1482 Správa 2 Szabatin 1 Štutgartu 1 Tížnicové 25 Sutnara 3 trhlý 2 Trmickému 1 ueberdauerungsform 1 Taibilla 11 stácecí 1 Tenemutovou 1 swiety 1 Twórcy 15 Tribece 1 Tölungu 1 Vardiho 1 Traxlerovy 1 Stránsky 2 Valorie 38 velkoskladu 4 uchovatelnost 1 Suminov 1 Tiedeman 3 tušily 2 Štefánikov 1 Valentinových 1 tem? 49 Török 56 véd 1 Tromboembolismem 1 Uytenbogaardtit 21 tenore 9 tutore 1 taušírovacích 1 Sphenobaiera 1 Teofile 1 SrCeNaCa 2 Stebbinsuv 1 Studiomix 2 sýrarská 1 therizinosauroidního 21 svarovacím 1 Vanhalových 4 Velaa 1 Úranovým 5 Taker 1 Ulzyta 4 Tehovicky 1 Tusci 6 Truong 1 Sveigbreen 3 tríkolovém 1 Steung 4 tágem 1 Stepanowa 110 ušetril 16 Tancíky 2 tramvajka 2 Tagbo 6 Stephon 1 Stuckou 1 techž 2 trichotecenové 1 toldou 2 Vazova 65 Šumar 1 urei 2 strychninové 8 Titanus 1 Suzuki 1 tobolinky 3 Speedym 3 Starfighters 9 Sypání 2 svirel 1 vBulletin 1 stíhajícího 2 spinakru 1 Toyneová 3 Stefko 134 usmrtit 2 Veiling 338 teritoriální 1 sroubenou 1 Thorncroftia 1 tessaiga 5 Sumara 3 Vajchr 1 tvrdáku 1 Tuzlanské 22 uklízecky 3 Syrucek 1 Taffelmusik 3 turbojet 1 Stredoamerickým 2 TheFreeDictionary 1 Subadresa 1 upredl 2 Tranzault 2 tracích 39 trojkrídlá 1 Spawnuje 17 trait 6 svacinku 2 vdavekchtivé 75 Sudice 2 udílecím 10 Spisová 4 Tertium 3 strojnický 1 Trattern 1 stridulují 1 Thillart 1 Tripehound 1 SoundScope 46 Syddanmark 1 Vapaa 1 sveticchovlis 6 Tabaková 48 Svržení 1 stopy bufoteninu 619 strategické 60 tašek 1 s nosností 95 Tino 2 teticka 1 ?ežké 4 Stefanus 2 valenciennes 1 tvrzenovité 1 Stavopres 1 Terbók 49 spravovaného 6 vekov 341 souvislé 6 Stínadelská 1 spaseném 1 Tetkou 1 stominutový 1 TEnto 1 Ušurovi 5 verbatim 12 velrybích 1 Tománkove 1 s polenským 5 Studnicka 2 Tanghin 3 tu 2 Tolary 3 urotelem 2 Subpixel 1 stolovacích 1 sublaevis 3 tabulární 1 Swiszczew 2 Tchaourou 14 starokatolických 1 Sulejmanovou 1689 synu 1 trato 4 Unixu 22 stamp 1 Szirmaye 1 Stolzum 1 velociraptorin 9 Spelkov 4 Swissmetra 67 Tamir 37 Toxique 1 Vaejovidae 1 Trenýrkový 16 Tamiflu 3 Uilenhoedová 1 Trittkopf 1 Tatroveporidní 1 strem 1 Svizra 1 Sykesville 1 Supersolution 1 Toojuuroo 1 StillJupiter 1 SQRTPS 11 Suve 7 stroboskopem 1 Vetoviensis 7 Statér 1 Toskánká 9 Vandičres 1 termai 1 vakhshensis 1 subseróze 1 velkoregionu 5 strumu 1 Taguciho 11 specifitu 1 transhumanistickou 4 sulc 1 tristibus 1 Stokorcový 10 uzemi 1 Tautliner 1 Tötens 2 Tachovskou 65 Svornosti 1 Swannové 14 Testosteron 1 trasovacími 1 Štukolustro 1 Thurberová 3 svatoreceným 1 terralit 1 vbraných 1 Taschenbergpalais 2 technostres 2 Thiébault 1 tyrans 2 Suzhou 1 subkapilární 1 táthagátu 1 trícetných 1 Stojnic 18 Svolení 1 superkick 2 Tajinami 1 ŠUTR 1 Thunderlipsem 1 ubica 14 ttl 1 Theromyzon 3 Timan 1 umlcenou 225 Starým 1 vágnerkou 3 Temüruv 1 suisset 1 Taschdjian 13 subvenci 1 treskovité 2 vermag 1 Sucessos 475 úctu 33 Synkov 20 sveracích 11 Souteskou 2 Vagantium 2 Úhore 7 úrokovým 1 Tetrevi 1 stredoseveru 1 Splendano 5 Topolská 1 Urapidil 92 Teží 1 Sulicice 2 trigám 3 Velkonemeckého 4 Sporthotel 4 Târnaveni 35 Traditional 8 synových 28 staro 1 timurovského 8 Todora 1 ulehnou 2 Takou 9 stávkami 1 Tisíc 1 Temporalia 2 Uwiklanie 1 Tarsau 1 Ulvsdotter 1 tatrických 2 štedrí 112 Vas 1 tjün 1 Veberuv 2 Spolus 1 tykvi 8 vazelina 1 Turnianskému 1 Spoustou 6 sporicího 1 Tatlowa 2 Trojánské 1 Teilerióza 124 úverové 1 Utracán 1 Ulzhan 8 Substantiva 1 Telemana 1 Superhry 2 toxikologickým 1 Teoloyucan 1 Uddevallský 4 Tafawa 1 Spĺr 1 Teixeirova 1 Vavrincovu 1 Vĺrfrukyrkan 3 VALOUCH 1 Staišiunaiteová 1909 územne 10 stojatého 1 trináctibitový 1 Srinagara 4 Stícanech 5 Sphaeriusidae 4 Treadellová 1 Turnspiele 1 Topolcnik 1 Treig 1 Transsexual 17 Vesmírných 1 Tsipiana 1 Utvorila 2 tripitaka 4 sterická 10 Sundstedt 1 Velepísní 1 Stereografický 37 ústavnost 1 Vetranovicovi 189 umelém 1 Unigeo 2 Valamo 1 vadností 1 Štukaturami 1 Tetétlen 1 starokrídlý 1 Temizu 1 Subuh 156 spálit 1 Tajnosnubní 32 Svan 1 sverovaný 2 Subnárodní 1 stranickostí 2 sudek 2 tridentskému 1 Tääll 5 trubacovitých 4 SUAS 1 superstudia 1 Urm 1 Tulenu 1 Szelemfi 1781 spol 4 tabaterka 48 sytosti 89 tetrívek 1 TARTAROS 2 tížní 8 stycnými 35 USAAC 1 studnuvodovod 1 Tuchomerice 2 sulfamethoxazolu 2 venalis 1 Václavovická 1 Tillikum 20 Tene 2 Vajcovka 3 Sube 1 transfázovou 1 Superrezoluce 1 STEINBACHA 3 Trojmostím 1 Trirémy 4 sporicích 5 stredomoravský 9 Srodkowe 7 trojjedinost 2 Štukatérská 3 Špringl 1 Spel 1 sytezátor 1 trimethylhydrochinon 100 ventilátory 2 velechrámem 3 Usopp 4 trolley 1 Španielskom 1 urubati 1 Valicha 1 trochoida 1288 spisy 16 Symptom 3 ucpaných 1 Svýcarsku 1 Sthenelus 3 Telese 1 Spiritza 244 ucebnici 2 sprengeri 15 Treu 23 Suvarnabhumi 76 urceni 2 symptomatologii 2 Teamového 1 Tarnay 2 Tréogan 5 úvalovité 1 trojclenností 1 Swartekillu 28 valencijský 6 uzdravená 3 Valašskomezirícska 3 valonští 1 Stings 1 toccát 1 starohčrvatskoga 2 Talebovo 2 Studneva 35 termoregulace 28 tanka 3 Untergau 4 Thermodesulfobacteria 14 Trubice 22 Tejnor 1 Transcriptions 2 ulpení 1 Topgrandma 7 Uummannaq 1 vennému 1 Swietokrzyské 3 trávíme 1 Ujezda 1 Starovojtové 8 Steinmeyer 5 Unhoštska 34 UVB 13 turmalínu 7 Uzdravování 1 Urpabilsaga 1 spoluje 1 Vachutková 2 Vedralovi 2 Turcovce 1 Strelenko 1 Taě 3 tolerovaný 2 Televerket 17 tony 6 Unije 5 subantarktický 2 ultimu 12 tonálním 1 unibw 3 thronum 25 Vertreibung 1 spiklencuv 3 Thumbnail 1 Vervák 8 Vernillac 12 Vácu 1 Taxonomií 1 Tyzzerie 14 Valnému 1 svetlesivou 1 Tibloc 3 Stifterovi 4 Tochon 1 Starohorská 1 TransnationalAssociations 1 Sreda 1 Tomichit 10 Vatekov 11 uzenina 1 Unicely 1 Trifala 1 Th? 1 Teplicum 1 Symphonisch 1 Trigoniastrum 8 vetévce 1 stereodialkomery 1 svolavatelum 1 venientes 1 ?u?ua 8 svára 4 Vávrovou 2 Unwind 8 universitetas 1 valounovým 2 Tiombe 10 úchopový 1 Starza 1 sposalizio 1 Strömgrenia 4 tixik 1 s Mostarem 1 transportovaným 1 ungem 14 Tant 1 Venatoria 6 stripování 1 trachytu 1 speziell 1 Vejzovic 1 Trifoncovski 10 tužebníková 12 tešínskému 3 svetrík 1 Tušlová 1 Találkozás 1 Trefulki 1 suplementaci 1 STAndard 1 Topasos 1 Toxokaróza 1 Stummra 2 stenocarpus 1 spados 1 Taizomuta 2 stretáváme 1 Stammersovou 532 Úspech 1 Sprawiedliwie 1 Tabacos 123 Španelsky 3 stohlavým 3 Valjeanovi 6 težebne 1 Strojmistr 1 Valentovo 3 Tannhoffs 2 Tshisungu 4 Thaisa 1 Toamak 17 upírky 1 tancujících 15 Tetralogie 28 Thomasova 4 Urdinarán 2 Tequillu 1 Spieckermann 2 studentica 2 Usumbura 1 Terosil 6 staronovou 1 Trichinellosis 3 turbínovou 3 Sychrovským 4 Tangenta 1 …vejminek 3 Toppler 1 Sulfurylchlorid 48 uzurpaci 1 StockholmStadshuset 1 Šunicová 1 Staditz 1 Turuchanském 1 sűr 14 Temnothorax 1 spiradiny 2 Szelényim 1 užitími 1 tlacové 1 velkodustojnící 38 Swieradów 2 trouchniví 4 Varící 2 Ventforet 5 susice 3 Tlaquepaque 1 umackávat 1 Turquía 3 Vény 1 Tussar 1 svaz nachází 1 trćkker 1 tahor 2 Toomer 1 testovánímu 2 stíracího 7 Vágai 3 syrovátkové 90 tištený 10 Udűn 12 tapas 1 SOVF 1 Šoustalovy 3 valchovacích 1 Teee 1 tenesan 2 Spálenému 1 Transinvestu 1 Stanžovská 1 Talpovským 8 Tancícího 1 Streptococcal 1 Ulearum 1 svätobenadickým 8 Špickou 1 vermehre 1 Tenczynských 7 tristaletý 1 Sužují 85 Spálov 9 Steela 13 tvrzištem 9 Toussuire 1 VEGETÁCIE 2 tautomerii 1 trichlornitrosomethanu 12 Turcianskou 1 triggeringu 1 svrchnejurského 1 strejce 2 Tuplovi 4 Telemu 1 Steegman 1 varhákovitých 1 Spiklenec 6 VER 1 Spravedlnostt 5 tempy 1 Tygrhart 13 uloupených 85 Štíra 1 Ul?ha 1 Urfaustovi 1 Sucré 2 Udegejcu 1 submarino 446 svetelný 1 Tanambourrée 1 vestfálem 1 uppsalském 6 svižném 1 Stromolezecká 10 UIQ 48 Thingola 70 veletrhu 1 Venec 12 úpadkové 1 theobaldi 6 špiónum 2 stromolezeckých 1 s Rosou 4 stolp 260 uložil 2 stakkars 7 Traumatické 1 vábníka 1 Tóró 1 tonów 1 Tolokiwa 5 TVK 6 Teia 1 Uralskými 13 tlumeným 1 trombonovým 2 Strelecek 1 tantriku 1 stopní 12 Terezské 1 Swiergocka 1 thakibo 5 Ticu 1 Šouša 2 Varovy 1 TeamLiquid 1 Trucující 1 Tungovy 25 špendlíky 24 Veligradu 2 Swtayhi 1 Tejnická 20 strážím 20 Václavovým 5 Terminifera 1 tircis 1 Údaios 9 Valcíková 1 Stanotas 1 Torag 2 Tápiógyörgye 1 švager 2 thyroid 2 Uzalud 4 Sporilovští 22 ubližovat 32 trpce 1 štastlivým 1 termitího 1 Tompecina 14 Tysonem 1 teriin 1 Tvirbutupis 146 Tremošná 1 Tasimaciligi 1 uridindifosfátglukózou 2 vdovkovití 26 tvrzích 1 Trottevieille 2 suites 1 Upfield 16 stripu 1 Termoluminiscencní 2 ucházejícího 1 Tlukow 1 Vejkladové 4 sverepem 1 uridiem 7 stredoškolacky 1 TGFbR 1 s prekvapivou 1 Verners 105 veškerým 1 velikomocným 8 Tohru 2 Spiegelovy 1 Trochoida 199 specifického 1 Trevaskis 1 Stanislave 1 Velkozálešským 3 Trautmannsdorfové 1 Tomšej 1 Transitable 3 Teletext 1 tajnostech 1 Tullyová 2 Sunleif 361 Veolia 1 Spisování 1 Systemální 2 Turboletu 3 startovatelnost 11 štukového 1 Turulova 1 ToyStories 32 stupínek 1 Štidiri 241 Tróje 1 Uvizlovi 1 Trlicovi 17 Tencent 13 Svetovému 3 tmavemodrých 1 sportsecyclopedia 1 uzpívat 92 stylizace 1 Sovákovi 1 Vaseda 1 Toonkunst 1 Sulikol 1 Tiskopisy 1 ulehnul 1 Svatošu 1 svetovni 1 umožnuji 1 urofagii 1 strategisches 1 stejnejmeného 1 UMENÍM 16 ukrajinizace 1 Triebelem 1 ultraproduktu 1 trinových 5 trialismu 1 Stanicka 1 Toppling 1 UEMS 93 teho 2 spolupodepisovat 1 usoudíte 1 supích 1 subchelátního 8 thinking 1 Ujhelyiensis 3 Tangarovití 1 Trinovantum 16 Tlstý 2 tigrinna 1 Tachyonu 1 Usipu 6 Tófukudži 1 tzeltal 3 superpartner 3 upozornováni 1 triapulmetrová 5 ústectí 1 Špandolíno 18 Šuláková 9316 svými 2 Šuriansky 12 Spréve 1 vclenovat 1 Talovo 1 s Královéhradeckými 387 Trikrát 2 Thrun 1 Trimeris 2 Svýma 1 transkulturne 172 srozumitelné 3 StarBev 12 Stonier 1 Torgošino 1 tabf 1 Svadilfarimu 7 Tiglatpilesarem 1 stredni 1 trencianske 1 verejních 1 Uyur 6 Tehama 5 špehováním 1 synsepalum 3 Turicum 1 s Národní 2 tripodu 1 Strachuj 3 Unterzentrum 3 Srdcovej 2 Trastamára 1 Venteres 2 Tvorive 1 Tibnáme 1 Threce 3 spinorbitální 2 Stehlíkova 1 tengri 1 ureafaciens 1 Verzichem 2 Supestock 95 Týž 1 Svatojiretínská 56 Tešice 97 tapiserie 3 Taxily 1 Srpatkovití 4 užovkový 29 Tassa 1 umožnue 1 syntázový 2 svjašcennaja 1 sumlenniem 2 Veaumorel 1 válcijú 10 suplenta 10 Stransky 1 ÚKŠ 1 Suzska 1 Trophic 1 Tülu 1 s první 1 tarcisio 1 Thasem 1 vanilinová 1 vandalština 14 ulomí 3 Stockovi 10 Togta 1 tüšiž 6 Trémarec 1 unicreditbank 1 synedriu 178 svatyní 1 Trautnav 10 štíhlostí 1 Vajnachské 113 START 2 Tuhamím 1 Steinkohlenrevier 9 uprázdnených 1 s faktem 1 UberPOP 52 Trení 37 Tundra 7 triumvirátem 47 tulipánokvetý 1 SvT 1 tentononcu 3 topidlech 3 terstských 1 Trnovského 17 Špalícku 2 Suorva 2 Steigerovi 2 Ústupové 1 Velokas 1 Stabigt 14 trackball 1 Varoise 11 Trélazé 1 Tarnowien 4 spirocheta 1 Vefi 1 termolisem 111 Tomahawk 2 unikamerální 1927 spojených 2 studience 2 Trvám 2 Strousberga 1 Tornyos 1 Teius 2 Staffelde 2 Vergis 1 Superbowlem 10 Terezínskou 1 uverejne 17 Uvedenou 200 ukradne 7 Subg 2 spasitelským 23 Tazio 1 terziánských 3 Trachanov 4 Tulpan 1 venove 5 TUM 2 Velidhoo 2 urgmed 1 syndepozicní 4 spoluvytvárely 2 trináctikolové 1 V?liusaqli 1 talosianu 6 Ulicná 1 Triptilodiscus 27 trolejí 11 timetable 1 Steri 3 Vaudry 1 Tomlinsonovi 2 urad 1 Szalaiová 1 svIjet 39 svýma 89 thajské 3 Tupacova 98 stínení 1 správneho 7 valdenské 7 Tanizakiho 6 úhorem 1 Vertikálních 1 ŠTÚR 1 thiamazol 284 stráních 6 uklidnovala 4 Švagra 2 Starkeym 1 tisská 1 ústupkove 1 Taaler 1 Vendské 2 stomií 1 trevelyanii 2 Tintítka 39 úschove 1 upového 1 Tanure 1 Velleyovou 1 Špickerkum 10 tycovými 1 s únorovým 3 sulfidický 1 Tenderem 29 sprádat 1 Ulriciny 3 Stanfordem 6 Starobrnenského 6 Urazil 2 subotická 3 valgrind 1 štouchajíce 2 Telegin 1 UWO 22 symplektická 1 Tzuovi 1 Strawn 1 Vcelákovou 1 Tmax 4 stycnému 1 spolecnická 3 Stiefvaterová 1 sysla 2 Unsin 1 Thonmas 1 Stockwellem 2 Tarnowskich 1 Švábovy 3 strojnických 8 veneno 4 tavnými 4 Švýcaru 5 svetcovým 1 sudeni 1 troublés 1 Spetz 5 teplovodních 3 Syridlo 17 Trstenická 4 Tchaje 5 stredomorím 1 tttaacctcctccagctctgca 6 Tafat 2 sumbawaensis 1 Vainuto 2 Šuialia 1 togae 151 Upírí 2 Stauferzeit 2 Stachijevic 1 toušu 2 Totton 1 Svatebcany 1 Tuglug 1 Štechovicku 1 Stoffwechsel 2 tsjekkisk 1 Tojanová 4 tretie 1 ussdelphy 4 Udával 3 Tungalagiin 3 velkostatkárká 1 Tonula 2 s náznakem 1 tresave 1 Urbikou 10 upadnul 7 vedeckovýzkumných 1 Ufano 2 Vágtapolca 2 Télégone 1 ústredný 1 Széllem 1 Tompkinsovi 2 Sumace 1 trojhradu 1 Ulanowicz 1 Tratilove 2 Stigonema 14 Thad 1 štrukturalismus 1 s necytostatickými 5 Tornes 9 trojrozmernými 1 tiburonensis 72 tematika 1 Tyren 1 Speezy 1 Sukcesivne 5 Trebišovský 622 VB 1 Tyrer 1 ujití 2 Španelkami 7 Švenger 1 Tereziánum 3 Trichys 1 tacklující 45 špíny 2 Tegethoffe 2 spolykané 3 Swayzem 1 Tajmir 27 UNITED 2 SPARTAN 1 svodbode 3 turkopolské 4 Svojanovským 1 srbkých 1 Tiltmedisem 22 utlacované 3 Spermatozoid 16 very 2 trhající 6 trimethoprim 1 svisleji 1 Svag 1 transneptunian 1 Sultánove 1 Terazijský 1 špuntový 1 vatsa 37 ustanoví 1 stríkej 2 umíráme 1 Valrisano 13 Sovetsk 1 strešovickým 5 Svinárský 1 superlidi 1 Veisz 22 spieva 4 spojkové 1 Spheniscosomus 1 termografických 1 Tilopou 2 uvahy 2 Thermodynamika 21 tenzorové 7 vestale 13 stabilizovaným 1 Tovland 2 Tripodion 21 Václavským 1 Valajanis 50 stredník 2 Vésigneux 5 Steterlach 1 Toyoace 1 stredokaliberní 9 úctových 234 táhla 2 Tomovým 1 Tarutino 6 tokugawského 2 SRFTI 1 Stelnitz 2 stolecku 1 Sumvald 1 Taráka 12 spoludržitel 286 vestibulu 10 Stronach 1 umelecko 2 Vacik 6 Svinci 1 Tannenberku 1 upytlaceno 1 subundulata 5 suspenzor 23 trojským 5 Stísnené 1 Transporteur 1 tezky 2 Spreti 1 spoluvydavateli 1 uživotnení 2 TNL 1 VDOD 10 Sudkovice 1 UMENÍ 1 Verudela 1 Tarsdorf 1 Svanteho 9 threadu 1 transgenem 1 Tianliang 1 Teumer 14 Umbo 28 Sueńo 3 Váchalova 5 Švábovou 3 Tutilo 16 temena 3 stélami 1 Venutti 3 uzdickoví 2 Taxodiaceae 2 Ureem 1 truhlarina 4 Tatinné 1 Ulybyšev 1 valck 5 Ujgurum 2 SWISSVAULT 31 Trpkoš 16 stínového 1 terpsiton 5 Teichos 1 Syngamóza 1 Squalicorax 23 strašných 1 Taufsteine 1 Teneste 6 Trójan 1 Thorenfeldt 1 vakuolovou 5 Spinettim 2 trackback 3 Syphilis 11 únosum 1 umjetnicka 1 Valtonových 1 Swooner 1 tizenhat 4 Using 1 Tristadvanáctá 3 Vereinswesen 9 Tartre 1 toporetmoi 1 Templeovou 1 Tanegašimu 2 Tjurin 1 Sprengela 1 Tomelty 262 tma 1 Uroložka 3 Ss 1 titulé 1 VANCOUVER 2 Stradúnka 2 Ungersberk 1 TRPASLÍCI 134 strmém 2 tercety 1 sskolnj 22 špalícek 1 Thakandhoo 18 Velikostne 8 Tindur 2 Ungernem 1 urothelium 1 vanad 1 Troegera 3 Vazokonstrikce 1 swahilština 1 Trevenenem 652 válecnou 135 týmovým 1 tenacita 1 Venneman 1 Tufu 1 velkovýsadbách 1 Transylvanie 11 Vedomosti 3 Tahirovic 6 ufologie 6 Stefanovová 7 svažujících 3 Stresemannovi 1 Vachan 167 Valašsku 1 technoparties 24 Valenti 1 Špráchalové 8 svažujícího 1 vampiric 2 Verstralen 44 Trenton 2 Tortequesne 8 Symfonia 23 ukamenován 1 targum 3 statui 64 tkánových 198 spoušt 2 Trhovou 8 Stemona 1 vanhan 18 Strednice 2 Tetrapterys 6 Stellar 2 Tlamka 1 tahi 1 Szmrecsányiovcu 10 suprafenester 3 †svob 54 tríletá 1 Uezwil 1 Thayawarte 1 Togarma 3 Tlustému 1 tkadlecu 3 Tramadol 1 Tennisklubb 1 Traieruv 2 Svalan 1 Temnitzquell 11 Techiji 12 Szeghalom 74 ucne 1 trabajar 5 vekovitého 7 uzenárství 8 Vaisembergová 1 Spolehlivostí 1 standartenführer 2 syrischen 1 Théophilanthropes 9 velebit 1 Uzavreného 380 stacil 1 Trinitichelys 3 stremchu 2 Spirydion 1 Štofcíka 1 teque 1 Theracra 1 unvd 1 trachtu 2 sympodiální 1 suicidarse 5 ubikvitinem 1 tuscanicus 1 Swanpoolu 1 Thijsovi 2 Sucharského 1 titanicitých 4 Veules 3 Spannmüller 6 Stilichonem 5 Südberlin 2 Valnirova 1 tritonymfu 2 telo… 1 starošpanelských 20 Svítí 1 Venkatesh 6 Štukou 1 Sperrmüll 1 thermes 1 Vaidava 1 sýrorodky 59 štukem 1 Staze 1 Tsountas 1 spodnímy 1 Toderasem 11 ušlechtilejší 4 Tóbiás 3 Tlacítkem 1 Spitterem 7 uvrženy 2 Strojetického 60 Thon 2 Tourdun 2 Taurogi 1 Stuetta 3 Vallensbćk 1 Tripterygiidae 2 Telejurnal 1 syrovatka 1 Traditioanl 12 Telramund 3 Talosianum 5 tapetách 1 vdavši 1 Stupniku 1 Šteka 57 Tschechische 1 Sttutgart 7 urychlovacem 1 ustlala 2 Špirocha 13 unterwegs 3 spojitelnost 35 Šp 1 stalagnátech 2 tucin 124 Správu 34 Vágnera 1 s doktorskou 1 surralistický 1 Tepliciach 1 Thöngwa 2 Souteživost 22 túra 1 s termálními 459 sousedy 4 Sparviero 6 Valromey 1 stolpenská 1 Stepy 1 Usbúa 1 vergessens 1 Totiková 6 Stia 10 SPADu 1 Tellinim 116 špice 3 Struník 1 stavropegie 1 trídicek 1 Thieting 8 Spytihnevovi 7 Tihic 1 s CDU 3 špilberský 7 Svachova 2 Umlaufbahn 1 veche 1 Veterného 1 Strojovnou 6 srílanských 1 verheff 1 vetovaného 1 Turkenu 2 Vaigentová 4 Teltscherová 1 Stenmarck 2 Tessinskými 3 Ulamertorsuaq 1 spongiceps 1 Úplet 59 Velociraptor 2 spou 1 trapistickými 5 strakoši 1 stepové 1 uciteljica 2 Tumbai 1 Väderstads 2 Theronem 17 SVETOVÉ 3 tramonto 35 Težkej 1 Undetakera 1 spoluzakladatelm 2 Tehelného 1 ThinkSport 3 Trdina 5 Trahoir 1 Timaníková 1 Stuckiho 570 terminálu 1 Stronciumapatit 1 uznávajícími 6 Šumavskou 13 Supremum 2 Taftových 2 Thutmóse 2 Trevirana 3 Stuckey 1 Vesihiisi 4 Telecek 5 tancovacky 535 Váhu 1 Toplianska 261 ښtek 1 Tertholen 3 Športové 1 Vágkirályfa 2 Thiosíranový 1 ukrývaným 2 Tattvópaplavasinha 572 stálá 1 vacnatcích 3 Suv 31 Vánocního 1 theby 41 tvoji 3 trojzpevy 1 tilky 1 TianSqGateTower 3 uzemneného 9 Suspended 1 tigrejských 1 tyjin 3 Urvi 29 tuhy 43 Strací 3 Vasara 4 Spankym 43 Trtí 1 strobili 2 Urçay 2 Suriauville 1 Stojnevová 1 Tyzlovi 1 sublateritius 1 tropilo 2 Tlachecí 3 Tichina 12 uakari 2847 Tehdy 1 Stastnym 3 Treffer 2 vanadzor 1 Velitelsko 124 stýkají 1 tufitickým 1 Tetrapturus 3 Swainová 2 Strombolského 1 techto… 2 Turzovku 58 Trasy 165 út 4 spolykat 1 thurzových 6 Tazbir 5 Ticholovcem 6 Velkovezír 2 táhnocí 31 vetveného 1 Tanzgeschichten 4 türkische 1 spinosaurovi 14 trojzvuk 4 trebechovictí 2 supem 1 týdennících 2 Théligny 1 Starhembergischen 2 Udegejci 1 Splendorelli 2 Svinkách 1 Uramaki 6 velelo 11 után 1 Ústupový 2 stihace 1 Ungnádech 1 Tippermuiru 1 texense 1 Triniu 1 Tiefschwarz 6 svrabem 5 Stephansplatz 1 Tschekau 1 Triumfans 1 Vasiho 1 Ujgurstán 24 Stachelbergu 2 Trashiyangste 1 Vertriebs 1 ubrouskách 1 vakorejsku 2 Theresienhütte 2 Sycomore 1 tonfou 1 Trastámaru 2 Švorcíková 161 trísloviny 1 spojitostem 2 Tunik 6 tercka 1 Tretjakova 2 svetlecervenou 6 tahiny 12 Torochtij 1 Tronach 3 vekerzugskou 77 Špinar 1 Trojmodro 1 SUH 75 vcelstev 1 stavbarského 1 Teasdalem 1 Stoneworks 17 Steinbecka 105 vektorových 2 Swierklaniec 1 s Evou 1 Väterländische 1 Sovinformbyuro 66 univerzálne 3 Trvalejším 1 Speedovo 1 toempah 5 Uchon 3 Stauntonová 6 Tetsuovi 1 tracheostomy 1 tepti 1 teratornu 1 Sprödglaserz 1 teatrofonu 1 statVaM 51 Sunbeam 44 Stratocaster 4 stanovištním 6 štítovém 1 Ticko 4 thynnus 102 Tradicním 10 stálicemi 1 stadstuin 5 Velikovský 3 Tenpó 3 Truš 4 Travensko 1 Trackways 5 Trav 1 Tjuvhyttjřnne 5 utkávaly 1 Stolly 1 trollími 3 Tylosin 3 teritorialita 6 Veru 2 svrchovanými 1 stabilogram 33 tisovec 1 úpechu 5 Stephensové 2 tergitu 1 Tynnanthus 1 theoryBalon 1 Tamarin 11 srstnatonosý 39 Uroše 1 Stumppovým 3 Tonghä 1 Spiderbait 1 Šumas 2 Stuckism 2 svetlovlasých 1 Važuzlem 6 szczecin 1 Svetly 1 strekovských 1 Stroskotance 9 stálicí 3 Uriela 1 tribendimidin 1 tamworthské 3 TCU 1 Tengi 10 Teenagers 4 tázána 1 Strauchmanuv 1 t? 1 Terezës 4 štvavých 1 Sztabu 3 Svitene 36 tiskarského 1 Typictejším 1 spoustit 1 Trubku 2 terminovat 1 Talawa 1 Stephelin 21 Taxila 1 Tattina 1 úatav 2 Stupicích 1 Vendéeští 9 Tachlovicích 1 Venecku 3 šrotovníku 1 s Erolem 7 Udírna 3 Štaif 5 subpopulaci 1 tajmníkem 1 Turkkila 3 Taftem 9 staroruských 1 Tesaríkových 9 uvrženi 3 tenzometrem 1 tonoplasty 1 tecky 1 Transmile 1 turectích 1 thuruth 6 Vello 1 Toušl 1 Tőutsimägi 1 Svilova 10 Vážnou 1 Streater 24 Vanura 1 Vanverst 7 vaišéšika 1 Vecgulbenského 1 Trankovská 10 Šrobárem 2 Suhescun 2 Stefina 4 studovanou 130 Tyne 3 ustanova 1 urraské 4 Valakiané 3 Tažená 11 sukem 1 tupejších 8 Vážila 1 Tiistai 2 sveucilišna 3 Ventolin 1 Travelata 764 svobodného 1 Tucem 1 Umínila 2 Üzbég 1 starej… 18 tmavocervená 8 systčmes 5 ucesané 1 Sundströmovi 1 uštepacná 1 Taxenbacher 26 Transcendence 1 spodnobádenskými 19 uvolil 1 triflyl 2 TRRB 1 Štadáni 2 Teluly 1 streetbalové 3 Steuerwald 24 Tojotomiho 4 Tkácovou 7 Tegin 5 uhýbala 1 Svatošuv 1 Sünderschar 6 Tajuplném 3 talárech 13 Tutsi 3 Varambon 26 spermatozoidy 1 Timbang 2 strelily 1 Vascăo 1 Sudeep 1 Stredohrotu 3 themis 1 Tuscarorum 1 spilitizované 2 upovídaném 2 Velicha 1 Tibuzio 1 Superdebaty 2 Velmez 3 váleckovými 8 Trieru 1 Tekupys 1 Suvedi 2 teleportacním 2 texasko 3 supresorového 2 Spialia 1 verkannte 3 ustrašená 9 Tripiers 1 Supernovu 4 toumeyana 1 túlala 7 verzálky 1 utkní 2 tisícikorunové 1 Vemac 22 Tobien 6 Thomaze 2 Tanalak 1 Szörényiho 6 vanilce 10 supręme 1 Šuvalská 1 sperlingii 4 Velocaru 2 Stenocolus 1 stereotaxí 1 tristaminový 4 teamové 2 Steinn 1 Szolopna 73 úterým 1 Thorovo 1 urbanickém 1 Unokáink 1 Trianel 9 Starkuv 11 Stredoevropskou 10 sztuki 29 verejnoprávním 1 Strobelite 1 Stephinger 1 terahertzovým 2 Talentem 1 vaasské 5 Tudorovi 306 titulky 1 s Katerinou 1 ukrivdenou 1 ??stupne 13 Trífázový 1 Tavenerovými 13 Spinal 1 této poslední 1 Vcelárei 33 úteku 7 veláry 10 udmurtsky 1 Valderrame 1 Toczko 1 Tuez 1 triangel 2 spatreného 1 Vejsadu 3 Sporické 2 Trápeza 1 Stapfetobel 54 trpaslicího 1 Trakupysem 22 úderného 1 Tchientinských 11 usídlením 58 suverénních 1 Vackárem 1050 váze 1 Tepechiapan 2 TRADD 1 teritorijními 1 tlapatých 4 urbanrail 19 umuceného 23 utopii 1 Trolia 8 Stygimoloch 1 Spegulo 1 Vecgulbenské 1 Steibachové 2 Verdelais 1 vetralo 16 trajektová 12 turionu 9 Sycorax 1 Sršen 2 svatava 1 spiderman 1 Verbka 1 Sumfest 1 Subaru 50 Trval 1 Turcány 1 staffelsteinskému 19 Targaryen 3 strefí 2 Stansdorf 114 Veselovský 2 Velkoobjemové 10 veganka 1 tokenizovat 1 toskánštiny 1 Syropoulos 1 Stríbrsko 1 Umierajuce 4 takana 29 Tedeschi 3 Thistles 1 Suharyo 2 Travesti 2 SYStem 39 tréninkových 1 velarizovaný 45 uvádeného 1 Trianaeophora 2 Švirec 5 Tinga 5 torzním 1 vécek 1 Umskaret 9 Torrigiano 1 trojstrunného 4 trmenech 12 tvárením 5 stereoizomer 6 trosecníkem 1 Stampeteria 7 Tq 2 superbos 1 upravitelných 1 úspesnou 1 telephioides 5 thi 1 timariota 6 tocenými 1 Vallenová 20 Stredu 5 spolunapsal 4 uríznutím 1367 SZ 1 Straßmanna 1 sparteinu 1 thiopuriny 1 Tammuzem 5 trojdobém 3 Stemmermann 1 Vcelikár 3 Timebunt 2 Valasse 2 Teyle 1 stonu 1 Tuwejtu 1 Tusspotová 16 Veletín 1 Sugaree 2 spirálkou 33 teplická 2 stove 1 vederbos 5 Uhrig 1 spolupredkladatelem 1 Svrcovu 1 Sulkem 1 Tomaze 6 Útechou 36 Tilman 9 tinského 7 Splitting 1 Tadjidine 1 Strumpet 1 Teuge 3 Trantorská 1 Tolnayovou 1 Stredovlnný 1 velevrása 11 Vei 2 Valetov 1 stamina 1 svitakkolegove 1 talál 1 težkotonážnost 1 Talentulum 13 Tanaro 2 vends 3 Varen 1 tuzemak 4 srstnatí 3 ústupnost 2 Vansteelant 4 Tyrolskému 1 Špackárnou 1 STRUNY 82 standardizovaný 2 Tajchman 2 Úradovny 1 superhrdinky 2 Urošovi 1 sterigma 4 Ülikooli 1 Terrasa 1 Surava 1 Straczekit 1 Švadlenky 1 Tourizm 1 veejnost 1 Urubu 2 trasováno 19 Tiwanaku 1 štoudve 14 spinosus 5 Uruguayec 2 Stahle 8 Thour 77 vášni 1 usingensku 30 Totally 8 umazal 1 Vávrovým 7 Tacomu 1 unvergesslichen 15 statistique 1 Troggia 2 STRÍTESKÝ 1 sylogické 1 ThorenGruppen 2 Sterculioideae 1 Venussie 1 spodné 1 Tampopo 2 Trolösa 9 Utiešenovic 10 švestkách 1 trojchlopnová 6 Transfery 7 sunutí 2 Tuvokuv 1 Synapscape 5 Sternschanze 1 swolani 2 válku 2 Ujazdowského 1 Trzebczin 1 Stadecku 1 Tamelander 15 Veselinovic 10 štíhlému 1 tabulett 14 thylakoidu 3 špagetovém 19 universum 3 telesovým 8462 Univerzity 1 Tennódži 6 Stanovského 2 starozápadoseverštine 125 správními 1 Tegenkamp 3 spoušteni 1 Tanajm 2 Telegrafo 254 Turecká 1 TUMULUM 1 Šutgradu 2 Stauros 1 spurbusy 2 súfijskou 1 vernulas 1 Umvelingangi 1 Thünenuv 4 umlátili 2 Sternwalda 1 Vahuküla 2 termomagnetické 381 textový 368 Švédskem 1 Sveinem 5 Tenix 6 Uninvited 2 suprapevné 1 Šualej 4 tero 1 verehrung 1 trilitu 1 Terabajtech 33 tepnách 1 sulfurit 1 stratocaster 13 steeplu 1 Uskocili 2 Spolecne 1 Vachruševe 1 Thioux 1 tresci 10 Turkova 2 Tartaras 1 Vacláv 1 Soupisech 7 Tatishvili 4 Tyrannen 1 s formátovaným 1 Steriphoma 1 tinkering 1 úchytného 1 Vercákem 2 Südam 8 Ulken 1 uhnízdením 2 túji 1 Thrórove 1 Tarantjeva 1 Streynshamu 1 Sydbrand 1 Stützerbach 72 Vancury 1 Suosy 1 Trtenicích 120 srovnal 2 Stafហ5 uzeninu 1 upevnili 4 Uzer 1 Stigralines 2 syndezmofytu 2 Ucihy 12 Tiskarská 6 spoluzakládali 1 velekozkušeného 539 špatnou 10 theropod 1 Temagamijská 1 Strletje 2 talan 1 streetartovou 3 težkopádnými 1 stroboskopových 1 Tobiaswolf 3 Unhošt 1 Tríkolák 4 tournant 2 Szunyoghy 2 Vetráku 1 sultanismus 134 sudí 1 Tolnštejn 1 Urbancova 6 Tila 14 strojírnu 1 Vercauterena 2 Tírthankara 3176 Uherské 44 soutežícím 1 Vasjukovová 1 Tomandlhof 1 Spindlera 3 Uruch 35 Teritoria 7 šustení 1 Sphenacodontoidea 1 Thomaschinski 1 Toodyay 1 Toubská 1 Turneraceć 1 Tenzory 1 transcendenntí 44 Srichaphan 1 Susije 2 stredoceskému 5 státnického 1 Taxham 1 Unverricht 1 Tianni 2 Stacking 2 thigmotropická 85 tvarovaná 1 Thomesen 4 Trafacky 50 strelná 1 teamviewer 1 Sunhee 1 švitorném 1 Stardi 1 Tielscher 55 spravedlivá 1 Suárezu 5 starostliví 2 Tršické 4 unicum 1 Tilquin 7 Stredou 1 tolerujícímu 1338 tah 1 Turnauem 1 strážovské 1 Steniacher 1 Tadešret 1 Trtílková 3 toboganem 2 Stevanovic 1 Strombomonas 1 Teynensis 1 Taiyonoto 1 Sovjak 1 svjašcennoj 2 Strigops 1 spareného 2 Suzano 1 Ubijstvo 2 spolecenství 2 trícipovým 22 THF 12 Tonje 1 Tallaferra 13 šroubováku 1 Unggirati 7 striky 2 Temerlan 1 Stasiecki 79 stresem 6 supplicant 1 Troufalá 60 tlumicem 1 Supikowitz 24 UNIDO 1 útulném 1 TEDxSalon 2 Stalingradskému 2 Tamošupis 4 Trutina 1 Štolbovské 1 špachtlovou 1 Toužilu 2 specalizovanou 7 územnesprávních 3 Sucharev 1 Szepesdaróc 1 Trapina 2 Sunz 1 SUCHOPÁR 39 Troubelice 1 Sulfolac 22 tome 5 Sratha 2 Touž 96 Strelná 3 tanja 1 TwinText 1 tavolníkovce 3 ? 6 tetrevy 1 thalamioi 1 Stonecipher 1 tríhostitelským 1 Sprachgrenze 5521 stavební 9 Ušguli 172 vážnost 1 Svanbäck 1 triseriální 1 teniotis 2 Stalpaert 3 Stilnox 2 uvolnovac 43 spojivek 4 Velkoknežny 6 úctový 1 Teixeiranthus 8 sršnovití 1 Trzesczy 30 vazebních 1 tonttu 2 Trojúhelníckovi 1 Tillemu 2 Thoracocarpus 1 Štramberce 3 Tehotnou 1 s Al 6 valdenskými 1 Sygietynska 1 ultravýkonnými 1 Synandra 11 svázanou 93 turbínami 23 Svin 1 Tepedelenti 17 Tamblyn 1 stadhuis 95 umožnujícím 5 unidentata 1 Stonožkové 6 Teshome 287 útlumu 11 Úholicek 1 Vahcuengh 1 trasportován 37 Tetína 1 tvoria 1 Tichooceánskou 1 transplantovatelných 1 Sulejovické 2 Sreco 1 Terezinské 1 Sumarokova 12 Tetschen 54 Vauclair 2 Tasnovicích 1 Toppisch 267 tropu 2 Subhadrá 3 Uvádenými 4 Steichenem 11 Tádžiku 2 tendue 3 Vakulovi 1 ukmerge 2 undecim 1 soviel 1 varaždinskou 30 trifidu 3 s napetím 1 SSDnow 2 valaštiny 4 Stanger 1 Stolzove 1 Tonecku 4 Stadtfest 1 VERNI 3 Translationum 2 ungedruckten 1 úchopech 1 Tretihorách 3 teracové 1 Übertragen 2 Uriasovo 1 stephane 2 správcovském 1 Szentvid 2 usmírený 1 thompsoni 13 Sousedy 37 uznají 1 umecký 48 triumfy 1 tercky 12 transakcního 16 spocítají 2 STRIGONIENSIS 8 tlapkou 7 utajil 1 Ureya 13 Suhag 19 Thaddäus 1 Stikk 1 Trzcinica 2 TRUMF 2 továrníkove 5 Vaterove 1 Spaniae 10 tenisovému 1 Spinhenge 1 Tsogang 11 Speyeru 442 Trh 4 stehn 1 stlacíme 2 Surýn 4 Šušanik 8 Steny 25 tapisérii 1 Tebisem 3 Stasiuka 1 u Ratají 28 tušili 48 sypavka 3 Tauko 7 Vennegoor 3 stromovitým 1 t?p 2 Tahmel 1 Tseu 1 tachtig 1 Spychalského 5 Útulný 13 transsexuálních 3 trímílové 2 Tschuschitz 718 strហ3 Ticsani 20 squashe 1 teploakumulacní 10 Traviate 1 Taliao 4 Uromastyx 4 Torridincola 97 Vehmanen 19 Tschechen 2 1 Vaudémontovi 1 Taschenbuecher 82 Tol 9 toxoplazmóza 1 trifenylmetanová 11 stáváme 1 Táncos 2 velmožskou 1 Ulmovo 2 uhlazeností 1 striptýzovou 30 Švarcava 3 Švemalis 1 Southerner 1 totI 299 Tucker 15 Terim 1 Stradina 4 Tetrachondra 10 Szkandera 2 veslicí 1 Tonouchiho 1 Strýckem 3 Terezo 1 Superpods 46 Tetovo 2 Souradný 134 svatebních 24 stale 8 tazetta 2 Tullyové 4 Toryum 2 toiletní 5 Telegeusidae 3 theresae 14 Trachyphloeus 1 ukázaní 6 Souter 1 Takasakijama 37 Stežery 1 Tomislavgradu 1 utvorím 1 Spacáky 1 vehis 1 Stueber 1 Thaver 5 stavebnicí 2 s Otto 6 Tchine 1 teplokrevníkovi 6 trakturu 34 újezdy 1 Velímského 1 Urgella 1 Tvalcrelidzeit 1 Štovíky 4 Soupe 1 Sueton 1 s prostitutkou 15 úrednickém 1 vápnomilka 1 uzupelniona 1 stahnu 5 Staver 2 sumecek 6 Újezdské 2 Suzakumon 1 Srbochorvati 2 VAA 1 Steimlemu 1 südböhmischer 46 trailer 25 Turcianska 1 Stanovme 6 Štepánovského 670 uzavrená 1 sviniveška 1 Stephaniho 4 trichurióza 5 Trylek 2 Tiesenhausenu 1 suffragánem 8 uspávacím 23 Tomková 1 Strizzel 3 Surfari 1 stroked 1 vakuotlaková 1 Tringo 12 Trumpová 19 Vakcína 4 trouchu 3 Vandor 1 startDocument 1 tlustolisté 4 Toppino 1 Vanade 1 Tarcsi 44 Týros 55 sympatizanti 1 stretajících 1 UOAssist 5 topnic 5 Stalock 2 Stubenbastei 2 unetické 1 splétány 1 übe 1 syktyvkar 1 Vensov 405 soustredila 2 sporádaní 1 Trebješica 16 Vázaná 4 uskrinutí 9 tchienu 1 Technick 25 Szidi 3 Vasina 1 Szextárgy 3 ultime 3 Tacuoki 10 Udelat 1 spoluinterpret 1 Superbránou 11 soutežnímu 2 tajnustkarení 2 Uberach 1 Vaibhav 1 špiónech 6 Talentovaná 4 tátové 27 Turnverband 1 uméleckou 1 Stuntmaster 712 Utah 6 TwinSpark 7 Turnovo 6 stroužku 1 Trekingová 5 Sulmierzyce 1 Tangshan 1 Vahenurme 4 Spirálovitá 9 Velcice 1 Stanislawice 6 subkontra 1 theurgie 1 Vernik 216 Šubrt 4 S Panathinaikosem 1 Vauvoja 3 svetélkujícím 7 tendencích 1 tríselném 3 spoluzaloženou 1 spárovacka 2 Šúacha 2 Tüa 2 trofií 1 Tarazone 1 vazokonstrikcních 1 Valvanová 63 Štepánská 1 Vértesszolostol 1 tyrosinovém 1 thenews 1 Takedova 1 Szikla 1 Subarevová 15 UltraSparc 5 Tomofumi 2 SPCR 30 Svépravice 1 Surlej 2 Steinhausovi 3 trikotýn 1 Tichondriuse 1 Torpanne 1 Terillos 1 TCHČQUE 2 Uderzeniowa 2 Teplovod 1 Trudén 1 vbehnul 1 vajra 1 Tapestry 11 upalováni 1 Svedbergova 1 Toleskim 73 stereotyp 1 u klasického 1 Szufa 4 Thia 2 Tankredove 1 Turbott 1 Vangede 4 Vadvetjĺkka 1 Spathiostemon 1 Tîrnauca 34 svetitelem 3 Taclobanu 11 Vaser 1 trackballum 1 Stojkem 1 Štástném 1 Sulínské 3 Tięn 1 svatodivišských 119 tlupy 1 Valfarem 1 Sraženinu 1 Transmited 1 Ullmania 1 Sovicille 157 užšího 2 Torcenay 1 toddy 1 Šravaku 1 Trichiuridae 1 vázicka 28 telcského 1 Steinleinerbach 9 stocených 1 Stejjer 1 tschechisher 1 synodalitou 76 telegrafu 1 uríznutým 2 tisknutá 15 Trýb 1 Ukoristenou 3 strádal 6 Stephanandra 14 Toxafen 18 štýrským 1 Vadier 5 stokovou 5 tolko 4 Touvier 1 universytet 1 unkovický 1 stredopravicove 2 úhloprícného 1 sulfátového 3 Stealheads 34 Teltscher 3 strojenosti 5 Šturmovi 8 Stríbrozobka 50 staroslovenské 1 Ukana 1 Standishovi 2 Tangles 49 Trees 3 stínovaný 2 soustrastný 12 thajštine 1 technológiu 1 verbovaly 7 Ulufa 1 stevarcií 1 teit 1 Švéta 24 stínových 4 ustrelí 1 Szepesszombathely 1 Valdoccu 1 Systematických 2 Strasserové 2 Ulvaceae 18 Transmission 1 Vacíme 3 transponující 6 Tarantinem 1 Týly 7 strpí 167 Ulmu 2 svinovského 1 stredopravý 4 Svatokrížská 4 Staubbrücke 1 Unnsin 1 stuholetky 12 Stahování 2 thiazolidindiony 2 Svárení 2 Stankovic 2 uctivejší 1 Ulad 10 Spiritisté 1 Vesalou 1 Surfes 2 Vakukok 17 veterovská 22 vázách 1 Transference 1 superhrdinek 10 Takticky 1 turnovska 1 superactive 1 tablut 21 Úpské 1 umjeršcim 5 Švecem 4 uroporfyrinogen 1 uchvacován 7 šupinový 1 Trajectoires 1 velmice 5 tutela 1 Spartacus… 1 űžnyj 1 urazené 1 Vbocené 3 SSUAR 1 Stichbajonett 3 udírnu 1 Takatahiro 1 trpaslíkama 3 Trefné 1 Tsillas 4 úrodách 1 Tennara 1 Tendzin 1 Tichoniem 1 spasticite 1 USVACUM 1 s bankou 65 Strašnická 1 tropis 1 toelgi 1 Teuberu 90 Tiziana 2 Vejsady 1 svatoblažejským 27 Tamilských 2 Tršická 47 vesmíru 1 tőndiőtt 24 UUCP 12 spathulata 7 stíhaní 1 STRK 1 VARIORUM 1 spráhle 1 Valdambrino 1 symphonisch 1 strkanicím 1 šterkonosná 2 Valojoulx 3 Tetropium 1 Trottičre 42 Trautenberk 1 souriante 1 VENANCIO 9 trílalocnaté 1 Usagre 3 stresujícího 51 Suur 39 urcujeme 3 Tschernigg 5 Ucebná 1 Svalbards 2 stínovky 1 Tenrikyo